Белки взаимодействия гамет как факторы репродуктивной изоляции криптических видов рода Littorina Férussac, 1822 тема диссертации и автореферата по ВАК РФ 03.03.04, кандидат наук Лобов Арсений Андреевич

• Лобов Арсений Андреевич
• кандидат наук
• 2021

Оглавление диссертации кандидат наук Лобов Арсений Андреевич

Введение

Глава 1. Обзор литературы

1.1 Несовместимость гамет в видообразовании

1.2 Подрод ЫегИгета как модель для изучения микроэволюционных последствий несовместимости гамет

Глава 2. Прекопулятивные репродуктивные барьеры в группе криптических видов моллюсков подрода ЫегЫгета рода ЬШвгта

Глава 3. Идентификация видоспецифичных белков взаимодействия гамет моллюксов рода ЬШвгта

Глава 4. Идентификация и описание параспермального белка ЬОБР

Глава 5. Полиморфизм ЬОБР как фактор репродуктивной изоляции моллюсков рода ЬШвгта .41 Заключение

Выводы

Благодарности

Материалы и методы

Список литературы

Приложение

Приложение

Приложение

Введение

Введение диссертации (часть автореферата) на тему «Белки взаимодействия гамет как факторы репродуктивной изоляции криптических видов рода Littorina Férussac, 1822»

Актуальность работы

Большинство современных определений понятия «вид» основаны на представлениях о единстве видового генного пула [1-3]. Например, Э. Майр (1974) подчеркивал, что фактическая или потенциальная репродуктивная изоляция — это главный критерий вида [1-5]. Соответственно, основные модели видообразования (микроэволюции) описывают потенциальные способы подразделения единой генетической (видовой) совокупности на относительно или полностью обособленные группировки [1; 2; 5].

Механизмы репродуктивной изоляции подразделяют на пре- и постзиготические [1; 4]. Считается, что ранние этапы видообразования чаще сопряжены с формированием презиготических репродуктивных барьеров, а постзиготические проявляются на более поздних этапах дивергенции [6-10]. Например, в модели аллопатрического видообразования для появления постзиготической репродуктивной изоляции между близкими видами птиц понадобилось не менее 22 миллионов лет дивергенции [1]. В симпатрической модели, напротив, формирование репродуктивной изоляции предшествует дивергенции и зачастую может происходить в течение относительно небольшого числа поколений, например, при стасипатрическом видообразовании путем быстрых перестроек хромосом [11; 12] или полиплоидизации генома [13].

Среди механизмов симпатрического видообразования все большее внимание привлекает несовместимость гамет, основанная на взаимодействии высокоспециализированных белков [14]. Эти белки экспрессируются в тканях репродуктивной системы и не участвуют в выполнении других функций [14-16]. Следовательно, изменение структуры белков взаимодействия гамет (БВГ) влияет только на оплодотворение [14]. На примере морских ежей Echinometra, Heliocidaris, Strongylocentrotus и моллюсков Haliotis и Tegula показано, что единичные замены в БВГ могут частично ограничивать панмиксию (см. обзор [14]). Так, считается, что 10 аминокислотных замен в молекуле акросомального белка морских ежей биндина хватает, чтобы сформировались репродуктивно изолированные группы [17].

Вместе с тем, наравне с белками иммунитета, БВГ - это одна из наиболее быстро эволюционирующих групп белков [15-16]. Благодаря ряду факторов (обитание в условиях симпатрии, половой конфликт, отбор против гибридов и др.), БВГ попадают под действие движущего отбора (positive selection) [15-25]. Как следствие, несовместимость гамет может формироваться за относительно короткие промежутки времени.

К настоящему моменту БВГ изучены только у ряда беспозвоночных с наружным оплодотворением и нескольких видов насекомых с внутренним оплодотворением [14]. Более того, в литературе отсутствуют данные о молекулярных основах взаимодействия гамет у представителей многих крупных таксонов, например, Spongia, Bryozoa и Annelida.

Несовместимость гамет может быть универсальным репродуктивным барьером для всех животных с половым процессом. Однако общебиологическая значимость этого потенциально мощного механизма видообразования пока не может быть с уверенностью обоснована. Основная причина этого - небольшое количество исследованных модельных объектов, относящихся к весьма ограниченному числу таксонов (см. обзор [14]).

Группы видов-двойников рода Littorina (Mollusca: Caenogastropoda) - новая и перспективная модель, на которой можно исследовать роль несовместимости гамет в симпатрическом видообразовании организмов с внутренним оплодотворением [14]. За последние 30 лет на этом комплексе видов уже изучались проблемы экологического видообразования, локальных адаптаций, репродуктивного поведения, паразито-хозяинных взаимодействий и др [26-36]. Для L. saxatilis доступны первичная сборка генома, позволяющая проводить комплексный молекулярный анализ (RADseq, Capture-seq и пр.), и транскриптомы нескольких тканей самцов и самок [37].

В то же время мало известно о репродуктивных барьерах между видами рода Littorina, а для подкласса Caenogastropoda не описано молекулярных посредников взаимодействия гамет.

Теоретическая и практическая значимость работы

Разработка моделей формирования репродуктивной изоляции в ходе видообразования, в особенности в ходе видообразования в симпатрии, имеет ключевое значение для дальнейшей теоретической разработки понятия вид - одного из центральных в эволюционном учении. В тоже время изучение несовместимости гамет у моллюсков с внутренним оплодотворением поможет формированию общебиологических обобщений и увязыванию накопленных ранее данных по насекомым с внутренним оплодотворением и другим беспозвоночным (моллюски, морские ежи) с внешним оплодотворением в единую конценпцию.

С практической точки зрения, в рамках данной мы адаптировали ряд биохимических методов для моллюсков рода Littorina. Учитывая, что эти моллюски широко распространены по СевероАтлантическим побережьям Европы, в Баренцевом и Белом море, в том числе в окрестностях МБС МГУ, МБС СПбГУ и МБС «Дальние Зеленцы», это делает их удобным объектом для учебных практических курсов по биохимии немодельных объектов.

Цели и задачи

Цель настоящей работы: идентифицировать и охарактеризовать белки взаимодействия гамет, потенциально вовлеченные в межвидовую репродуктивную изоляцию в комплексах криптических видов рода Littorina.

Задачи:

- Подтвердить возможность контакта гетероспецифичных половых продуктов в природе между пятью видами рода Littorina: L. saxatilis, L. arcana, L. compressa, L. obtusata, L. fabalis.

- Провести протеомный анализ тканей самцов и выявить видоспецифичные белки репродуктивных тканей

- Проанализировать первичную структуру, локализацию и особенности пространстенно-временного паттерна экпрессии белков, потенциально вовлеченных в несовместимость гамет

- Провести анализ внутри- и межвидового полиморфизма охарактеризованных белков

Положения, выносимые на защиту

1. Между представителями криптических групп «saxatilis» и «obtusata» подрода Neritrema присутствует частичная прекопулятивная репродуктивная изоляция - в естественных популяциях наблюдаются преимущественно гомоспецифичные копуляции, но для большинства видов возможен контакт гетероспецифичных половых продуктов.

2. В протеомах всех тканей, в которых формируются компоненты семени, самцов пяти изучаемых видов, присутствуют ткане- и видоспецифичные белки, потенциально вовлеченные в несовместимость гамет. Все эти белки отсутствуют в базах данных и могут быть представителями новых для науки семейств белков.

3. В семенных везикулах был обнаружен видоспецифичный белок LOSP. Этот белок специфично экспрессируется в параспермальной клеточной линии и накапливается в зрелых параспермах, входящих в состав спермы, где находится до осеменения (функция LOSP, по-видимому, реализуется в организме самки после передачи спермы). LOSP не имеет гомологов в базах данных или известных доменов и представляет новое для науки семейство белков.

4. LOSP видоспецифичен у видов группы «obtusata»; различается у представителей криптических групп, однако он не видоспецифичен внутри группы L. saxatilis/L. arcana.

5. LOSP высоковариабелен и, по-видимому, подвержен движущему отбору в группе «saxatilis», но испытывает стабилизирующий отбор в группе «obtusata». Паттерн полиморфизма LOSP в группе «saxatilis» соответствует данным по полиморфизму

изученных ранее белков взаимодействия гамет и может свидетельствовать об участии LOSP в несовместимости гамет в группе «saxatilis».

Научная новизна работы

Был описан представитель нового семейства параспермальных белков - LOSP, не имеющий гомологов в базах данных [38; 39]. LOSP - это первый описанный параспермальный белок [39]. Впервые для гастропод были изучены протеомы простаты, пениса и семенных везикул [38]; апробированы подходы для использования протеомных данных в таксономических исследованиях и оценке физиологической подразделенности популяций [34; 40]. Впервые для моллюсков рода Littorina были изучены межвидовые прекопулятивные репродуктивные барьеры в естественных популяциях.

Проведенные комплексные исследования делают моллюсков рода Littorina единственной модельной системой (помимо членистоногих) для изучения несовместимости гамет у беспозвоночных животных с внутреннем оплодотворением [14].

Публикации и апробация работы

По материалам диссертации опубликовано 17 работ: 6 научных статей в журналах, индексируемых системами WoS и/или Scopus, в том числе 3 в журналах первого квартиля SJR, и 11 публикаций в материалах международных и всероссийских конференций.

Основные положения и научные итоги диссертации были изложены в докладах на научных конференциях: XI Interational Symposium on Littorinid Biology and Evolution (XI ISOLBE; 28.071.08.2014), Molluscan Forum (24.11.2016), 20-я Международная Пущинская школа-конференция молодых ученых «Биология - Наука XXI Века» (18-22.04.2016), XII Interational Symposium on Littorinid Biology and Evolution (XII ISOLBE; 13.09-16.09.2017), Talking Evolution (26.0928.09.2018), 54th European Marine Biology Symposium (25.09-29.09.2019).

Диссертация была рекомендована к защите на соискание ученой степени кандидата биологических наук по итогам представления основных результатов и их обсуждения во время заседания кафедры Зоологии беспозвоночных Санкт-Петербургского государственного университета 19 декабря 2019 г.

Личный вклад автора

Сбор материала для всех исследований производился при личном участии автора, за исключением ряда сборов дополнительного материала на УНБ «Беломорская» СПбГУ и Беломорской биостанции МГУ (Белое море).

Большая часть биохимических исследований была проведена лично автором, в том числе масс-спектрометрический анализ, получение поликлональных антител LOSP, двумерный электрофорез, выделение РНК и др. Исключение составили: подготовка библиотек и запуск NGS-секвенирование и секвенирование по Сенгер; данные процедуры осуществлялись на базе РЦ СПбГУ при участии Машарского Алексея Эльвиновича. Кроме того, часть двумерных электрофореграмм в исследованиях протеомной близости видов литторинид получена другими исследователями (см. подробнее в [34; 40]). Анализ протеома простаты проводился совместно с Зайнуллиной Божаной Радиковной под непосредственным руководством автора.

Анализ полученных данных проводился лично автором с участием коллег, представленных в коллективе авторов соответствующих публикаций, за исключением статистического анализа протеомных данных для анализа физиологической близости литторинид (см. подробнее в [34; 40]) и статистического анализа частоты копуляций моллюсков в естественных популяциях Баренцевого моря, который проводился Варфоломеевой Мариной Александровной и Мальцевой Ариной Леонидовной.

Глава 1. Обзор литературы 1.1 Несовместимость гамет в видообразовании

Репродуктивная изоляция как одна из центральных проблем эволюционной биологии

Долгое время в биологии главенствовала типологическая концепция вида [5; 41; 42]. Последующий концептуальный сдвиг был во многом связан с развитием идей «функционализма» и «трансформизма» как противопоставления идеям креационизма, включающем представления о неизменности живых организмов [42]. Вот как этот конфликт описывал Майр: «Any attachment to metaphysical idealism, any commitment to an unchanging eidos, precludes belief in descent with modification» (Mayr 1964. p. xx [sic], по [42]).

После многолетнего противостояния этих двух точек зрения, в 19 веке с появлением работ Дарвина трансформизм постепенно стал главенствовать в биологии [5; 41; 42]. Дальнейшее развитие трансформизма, сопровождаемое развитием генетики, привело к формированию синтетической теории эволюции (СТЭ, [5]). Одна из центральных идей СТЭ - это биологическая концепция вида [1; 5]. По определению Майра, биологический вид - это система из скрещивающихся популяций, фактически или потенциально репродуктивно изолированных от таких групп других видов [1; 4; 5]. В отличие от типологической концепции вида, в рамках СТЭ именно популяция становится объектом эволюционных исследований [4; 5].

Тем не менее, биологическая концепция вида оказывается сложно применима к исследованиям реальных биологических процессов и явлений: измерение репродуктивных барьеров представляет собой самостоятельную и не тривиальную задачу. Фактически многим исследователям по-прежнему приходится прибегать к типологическому описанию видов [5]. Следствием этого становится проблема «скрытого видообразования» («cryptic speciation»), когда морфологически единый вид при более подробном изучении оказывается системой из частично репродуктивно изолированных криптических видов [4; 43-47]. Также важно подчеркнуть, что биологическая концепция вида в принципе не применима в палеонтологии, для видов без полового размножения.

Однако и среди видов, для которых удается изучить механизмы репродуктивной изоляции и их эффективность, существует большое количество примеров, не укладывающихся в СТЭ. Так, зачастую, между близкими видами существуют гибридные зоны, и исследователям удается детектировать поток генов: либо необходимо признать, что это не отдельные виды в понимании СТЭ, либо что полное ограничение потока генов не является необходимым критерием вида [1; 5; 48-50].

Одна из причин такой неоднозначности в определении биологического вида и проблем в его применении к реальным биологическим системам - это отсутствие четких представлений о роли репродуктивной изоляции на ранних этапах видообразования [48]. Следовательно, дальнейшая разработка понятия биологического вида в рамках СТЭ делает необходимым подробное изучение механизмов репродуктивной изоляции, и особенностей их формирования в процессе видообразования [48].

Механизмы репродуктивной изоляции подразделяют на пре- и постзиготические [1; 4]. Презиготические механизмы репродуктивной изоляции снижают вероятность гетероспецифичного оплодотворения. Они довольно разнообразны по своей природе и, как правило, их делят на следующие группы [4]:

• Географическая изоляция - географическое разобщение видов/популяций;

• Экологическая изоляция - неравномерность распределения особей в пространстве, обусловленная заселением неравнозначных биотопов; в отличие от географической изоляции, может значительно ускорять процессы дивергенции за счет дизруптивного отбора [50];

• Временная изоляция - разнесение репродуктивных периодов во времени;

• Этологическая изоляция - несовместимость различных поведенческих аспектов полового размножения;

• Механическая изоляция - морфологическая несовместимость репродуктивных органов;

• Гибель гамет (несовместимость гамет) - несоответствие молекулярных посредников взаимодействия гамет, препятствующее оплодотворению [14]. У животных с внутренним оплодотворением этот механизм репродуктивной изоляции может реализовываться за счет белков семенной жидкости. Эти белки могут быть непосредственно вовлечены в несовместимость гамет или отвечать за передачу специфичных сигналов, воздействующих на организм самки и необходимых для успешного оплодотворения. Поэтому в случае животных с внутренним оплодотворением используют термин «посткопулятивная презиготическая репродуктивная изоляция», сокращенно PCPZ (post-copulatory pre-zygotic reproductive barriers), объединяющий спектр разнообразных явлений, приводящих к нарушению гетероспецифичного взаимодействия гамет [14].

В природных популяциях репродуктивную изоляцию, как правило, обеспечивают несколько механизмов, каждый из которых в отдельности не смог бы обеспечить уровня генетической обособленности вида, достаточного для сохранения видовой идентичности [1; 4].

Считается, что ранние этапы видообразования чаще сопряжены с формированием презиготических репродуктивных барьеров, а постзиготические проявляются на более поздних этапах дивергенции [6-10]. Однако, по-видимому, механизмы формирования репродуктивной

изоляции формируются по-разному, в зависимости от типа видообразования. Так, в аллопатрическом видообразовании, географическое разобщение популяций - это одно из необходимых условий дивергенции [4]. Для гибридного видообразования, напротив, необходима возможность гибридизации между родительскими видами (полное или частичное отсутствие репродуктивных барьеров; [51]). В симпатрической модели формирование репродуктивной изоляции предшествует дивергенции и не связана с географическим разобщением популяций [48].

В то время как модель видообразования в аллопатрии фактически стала основой для разработки биологической концепции вида, видообразование в симпатрии представляет один из наиболее неоднозначных и дискуссионных аспектов синтетической теории эволюции [48]. Изучение групп, совместно обитающих (симпатрических) филогенетически близких видов позволяет подробно исследовать формирование механизмов репродуктивной изоляции на ранних стадиях видообразования и вести разработку моделей видообразования с сохранением потока генов [49] и моделей экологического видообразования [50]. Одна из перспективных, но пока слабо изученных моделей видообразования - это модель симпатрического видообразования за счет быстрой эволюции белков, вовлеченных в процессы взаимодействия гамет [15] (см. также обзор [14]). На примере морских ежей, моллюсков рода Haliotis и ряда насекомых продемонстрировано, что белки взаимодействия гамет полиандрических видов с внутренним оплодотворением или видов с внешним оплодотворением, обитающих в условиях симпатрии, подвержены движущему отбору (positive selection): количество несинонимичных замен в белках взаимодействия гамет таких видов превосходит количество синонимичных (rev. in: [15, 16]; см. также обзор: [14]). При этом даже единичные аминоксилотные замены в белках взаимодействия гамет могут оказывать влияние на эффективность процессов взаимодействия гамет и, при условии коэволюции соответствующих молекул самца и самки, могут приводить к репродуктивной изоляции. Так, всего 10-ти аминокислотных замен в молекуле акросомального белка биндина достаточно для формирования репродуктивной изоляции между двумя симпатрическими видами морских ежей [17]. Потенциально подобные описанному феномены могут стать основой для дивергенции и симпатрического видообразования любых видов с половым размножением, однако недостаточное количество разработанных модельных систем пока не позволяет сформировать обоснованных обобщений [14]. Таким образом, изучение молекулярных механизмов формирования и поддержания несовместимости гамет представляется перспективным для дальнейшей разработки синтетической теории эволюции [1; 5; 48-50).

Молекулярные механизмы несовместимости гамет

Несовместимость гамет основана на видоспецифичной структуре отдельных молекулярных посредников взаимодействия гамет, которые происходят сходным образом у всех изученных животных (редкое исключение составляют, например, нематоды) [14]. Наиболее подробно взаимодействия гамет изучены у морских ежей с наружным оплодотворением, на примере которых можно продемонстрировать этапы взаимодействия гамет (рис. 1) [14].

Рисунок 1. Этапы взаимодействия гамет морских ежей (обозначены цифрами). Расшифровка приведена

в тексте. Из [14].

(1) Взаимодействия гамет начинаются с привлечения сперматозоида хемоаттрактантами яйцеклетки, представленными небольшими водорастворимыми молекулами различной химической природы: от ненасыщенных спиртов и аминокислот до белков (рис. 1, 0 - 1); (2) физический контакт сперматозоида и яйцеклетки стимулирует следующую стадию их взаимодействия - индукцию акросомальной реакции, которая сопровождается экзоцитозом

акросомы (специализированная везикула на апикальном конце сперматозоида, наполненная акросомальными белками) и стимулируется специфическим распознаванием рецепторами на поверхности сперматозоида их лигандов, входящих в состав оболочки яйцеклетки (рис. 1, 2 - 4); (3) высвобождение акросомальных белков приводит к локальному разрушению оболочки яйцеклетки и/или адгезии сперматозоида к оболочкам яйцеклетки (рис. 1, 3 - 4); (4) эти процессы делают возможным контакт мембран сперматозоида и яйцеклетки, который может привести к заключительному этапу взаимодействия гамет - слиянию гамет (рис. 1, 5; подробнее эти процессы рассмотрены в обзоре [14]).

Несовместимость гамет может быть реализована на любом из вышеперечисленных этапов, однако подробное постадийное изучение несовместимости гамет проводилось только для морских ежей, в то время как данные для других видов фрагментарны [14].

(2) Хемоаттрактанты яйцеклеток морских ежей представлены пептидами, которые зачастую имеют видоспецифичные различия в аминокислотной последовательности [52]. Именно их отличия определяют видоспецифичность привлечения сперматозоидов яйцеклетками 17 видов, принадлежащих к нескольким родам морских ежей [52]. Так, хемоаттрактант Arbacia punctulata не оказывает действия на сперматозоиды Lytechinuspictus [53-55].

Аналогичный феномен избирательного действия хемоаттарктантов на конспецифичные сперматозоиды показан для голотурий, офиур, ряда двустворчатых моллюсков и актиний [14]. В то же время у моллюсков рода Haliotis в качестве хемоаттрактанта яйцеклетки выступает L-триптофан, не различающийся между видами [56].

(3 ) Индукция акросомальной реакции морских ежей происходит за счет взаимодействия специфичного рецептора с сульфатированными полисахаридами оболочки яйцеклетки (рис. 1, 23). Эти полисахриды могут иметь различия в количестве и расположении сульфатных группировок в молекуле, что является основой видоспецифичности этих процессов [25]. В то же время у морских звезд индукция акросомальной реакции специфична лишь на уровне подсемейств, а для других групп животных видоспецифичность на этом этапе не продемонстрирована вовсе [14].

(4) Стадия разрушения оболочки яйцеклетки, напротив, видоспецифична у многих изученных групп [14]. У морских ежей она реализуется за счет видоспецифичной адгезии сперматозоида к оболочкам яйцеклетки, которая определяется структурой акросомального белка биндина, распологающегося на поверхности мембраны сперматозоида после акросомальной реакции [17; 19]. В частности, экспериментально показано, что изменчивость этого белка связана с репродуктивной изоляцией у симпатричских видов трех родов морских ежей: Echinometra, Heliocidaris, Strongylocentrotus [17; 19; 57]. У моллюсков рода Haliotis и Tegula видоспецифичность достигается за счет селективного разрушения оболочки яйцеклетки

акросомальным белком лизином [58; 59]. Предполагается также, что именно полиморфизм акросомальных белков поддерживает репродуктивные барьеры между близкими видами двустворчатых моллюсков родов Crassostrea [60; 61] и Mytilus [62].

(5) Слияние мембран также может быть видоспецифично, например, при слиянии гамет Echinometra mathaei и E. oblonga [63]. Однако молекулярные основы этой видоспецифичности не известны.

Несовместимость гамет у животных с внутренним оплодотворением - PCPZ

У животных с внутренним оплодотворением процессы взаимодействия гамет (рис. 1) находятся под влиянием белков семенной жидкости самца и физиологического состояния самки. Во многих случаях эти процессы усложняются хранением спермы самкой после копуляции, на которое влияют оба фактора (подробнее см. [14]). У животных с внутренним оплодотворением правильнее заменить «несовместимость гамет» более удачным термином: посткопулятивная презиготическая репродуктивная изоляция (postcopulatory prezygotic reproductive barriers, PCPZ). Это понятие включает целый ряд схожих по проявлению механизмов репродуктивной изоляции, основанных, тем не менее, на разных молекулярных процессах.

Зачастую PCPZ основана на возможности самца влиять на физиологию самки. Например, у мух Anastrepha suspensa в присутствии конспецифичных самцов ускоряется развитие репродуктивной системы самок [64]. Однако ключевую роль играют белки семенной жидкости, которые самец передает вместе со спермой при внутреннем оплодотворении. Так, компоненты конспецифичной семенной жидкости у мотыльков Heliothis virescens и сверчков рода Allonemobius стимулируют самку к продукции ооцитов [65; 66].

Белки семенной жидкости разнообразны как по функциям, так и по структуре. Например, в семенной жидкости жука Callosobruchus maculatus обнаружено не менее 127 различных белков [67], у Drosophila их известно больше 150 [68], а у человека таких белков обнаружено более 900 [69]. Эти белки влияют на продукцию яйцеклеток, изменение формы протоков репродуктивной системы, обеспечивают антимикробную активность и готовность самки к последующему оплодотворению. Они могут определять длительность хранения спермы, модулировать активность сперматозоидов и, соответственно, влиять на их потенциальную конкуренцию [14; 70]. Наконец, показана роль этих белков в механическом блокировании семяприемника (формирование сфрагиса (mating plug)) [71]. Протеомный анализ компонентов семенной жидкости представляет актуальную задачу, поскольку многие белки семенной жидкости относятся к новым для науки семействам, а их функции неизвестны. Накопленные к настоящему моменту данные не позволяют провести сравнительный структурный анализ белков, не имеющих известных доменов или гомологов в базах данных, и в полной мере оценить степень их участия

в процессе размножения. Более того, из-за специфики протеомных методов, анализ протеома семенной жидкости все еще далек от завершения даже у модельных объектов. Так в 2019 году авторы сообщают о 132 не описанных ранее белках семенной жидкости у Drosophila pseudoobscura - одного из ключевых модельных объектов современной молекулярной биологии [72].

Таким образом, дальнейшая разработка биологического понятия вид, являющегося одним из ключевых элементов эволюционного учения, тесно связана с изучением механизмов формирования репродуктивных барьеров на ранних стадиях симпатрического видообразования. Один из перспективных и потенциально универсальных, но слабоизученных механизмов формирования репродуктивной изоляции в симпатрии - это несовместимость гамет на основе видоспецифичной структуры белков взаимодействия гамет. Несовместимость гамет изучена преимущественно у видов с внешним оплодотворением, среди которых полноценные данные по всем этапам взаимодействия гамет представлены только для морских ежей, в то время как по другим видам присутствуют лишь фрагментарные данные. Среди беспозвоночных с внутренним оплодотворением изучены только насекомые, несовместимость гамет которых связана с полиморфизмом белков семенной жидкости. Все это делает актуальным разработку новых модельных систем несовместимости гамет беспозвоночных с внутренним оплодотворением -симпатрических видов моллюсков подрода Neritrema рода Littorina.

Список литературы диссертационного исследования кандидат наук Лобов Арсений Андреевич, 2021 год

Список литературы

1. Coyne, J. A., Orr, H. A. Speciation. - Sanderland, MA: Sinauer Associates, 2004. - 545 p.

2. De Queiroz, K. Species concepts and species delimitation. // Systematic biology. - 2007. -Vol. 56, № 6. - P. 879-886.

3. Mallet, J. Why was Darwin's view of species rejected by twentieth century biologists? // Biology Philosophy. - 2010. - Vol. 25, № 4. - P. 497-527.

4. Майр, Э. Популяции, виды и эволюция. - Москва: Мир, 1974. - 460 с.

5. Mayr, E. The biological species concept. / Species concepts and phylogenetic theory: a debate.

- Columbia: Columbia University Press, 2000. - 256 p.

6. Coyne, J. A., Orr, H. A. "Patterns of speciation in Drosophila" revisited. // Evolution. - 1997.

- Vol. 51, № 1. - P. 295-303.

7. Schluter, D. Ecology and the origin of species. // Trends in ecology & evolution. - 2001. - Vol. 16, № 7. - P. 372-380.

8. Servedio, M. R., Noor, M. A. The role of reinforcement in speciation: theory and data. // Annual Review of Ecology, Evolution, and Systematics. - 2003. - Vol. 34, № 1. - P. 339-364.

9. Turissini, D. A., Liu, G., David, J. R. et al. The evolution of reproductive isolation in the Drosophila yakuba complex of species. // Journal of evolutionary biology. - 2015. - Vol. 28, № 3. - P. 557-575.

10. Turissini, D. A., McGirr, J. A., Patel, S. S. et al. The rate of evolution of postmating-prezygotic reproductive isolation in Drosophila. // Molecular Biology and Evolution. - 2018. - Vol. 35, № 2. - P. 312-334.

11. Баклушинская, И. Ю. Проблемы хромосомного видообразования, гибридизации и определения пола на примере слепушонок рода Ellobius (Mammalia, Rodentia). Дисс. докт. биол. наук.: 03.00.15. - Москва, 2005. - 320 л.

12. Rieseberg, L. H. Chromosomal rearrangements and speciation. // Trends in ecology & evolution. - 2001. - Vol. 16, № 7. - P. 351-358.

13. Grant, V. Plant speciation. - Columbia: Columbia University Press, 1981. - 563 p.

14. Лобов, А. А., Мальцева, А. Л., Михайлова, Н. А. и др. Молекулярные механизмы несовместимости гамет беспозвоночных. // Acta Naturae (русскоязычная версия). - 2019.

- Vol. 11, № 3(42). - P. 4-15.

15. Swanson, W. J., Vacquier, V. D. The rapid evolution of reproductive proteins. // Nature

Reviews Genetics. - 2002. - Vol. 3, № 2. - P. 137-144.

16. Wilburn, D. B., Swanson, W. J. From molecules to mating: Rapid evolution and biochemical studies of reproductive proteins. // Journal of Proteomics. - 2016. - Vol. 135. - P. 12-25.

17. Zigler, K. S., McCartney, M. A., Levitan, D. R., Lessios, H. A. Sea urchin bindin divergence predicts gamete compatibility. // Evolution. - 2005. - Vol. 59, № 11. - P. 2399-2404.

18. Dorus, S., Evans, P. D., Wyckoff, G. J. et al. Rate of molecular evolution of the seminal protein gene SEMG2 correlates with levels of female promiscuity. // Nature genetics. - 2004. - Vol. 36, № 12. - P. 1326-1329.

19. Zigler, K. S. The evolution of sea urchin sperm bindin. // International Journal of Developmental Biology. - 2004. - Vol. 52, № 5-6. - P. 791-796.

20. Clark, N. L., Aagaard, J. E., Swanson, W. J. Evolution of reproductive proteins from animals and plants. // Reproduction. - 2006. - Vol. 131, № 1. - P. 11-22.

21. Levitan, D. R., Ferrell, D. L. Selection on gamete recognition proteins depends on sex, density, and genotype frequency. // Science. - 2006. - Vol. 312, № 5771. - P. 267-269.

22. Levitan, D. R., Stapper, A. P. Simultaneous positive and negative frequency-dependent selection on sperm bindin, a gamete recognition protein in the sea urchin Strongylocentrotus purpuratus. // Evolution: International Journal of Organic Evolution. - 2010. - Vol. 64, № 3. -P. 785-797.

23. Lessios, H. A., Zigler, K. S. Rates of sea urchin bindin evolution // Oxford: Oxford University Press, 2012. - pp. 136-143.

24. Kvarnemo, C., Simmons, L. W. Polyandry as a mediator of sexual selection before and after mating. // Philosophical Transactions of the Royal Society B: Biological Sciences. - 2013. -Vol. 368, № 1613. - P. 20120042.

25. Pomin, V. H. Sulfated glycans in sea urchin fertilization. // Glycoconjugate journal. - 2015. -Vol. 32, № 1-2. - P. 9-15.

26. Sokolova, I. M., Berger, V. J. Physiological variation related to shell colour polymorphism in White Sea Littorina saxatilis. // Journal of Experimental Marine Biology and Ecology. - 2000. - Vol. 245, № 1. - P. 1-23.

27. Granovitch, A. I., Sergievsky, S. O., Sokolova, I. M. Spatial and temporal variation of trematode infection in coexisting populations of intertidal gastropods Littorina saxatilis and L. obtusata in the White Sea. // Diseases of Aquatic Organisms. - 2000. - Vol. 41, № 1. - P. 5364.

28. Johannesson, K. Evolution in Littorina: ecology matters. // Journal of Sea Research. - 2003. -Vol. 49, № 2. - P. 107-117.

29. Granovtich, A. I., Mikhailova, N. A., Znamenskaya, O. et al. Species complex of mollusks of the genus Littorina (Gastropoda, Prosobranchia) from the eastern Murman coast. // Zoologicheskii Zhurnal. - 2004. - Vol. 83, № 11. - P. 1305-1316.

30. Grahame, J. W., Wilding, C. S., Butlin, R. K. Adaptation to a steep environmental gradient and an associated barrier to gene exchange in Littorina saxatilis. // Evolution. - 2006. - Vol. 60, № 2. - P. 268-278.

31. Bibby, R., Cleall-Harding, P., Rundle, S. et al. Ocean acidification disrupts induced defences in the intertidal gastropod Littorina littorea. // Biology Letters. - 2007. - Vol. 3, № 6. - P. 699701.

32. Granovitch, A. I., Maximovich, A. N., Avanesyan, A. V. et al. Micro-spatial distribution of two sibling periwinkle species across the intertidal indicates hybrdization. // Genetica. - 2013. -Vol. 141, № 7-9. - P. 293-301.

33. Rolan-Alvarez, E., Austin, C., Boulding, E. G. The contribution of the genus Littorina to the field of evolutionary ecology. // Oceanography and Marine Biology: an annual review. - 2015. - Vol. 53. - P. 157-214.

34. Maltseva, A. L., Varfolomeeva, M. A., Lobov, A. A. et al. Measuring physiological similarity of closely related littorinid species: a proteomic insight. // Marine Ecology Progress Series. -2016. - Vol. 552. - P. 177-193.

35. Muraeva, O. A., Maltseva, A. L., Mikhailova, N. A. Mechanisms of adaption to salinity stress in marine gastropods Littorina saxatilis: a proteomic analysis. // Cell and Tissue Biology. -2016. - Vol. 10, № 2. - P. 160-169.

36. Demin, S. I., Stefanova, V. N., Granovitch, A. I. Spermatogenesis and lobular cyst type of testes organization in marine gastropod Littorina saxatilis (Olivi 1792). // Cell and tissue research. -2019. - Vol. 376, № 3. - P. 457-470.

37. Galindo, J., Grahame, J. W., Butlin, R. K. An EST-based genome scan using 454 sequencing in the marine snail Littorina saxatilis. // Journal of evolutionary biology. - 2010. - Vol. 23, № 9. - P. 2004-2016.

38. Lobov, A. A., Maltseva, A. L., Mikhailova, N. A. LOSP: a newly identified sperm protein from Littorina obtusata. // Journal of Molluscan Studies. - 2015. - Vol. 81, № 4. - P. 512-515.

39. Lobov, A. A., Maltseva, A. L., Starunov, V. V. LOSP: a putative marker of parasperm lineage in male reproductive system of the prosobranch mollusk Littorina obtusata. // Journal of Experimental Zoology Part B: Molecular and Developmental Evolution. - 2018. - Vol. 330, № 4. - P. 193-201.

40. Maltseva, A. L., Varfolomeeva, M. A., Lobov, A. A. et al. Proteomic similarity of the Littorinid snails in the evolutionary context. // PeerJ. - 2020. - Vol. 8. - P. e8546.

41. Greene, J. C. Science, ideology, and world view: essays in the history of evolutionary ideas. // Journal of the History of Biology. - 1982. - Vol. 15, № 3. - P. 471-472

42. Amundson, R. Typology reconsidered: two doctrines on the history of evolutionary biology. // Biology and Philosophy. - 1998. - Vol. 13, № 2. - P. 153-177.

43. Struck, T. H., Cerca, J. Cryptic species and their evolutionary significance. // eLS. - 2019. - P. 1-9.

44. Beheregaray L.B., Caccone A. Cryptic biodiversity in a changing world. // Journal of Biology.

- 2007. - Vol. 6, № 4. - P. 1-5.

45. Bickford D., Lohman D.J., Sodhi N.S. et al. Cryptic species as a window on diversity and conservation. // Trends in Ecology & Evolution. - 2007. - Vol. 22, № 3. - P. 148-155.

46. Pfenninger M., Schwenk K. Cryptic animal species are homogeneously distributed among taxa and biogeographical regions. // BMC Evolutionary Biology. - 2007. - Vol. 7, № 121. - P. 1-6.

47. Chenuil A., Cahill A.E., Delemontey N. et al. Problems and questions posed by cryptic species. A framework to guide future studies. / In: Casetta E., Marques da Silva J., Vecchi D. (eds.). From assessing to conserving biodiversity. // History, philosophy and theory of the life sciences.

- Cham, 2019. - P. 77-106.

48. Bird, C. E., Fernandez-Silva, I., Skillings, D. J. et al. Sympatric speciation in the post "modern synthesis" era of evolutionary biology. // Evolutionary Biology. - 2012. - Vol. 39, № 2. - P. 158-180.

49. Feder, J. L., Egan, S. P., Nosil, P. The genomics of speciation-with-gene-flow. // Trends in genetics. - 2012. - Vol. 28, № 7. - P. 342-350.

50. Nosil, P. Ecological speciation. - Oxford: Oxford University Press, 2012. - 304 p.

51. Mallet, J. Hybrid speciation. // Nature. - 2007. - Vol. 446, № 7133. - P. 279-283.

52. Suzuki, N., Yoshino, K. I. The relationship between amino acid sequences of sperm-activating peptides and the taxonomy of echinoids. // Comparative Biochemistry and Physiology Part B: Comparative Biochemistry. - 1992. - Vol. 102, № 4. - P. 679-690.

53. Hathaway, R. R. Activation of respiration in sea urchin spermatozoa by egg water. // The Biological Bulletin. - 1963. - Vol. 125, № 3. - P. 486-498.

54. Suzuki, N., Garbers, D. L. Stimulation of sperm respiration rates by speract and resact at alkaline extracellular pH. // Biology of reproduction. - 1984. - Vol. 30, № 5. - P. 1167-1174.

55. Ward, G. E., Brokaw, C. J., Garbers, D. L. et al. Chemotaxis of Arbacia punctulata spermatozoa to resact, a peptide from the egg jelly layer. // The Journal of cell biology. - 1985. - Vol. 101, № 6. - P. 2324-2329.

56. Riffell, J. A., Krug, P. J., Zimmer, R. K. Fertilization in the sea: the chemical identity of an abalone sperm attractant. // Journal of Experimental Biology. - 2002. - Vol. 205, № 10. - P. 1439-1450.

57. Vacquier, V. D., Swanson, W. J., Hellberg, M. E. What have we learned about sea urchin sperm bindin? // Development, growth & differentiation. - 1995. - Vol. 37, № 1. - P. 1-10.

58. Vacquier, V. D., Lee, Y. H. Abalone sperm lysin: unusual mode of evolution of a gamete recognition protein. // Zygote. - 1993. - Vol. 1, № 3. - P. 181-196.

59. Hellberg, M. E., Vacquier, V. D. Rapid evolution of fertilization selectivity and lysin cDNA sequences in teguline gastropods. // Molecular Biology and Evolution. - 1999. - Vol. 16, № 6. - P. 839-848.

60. Brandriff, B., Moy, G. W., Vacquier, V. D. Isolation of sperm bindin from the oyster (Crassostrea gigas). // Gamete Research. - 1978. - Vol. 1, № 2. - P. 89-99.

61. Moy, G. W., Springer, S. A., Adams, S. L. Extraordinary intraspecific diversity in oyster sperm bindin. // Proceedings of the National Academy of Sciences. - 2008. - Vol. 105, № 6. - P. 1993-1998.

62. Riginos, C., McDonald, J. H. Positive selection on an acrosomal sperm protein, M7 lysin, in three species of the mussel genus Mytilus. // Molecular biology and evolution. - 2003. - Vol. 20, № 2. - P. 200-207.

63. Metz, E. C., Kane, R. E., Yanagimachi, H. et al. Fertilization between closely related sea urchins is blocked by incompatibilities during sperm-egg attachment and early stages of fusion. // The Biological Bulletin. - 1994. - Vol. 187, № 1. - P. 23-34.

64. Pereira, R., Teal, P. E., Sivinski, J. et al. Influence of male presence on sexual maturation in female Caribbean fruit fly, Anastrepha suspensa (Diptera: Tephritidae). // Journal of insect behavior. - 2006. - Vol. 19, № 1. - P. 31-43.

65. Park, Y. I., Shu, S., Ramaswamy, S. B. et al. Mating in Heliothis virescens: transfer of juvenile hormone during copulation by male to female and stimulation of biosynthesis of endogenous juvenile hormone. // Archives of Insect Biochemistry and Physiology: Published in Collaboration with the Entomological Society of America. - 1998. - Vol. 38, № 2. - P. 100107.

66. Marshall, J. L., Huestis, D. L., Hiromasa, Y. et al. Identification, RNAi knockdown, and functional analysis of an ejaculate protein that mediates a postmating, prezygotic phenotype in a cricket. // PloS one. - 2009. - Vol. 4, № 10. - P. e7537.

67. Goenaga, J., Yamane, T., Ronn, J. et al. Within-species divergence in the seminal fluid proteome and its effect on male and female reproduction in a beetle. // BMC evolutionary biology. - 2015. - Vol. 15, № 1. - P. 266.

68. Sepil, I., Hopkins, B. R., Dean, R. et al. Quantitative proteomics identification of seminal fluid proteins in male Drosophila melanogaster. // Molecular & Cellular Proteomics. - 2019. - Vol. 18. - P. S46-S58.

69. Pilch, B., Mann, M. Large-scale and high-confidence proteomic analysis of human seminal plasma. // Genome biology. - 2006. - Vol. 7, № 5. - P. R40.

70. Avila, F. W., Sirot, L. K., LaFlamme, B. A. et al. Insect seminal fluid proteins: identification and function. // Annual review of entomology. - 2011. - Vol. 56. - P. 21-40.

71. Thornhill, R. Sexual selection and paternal investment in insects. // The American Naturalist.

- 1976. - Vol. 110, № 971. - P. 153-163.

72. Karr, T. L., Southern, H., Rosenow, M. A. et al. The old and the new: discovery proteomics identifies putative novel seminal fluid proteins in Drosophila. // Molecular & Cellular Proteomics. - 2019. - Vol. 18. - P. S23-S33.

73. Reid, D. G. Systematics and evolution of Littorina (Vol. 164). - London: Ray Society, 1996. -463 p.

74. Гранович, А. И., Лоскутова, З. И., Грачева, Ю. А. и др. Морфометрический анализ копулятивного органа моллюсков видового комплекса "saxatilis" (coenogastropoda, littorinidae): проблемы идентификации и статуса видов. // Зоологический журнал. - 2008.

- Vol. 87, № 12. - P. 1425-1436.

75. Ravinet, M., Westram, A., Johannesson, K. et al. Shared and nonshared genomic divergence in parallel ecotypes of L ittorina saxatilis at a local scale. // Molecular ecology. - 2016. - Vol. 25, № 1. - P. 287-305.

76. Reid, D. G., Dyal, P., Williams, S. T. A global molecular phylogeny of 147 periwinkle species (Gastropoda, Littorininae). // Zoologica Scripta. - 2012. - Vol. 41, № 2. - P. 125-136.

77. Small, M. P., Gosling, E. M. Genetic structure and relationships in the snail species complex Littorina arcana Hannaford Ellis, L. compressa Jeffreys and L. saxatilis (Olivi) in the British Isles using SSCPs of cytochrome-b fragments. // Heredity. - 2000. - Vol. 84, № 6. - P. 692701.

78. Panova, M., Johansson, T., Canbäck, B. et al. Species and gene divergence in Littorina snails detected by array comparative genomic hybridization. // BMC genomics. - 2014. - Vol. 15, № 1. - P. 687.

79. Lobov A. A., Babkina I. Y., Maltseva A. L. et al. Penial mamilliform glands proteins in closely related Littorina species (Mollusca, Caenogastropoda): variability and possible contribution to reproductive isolation. // Biological Communications. - 2020. - Vol. 65, № 2. - P. 200-212.

80. Mikhailova, N. A., Gracheva, Y. A., Backeljau, T. et al. A potential species-specific molecular marker suggests interspecific hybridization between sibling species Littorina arcana and L. saxatilis (Mollusca, Caenogastropoda) in natural populations. // Genetica. - 2009. - Vol. 137, № 3. - P. 333.

81. Ellis, C. H. Littorina arcana sp. nov.: a new species of winkle (Gastropoda: Prosobranchia: Littorinidae). // Journal of Conchology. - 1978. - Vol. 29. - P. 304.

82. Granovitch, A. I., Sokolova, I. M. Littorina arcana Hannaford Ellis, 1978—a new record from the eastern Barents Sea. // Sarsia. - 2001. - Vol. 86, № 3. - P. 241-243.

83. Carvalho, J. G. M. Study on the diversification of flat periwinkles (Littorina fabalis and L. obtusata): insights from genetics and geometric morphometrics. Doctoral dissertation. -Lisbon, 2014. - 64 p.

84. Marques, J. P., Sotelo, G., Larsson, T. et al. Comparative mitogenomic analysis of three species of periwinkles: Littorina fabalis, L. obtusata and L. saxatilis. // Marine genomics. - 2017. -Vol. 32. - P. 41-47.

85. Carvalho, J., Pereira, C., Sotelo, G. et al. De novo isolation of 17 microsatellite loci for flat periwinkles (Littorina fabalis and L. obtusata) and their application for species discrimination and hybridization studies. // Journal of Molluscan Studies. - 2015. - Vol. 81, № 3. - P. 421425.

86. Costa, D., Sotelo, G., Kaliontzopoulou, A. et al. Hybridization patterns between two marine snails, Littorina fabalis and L. obtusata. // Ecology and evolution. - 2020. - Vol. 10, № 3. - P. 1158-1179.

87. Warwick, T., Knight, A. J., Ward, R. D. Hybridisation in the Littorina saxatilis species complex (Prosobranchia: Mollusca). // Hydrobiologia. - 1990. - Vol. 193, № 1. - P. 109-116.

88. Saur, M. Mate discrimination in Littorina littorea (L.) and L. saxatilis (Olivi) (Mollusca: Prosobranchia). / In: Progress in littorinid and muricid biology. - Dordrecht: Springer, 1990. -P. 261-270.

89. Erlandsson, J., Rolán-Alvarez, E. Sexual selection and assortative mating by size and their roles in the maintenance of a polymorphism in Swedish Littorina saxatilis populations. / In: Aspects of Littorinid Biology. - Dordrecht: Springer, 1998. - P. 59-69.

90. Pickles, A. R., Grahame, J. Mate choice in divergent morphs of the gastropod mollusc Littorina saxatilis (Olivi): speciation in action? // Animal Behaviour. - 1999. - Vol. 58, № 1. - P. 181184.

91. Rolán-Alvarez, E., Erlandsson, J., Johannesson, K. et al. Mechanisms of incomplete prezygotic reproductive isolation in an intertidal snail: testing behavioural models in wild populations. // Journal of Evolutionary Biology. - 1999. - Vol. 12, № 5. - P. 879-890.

92. Rolán-Alvarez, E. Sympatric speciation as a by-product of ecological adaptation in the Galician Littorina saxatilis hybrid zone. // Journal of Molluscan Studies. - 2007. - Vol. 73, № 1. - P. 110.

93. Cruz, R., Carballo, M., Conde-Padin, P. et al. Testing alternative models for sexual isolation in natural populations of Littorina saxatilis: indirect support for by-product ecological speciation? // Journal of Evolutionary Biology. - 2004. - Vol. 17, № 2. - P. 288-293.

94. Nosil, P., Vines, T. H., Funk, D. J. Reproductive isolation caused by natural selection against immigrants from divergent habitats. // Evolution. - 2005. - Vol. 59, № 4. - P. 705-719.

95. Hollander, J., Galindo, J., Butlin, R. K. Selection on outlier loci and their association with adaptive phenotypes in Littorina saxatilis contact zones. // Journal of Evolutionary Biology. -2015. - Vol. 28, № 2. - P. 328-337.

96. Paterson, I. G., Partridge, V., Buckland-Nicks, J. Multiple paternity in Littorina obtusata (Gastropoda, Littorinidae) revealed by microsatellite analyses. // The Biological Bulletin. -2001. - Vol. 200, № 3. - P. 261-267.

97. Makinen, T., Panova, M., André, C. High levels of multiple paternity in Littorina saxatilis: hedging the bets? // Journal of Heredity. - 2007. - Vol. 98, № 7. - P. 705-711.

98. Butlin, R. K. Reinforcement: an idea evolving. // Trends in Ecology & Evolution. - 1995. -Vol. 10, № 11. - P. 432-434.

99. Reid, D. G. The comparative morphology, phylogeny and evolution of the gastropod family Littorinidae. // Philosophical Transactions of the Royal Society of London. B, Biological Sciences. - 1989. - Vol. 324, № 1220). - P. 1-110.

100. Buckland-Nicks, J. A., Worthen, G. T. Functional morphology of the mammiliform penial glands ofLittorina saxatilis (Gastropoda). // Zoomorphology. - 1992. - Vol. 112, № 4. -P. 217-225.

101. Ганжа, Е. В., Гранович, А. И., Петрова, Ю. А. и др. Анализ гистологических особенностей строения пениальных желез моллюсков рода Littorina Северной Атлантики. // Biological Communications. - 2006. - Vol. 3, № 4. - P. 40-46.

102. Parker, G. A., Pizzari, T. Sperm competition and ejaculate economics. // Biological Reviews. - 2010. - Vol. 85, № 4. - P. 897-934.

103. Chen, B., Piel, W. H., Gui, L. et al. The HSP90 family of genes in the human genome: insights into their divergence and evolution. // Genomics. - 2005. - Vol. 86, № 6. - P. 627-637.

104. Dan, J. C. Studies on the acrosome. I. Reaction to egg-water and other stimuli. // The Biological Bulletin. - 1952. - Vol. 103, № 1. - P. 54-66.

105. Madden, T. The BLAST sequence analysis tool. / In: The NCBI Handbook [Internet]. 2nd edition. 2013. National Center for Biotechnology Information (US).

106. Waterhouse, A., Bertoni, M., Bienert, S. SWISS-MODEL: homology modelling of protein structures and complexes. // Nucleic acids research. - 2018. - Vol. 46, № W1. - P. W296-W303.

107. Park, H., Kim, D. E., Ovchinnikov, S. et al. Automatic structure prediction of oligomeric assemblies using Robetta in CASP12. Proteins: Structure. // Function, and Bioinformatics. -2018. - Vol. 86. - P. 283-291.

108. Xu, D., Zhang, Y. Ab initio protein structure assembly using continuous structure fragments and optimized knowledge-based force field. // Proteins: Structure, Function, and Bioinformatics. - 2012. - Vol. 80, № 7. - P. 1715-1735.

109. Chivian, D., Kim, D. E., Malmström, L. et al. Automated prediction of CASP-5 structures using the Robetta server. // Proteins: Structure, Function, and Bioinformatics. - 2003. - Vol. 53, № S6. - P. 524-533.

110. Oldfield, C. J., Dunker, A. K. Intrinsically disordered proteins and intrinsically disordered protein regions. // Annual review of biochemistry. - 2014. - Vol. 83. - P. 553-584.

111. Mészâros, B., Erdos, G., Dosztânyi, Z. IUPred2A: context-dependent prediction of protein disorder as a function of redox state and protein binding. // Nucleic acids research. -2018. - Vol. 46, № W1. - P. W329-W337.

112. Dosztânyi, Z. Prediction of protein disorder based on IUPred. // Protein Science. - 2018. - Vol. 27, № 1. - P. 331-340.

113. Buckland-Nicks, J. A., Chia, F. S. On the nurse cell and the spermatozeugma in Littorina sitkana. // Cell and Tissue Research. - 1977. - Vol. 179, № 3. - P. 347-356.

114. Hayakawa, Y. Parasperm: morphological and functional studies on nonfertile sperm. // Ichthyological Research. - 2007. - Vol. 54, № 2. - P. 111-130.

115. Canbäck, B., André, C., Galindo, J. et al. The Littorina sequence database (LSD)-an online resource for genomic data. // Molecular ecology resources. - 2012. - Vol. 12, № 1. -P. 142-148.

116. Gorbushin, A. M. Immune repertoire in the transcriptome of Littorina littorea reveals new trends in lophotrochozoan proto-complement evolution. // Developmental & Comparative Immunology. - 2018. - Vol. 84. - P. 250-263.

117. Marques, J. P., Sotelo, G., Galindo, J. et al. Transcriptomic resources for evolutionary studies in flat periwinkles and related species. // Scientific data. - 2020. - Vol. 7, № 1. - P. 111.

118. Kryazhimskiy, S., Plotkin, J. B. The population genetics of dN/dS. // PLoS genetics. -2008. - Vol. 4, № 12.

119. Team, R. C., DC, R. A language and environment for statistical computing, 2019. Vienna, Austria: R Foundation for Statistical Computing; 2012. URL https://www. R-project. org.

120. Fuchs, B., Wang, W., Graspeuntner, S. et al. Regulation of polyp-to-jellyfish transition in Aurelia aurita. // Current Biology. - 2014. - Vol. 24, № 3. - P. 263-273.

121. Ronquist, F., Teslenko, M., Van Der Mark, P. et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. // Systematic biology. -2012. - Vol. 61, № 3. - P. 539-542.

Количество обнаруженных активных партнеров в копулирующих парах на верхнем и нижнем уровнях литорали. Красным отмечены виды, для которых обнаружены межвидовые/гетеросексуальные копулирующие пары; зеленым отмечены виды, для которых не были обнаружены такие пары.

Горизо нт литорали вид всего активных партнеро в копуляции с самками своего вида копуляц ия с самками другого вида копуляция с самцами, зараженными или незрелыми партнерами

L. saxatilis 106 62 2 42

Верх L. arcana 18 1 8 9

L. obtusata 12 7 0 5

L. saxatilis 38 20 2 16

L. arcana 13 0 4 9

Низ L. compressa 9 8 0 1

L. obtusata 74 63 0 11

L. fabalis 24 17 3 4

Результаты анализа соотношения несинонимичных/синонимичных замен (dN/dS) точного критерия Фишера для пар L. saxatilis/L. arcana (MEGAX). Красным отмечены пары, для которых dN/dS достоверно больше 1.

Ключ для определения моллюсков подрода Neritrema рода Littorina Северо-Атлантической части Европы.

1. На раковине моллюска присутствуют выраженные спиральные бороздки; как правило, раковина с выраженным завитком (2)

На раковине моллюска присутствуют волосовидные слабовыраженные спиральные бороздки; как правило, завиток слабо выражен (5)

2. При вскрытии было определено, что:

- это самка (3)

- это самец (4)

- определение пола невозможно из-за заражения трематодами или возраста моллюска (определение вида невозможно)

3. Комплекс паллиальных желез развит нормально, эмбрионы в слизистой железе отсутствуют, и бурса:

- занимает всю нижнюю часть слизистой железы, либо бурса немного не доходит до начала слизистой железы, но по ширине занимает не менее половины слизистой железы (L. arcana)

- маленькая и занимает менее трети слизистой железы, сами железы расположены компактно (L. compressa)

- занимает половину длинны слизистой железы (L. saxatilis/L. arcana, точное определение вида затруднительно)

Комплекс паллиальных желез развит нормально, в слизистой железе присутствует хотя бы один эмбрион. Если бурса видна, занимает примерно половину длинны слизистой железы (L. saxatilis)

4. Пенис развит нормально, пениальные железы присутствуют, и они расположены:

- строго в один ряд, желез более шести (L. saxatilis)

- более чем в один ряд, в дополнительных рядах более двух желез (L. arcana)

- на концевой части пениса, железы крупные, количество желез не более шести (L. compressa)

5. При вскрытии было определено, что:

- это самка (6)

- это самец (7)

- определение пола невозможно из-за заражения трематодами или возраста моллюска (определение вида невозможно)

6. Комплекс палиальных желез развит нормально, эмбрионы в слизистой железе отсутствуют и бурса:

- по длине занимает практически всю нижнюю часть слизистой железы либо бурса немного не доходит до начала слизистой железы, но по ширине занимает не менее половины слизистой железы (Ь. оЫтМа)

- бурса маленькая и занимает менее трети слизистой железы, сами железы расположены компактно (Ь. /аЪаШ)

7. Пенис развит нормально, пениальные железы присутствуют, и они расположены:

- строго в один ряд, на конце пениса имеется ярко выраженный филамент, длинной не менее 1/3 от основной части пениса (Ь./аЪаШ)

- железы расположены более чем в один ряд, в дополнительных рядах более двух желез, филамент на кончике пениса отсутствует (Ь. оЫша1а).

SAINT-PETERSBURG STATE UNIVERSITY

Printed as manuscript

Lobov Arseniy Andreevich

Gamete interaction proteins as factors of reproductive isolation of cryptic species of

the genus Littorina Ferussac, 1822

03.03.04 - Cell biology, cytology, histology

Thesis for the degree of Candidate of Biological Sciences Translation from Russian

Supervisor: PhD in Biological Sciences, Maltseva Arina Leonidovna

Saint-Petersburg, 2020

Introduction.............................................................................................................................................73

Chapter 1. Literature review....................................................................................................................78

1.1 Gamete incompatibility in speciation..............................................................................................78

1.2 Subgenus Neritrema as a model for studying the microevolutionary consequences of gamete incompatibility........................................................................................................................................84

Chapter 2. Precopulatory reproductive barriers in the group of cryptic species of mollusks of the subgenus Neritrema.................................................................................................................................90

Chapter 3. Identification of species-specific gamete interaction proteins of mollusks of the subgenus Neritrema................................................................................................................................................92

Chapter 4. Identification and description of the paraspermal protein LOSP........................................100

Chapter 5. LOSP polymorphism as a factor of reproductive isolation of mollusks of the genus Littorina ...............................................................................................................................................................110

Conclusion.............................................................................................................................................116

Principal findings .................................................................................................................................. 118

Acknowledgments.................................................................................................................................119

Materials and methods..........................................................................................................................120

References.............................................................................................................................................125

Supplement 1.........................................................................................................................................135

Supplement 2.........................................................................................................................................136

Supplement 3.........................................................................................................................................137

Relevance of work

Most modern definitions of the term "species" are based on the concept of the unity of the species gene pool [1-3]. For example, E. Mayr (1970) emphasized that actual or potential reproductive isolation is the main criterion for a species [1-5]. Accordingly, the main models of speciation (microevolution) describe potential ways of dividing a single genetic (species) population into relatively or completely isolated groups [1; 2; 5].

The mechanisms of reproductive isolation are subdivided into pre- and postzygotic [1; 4]. It is believed that the early stages of speciation are more often associated with prezygotic reproductive barriers, while postzygotic ones are forms at later stages of divergence [6-10]. For example, in the allopatric speciation model, postzygotic reproductive isolation between closely related bird species required at least 22 million years of divergence [1]. In the sympatric model, on the contrary, the formation of reproductive isolation precedes divergence and can often occur over a relatively small number of generations, for example, during stasipatric speciation through rapid chromosome rearrangements [11; 12] or genome polyploidization [13].

Among the sympatric speciation mechanisms, gamete incompatibility based on the interaction of highly specialized proteins attracts some increasing attention [14]. These proteins are expressed in the tissues of the reproductive system and, typically, do not participate in other functions [14-16]. Consequently, changes in the structure of the gamete interaction proteins (GIPs) affect only fertilization [14]. Using the example of the sea urchins genus Echinometra, Heliocidaris, Strongylocentrotus, and mollusks genus Haliotis and Tegula, it was shown that single amino acid replacement in the GIPs could partially limit panmixia (see the review by [14]). For example, it is considered that ten amino acid substitutions in the acrosomal protein molecule of sea bindin urchins are enough to form reproductively isolated groups [17].

At the same time, along with immunity proteins, GIPs are among the most rapidly evolving protein groups [15; 16]. Due to several factors (sympathy, sexual conflict, reinforcment), GIPs are influenced by positive selection [14-25]. As a result, gamete incompatibility may form rapidly.

GIPs have been studied only in several invertebrates with external fertilization and some insects with internal fertilization up today [14]. Moreover, we know practically nothing about the molecular basis of gamete interaction in many large taxa, for example, Spongia, Bryozoa, and Annelida.

Gamete incompatibility can be a universal reproductive barrier for all animals with the reproductive process. However, the general biological significance of this potentially powerful speciation mechanism

cannot be reliably substantiated yet. The main reason for this is the small number of studied model objects related to a minimal number of taxa (see the review by [14]).

Groups of closely related species of the genus Littorina (Mollusca: Caenogastropoda) are a new and promising model to study the role of gamete incompatibility in sympatric speciation of organisms with internal fertilization [14]. Over the past 30 years, this species complex has been already studied in case of the problems of ecological speciation, local adaptations, reproductive behavior, parasite-host interactions [26-36]. For L. saxatilis, a primary genome assembly and transcripts of several tissues of males and females are available that allow complex molecular analysis (RADseq, Capture-seq, etc.) [37].

At the same time, it is little known about the reproductive barriers between species of the genus Littorina. Moreover, no molecules involved in the gamete interaction have been described for Caenogastropoda.

The theoretical and practical significance of the work

The development of models describing the formation of reproductive isolation in speciation, especially in speciation in sympathy, is of crucial importance for the further theoretical development of the species concept - one of the central ideas of evolutionary theory. At the same time, investigation of the incompatibility of gametes in mollusks with internal fertilization is necessary for biological generalizations and allows us to compare data on insects with internal fertilization and other invertebrates (mollusks, sea urchins) with external fertilization.

From a practical point of view we adapted several biochemical methods for mollusks of the genus Littorina in this work. Given that these mollusks are widely distributed along the North Atlantic coasts of Europe, in the Barents and the White Sea, including in the vicinity of MBS of Moscow State University, MBS of St. Petersburg State University and MBS "Dalnie Zelency" they become a convenient object for training practical courses in the biochemistry of non-model organisms.

Goals and objectives

This work aims to identify and characterize gamete interaction proteins that are potentially involved in interspecific reproductive isolation in complexes of cryptic species of the genus Littorina.

Objectives:

- Confirm the possibility of contact of heterospecific sexual products in nature between five species of the genus Littorina: L. saxatilis, L. arcana, L. compressa, L. obtusata, L. fabalis.

- Analyze proteomes of male tissues (seminal vesicles, prostate, penis) and identify species-specific reproductive proteins

- To analyze the primary structure, localization, and spatio-temporal expression pattern of proteins potentially involved in gamete incompatibility

- To analyze the intraspecific and interspecific polymorphism of the characterized proteins

Principal findings to be considered

1. There is partial precopulatory reproductive isolation between species of the Neritrema cryptic groups "saxatilis" and "obtusata" — predominantly homospecific copulations are observed in natural populations, but contact of hetero-specific sexual products is possible for most species.

2. In the seminal fluid, prostate, and penial proteomes of males of the five species, there are tissue-and species-specific proteins potentially involved in gamete incompatibility. All these proteins have no homologous in databases and might be the members of new protein families.

3. Species-specific LOSP protein has found in seminal vesicles. This protein is specifically expressed in the parasperm cell line and accumulates in the mature parasperms, where it is located before insemination (we assume that the LOSP function is realized in the female's body after sperm transfer). LOSP has no homologs in NCBI databases or known domains and represents a new protein family.

4. LOSP is species-specific in species of the "obtusata" group; it differs among species from different cryptic groups; however, it is not species-specific within the L. saxatilis/L. arcana group.

5. LOSP is highly variable and appears to be under positive selection in the "saxatilis" group, but it is under stabilizing selection in the obtusata group. The pattern of LOSP polymorphism in the saxatilis group corresponds to the data on the polymorphism of previously studied gamete interaction proteins and may indicate the participation of LOSP in gamete incompatibility in the saxatilis group.

The scientific novelty of work

We described a member of a new family of paraspermal proteins - LOSP, which does not have homologs in the databases [38; 39]. LOSP is the first parasperm protein described [39]. For the first time, proteomes of the prostate, penis, and seminal vesicles were studied for gastropods [38]. We have tested approaches for using proteomic data in taxonomic studies and assessing the physiological

subdivision of populations [34; 40]. For the first time, interspecific precopulatory reproductive barriers in natural populations were studied for mollusks of the genus Littorina.

Our comprehensive studies make the mollusks of the genus Littorina the only model system (besides arthropods) for investigation of the incompatibility of gametes in animals with internal fertilization [14].

Publications and approbation of work

Based on the materials of the dissertation, 17 works were published - 6 scientific articles in journals indexed by WoS/Scopus, including three articles in the journals of the first quartile, and 11 publications in materials of international and Russian conferences.

The main provisions and scientific results of the dissertation were presented in reports at scientific conferences: XI International Symposium on Littorinid Biology and Evolution (XI ISOLBE; 28.071.08.2014), Molluscan Forum (24.11.2016), 20th International Pushchino School-Conference for Young Scientists "Biology - Science of the 21st Century" (18-22.04.2016), XII International Symposium on Littorinid Biology and Evolution (XII ISOLBE; 13.09-16.09.2017), Talking Evolution (26.0928.09.2018), 54th European Marine Biology Symposium (25.09-29.09.2019).

The thesis was recommended for a Ph.D. defense based on the presentation of the main results and their discussion during a meeting of the Department of Invertebrate Zoology of St. Petersburg State University on December 19, 2019.

The personal contribution of the author

The collection of material for all studies was carried out with the author's participation, except for some collections of additional material at the MBS of St. Petersburg State University "Belomorskaya" and MBS of Moscow State University National Security in the White Sea.

Most of the biochemical studies were carried out personally by the author, including mass spectrometric analysis, obtaining LOSP polyclonal antibodies, two-dimensional electrophoresis, RNA isolation, etc. The exceptions were: library preparation and NGS sequencing, as well as Senger sequencing which were performed in the St. Petersburg State University Resource Center with the participation of Alexei E. Masharsky; a part of two-dimensional electrophoregrams in studies of the proteomic proximity of littorinid's species was obtained by other researchers (see [34; 40] for more details).

The analysis of the obtained data was carried out personally by the author with the participation of colleagues represented in the team of authors of the relevant publications, except the analysis of

proteomic data for the analysis of the physiological similarity of littorinids (see [34; 40] for more details) and the analysis of copulating pairs.

Chapter 1. Literature review 1.1 Gamete incompatibility in speciation

Reproductive isolation as one of the central problems of evolutionary biology

For a long time, the species' typological concept was dominated in biology [5; 41; 42]. The subsequent conceptual shift was connected with the development of the ideas of "functionalism" and "transformism" as opposed to the ideas of creationism, which included the immutability of living organisms [42]. Here is how Mayr described this conflict: "Any attachment to metaphysical idealism, any commitment to an unchanging eidos, precludes belief in descent with modification" (Mayr 1964. p. Xx [sic], according to [42]).

After many years of confrontation between these two points of view, in the 19th century, with the advent of Darwin's work, transformationism gradually began to dominate [5; 41; 42]. The further development of transformism, accompanied by the development of genetics, led to the formation of the Modern Synthesis [5]. One of the central ideas of the Modern Synthesis is the biological concept of the species [1; 5]. By Mayr's definition, a biological species is a system of mating populations virtually or potentially reproductively isolated from other such groups [1; 4; 5]. In contrast to the species' typological concept, within the framework of the Modern Synthesis, the population becomes the object of evolutionary research [4; 5].

However, the biological concept of the species is poorly applicable to real research because of the difficulty in measuring reproductive barriers, and, in fact, researchers still have to use the typological species criterion [5]. A consequence of this is the problem of "cryptic speciation" when a morphologically single species after a detailed study is turning out to a system of partially reproductively isolated cryptic species [4; 43-47].

It is also important to emphasize that the biological concept of the species is fundamentally not applicable in paleontology, in case of species without sexual reproduction and in agamous eu- and prokaryotes.

However, among the species for which it is possible to study the mechanisms of reproductive isolation and their effectiveness, many examples do not fit into the Modern Synthesis. There are many examples of hybrid zones between closely related species, and researchers can detect the gene flow between them: we either have to admit that these are not "species" in the understanding of the Modern Synthesis or that complete restriction of the gene flow is not a necessary criterion for the species [1; 5; 48-50].

One of the reasons for this ambiguity in determining the biological species and the problems in its application to real biological systems is the lack of a clear definition of the role of reproductive isolation in the early stages of speciation [48]. Therefore, the further development of the concept of a biological species within the framework of the Modern Synthesis makes it necessary to study in detail the mechanisms that form reproductive isolation and the features of their formation in speciation [48].

The mechanisms of reproductive isolation are divided into pre- and postzygotic [1; 4]. Presygotic mechanisms of reproductive isolation reduce the likelihood of heterospecific fertilization. They are quite diverse and, usually, they are divided into the following groups [4]:

• Geographic isolation - geographic separation of species / populations;

• Ecological isolation - uneven distribution of individuals in space, due to the population of individuals of unequal biotopes. Unlike geographical isolation, it can significantly accelerate divergence processes due to disruptive selection [50];

• Temporary isolation - spacing reproductive periods in time;

• Ethological isolation - incompatibility of various behavioral aspects of sexual reproduction;

• Mechanical isolation - morphological incompatibility of the reproductive organs;

• Gamete incompatibility - a mismatch between the molecular mediators of gamete interactions, which prevents fertilization. In animals with internal fertilization, this mechanism of reproductive isolation can be realized through seminal fluid proteins. These proteins can be directly involved in the gamete incompatibility or be responsible for transmitting of specific signals that affect the female organism and are necessary for successful fertilization. Therefore, in the case of animals with internal fertilization, a more general term in use: postcopulatory prezygotic reproductive isolation (PCPZ) combining the spectrum of various phenomena leading to disruption of the heterospecific gamete interaction [14].

In natural populations, reproductive isolation usually is ensured by several mechanisms, each of which individually could not provide a level of genetic isolation sufficient to maintain species identity [1; 4].

It is considered that the early stages of speciation are more often associated with the formation of prezygotic reproductive barriers, while postzygotic ones are manifested at later stages of divergence [610]. However, it seems that the mechanisms of the formation of reproductive isolation are formed in different ways, depending on the type of speciation. So, in allopatric speciation, geographic separation of populations necessary for divergence [4]. For hybrid speciation, on the contrary, the possibility of hybridization between parental species is necessary (complete or partial absence of reproductive

barriers; [51]). In the sympatric model, the formation of reproductive isolation precedes divergence and is not associated with the geographical separation of populations [48].

While the model of speciation in allopathy became the basis for the development of the species' biological concept, speciation in sympatry is one of the most controversial and debatable aspects within the Modern Synthesis [48]. The study of groups of cohabiting (sympatric) phylogenetically close species allows us to study in detail the formation of reproductive isolation mechanisms at the early stages of speciation and to develop the models of speciation with gene flow [49] and ecological speciation [50]. One promising but still poorly studied speciation model is the sympatric speciation model by the rapid evolution of proteins involved in gamete interaction [15] (see also the review by [14]). In models of sea urchins, Haliotis mollusks, and several insects, it was demonstrated that the GIPs of polyandric species with internal fertilization or species with external fertilization living in sympatric conditions are influenced by positive selection: the number of non-synonymous substitutions in the GIPs of such species exceeds synonymous (rev. in [14-16]). Moreover, even single substitutions in GIPs can affect the efficiency of gamete interaction processes and, subject to the co-evolution of the corresponding male and female molecules, can lead to reproductive isolation. For example, just ten amino acid substitutions in the molecule of acrosomal protein bindin are enough to form reproductive isolation between two sympatric species of sea urchins [17]. Potentially, similar phenomena may be the basis for divergence and sympatric speciation of any species with sexual reproduction; however, the insufficient number of developed model systems does not yet allow the formation of reasonable generalizations [14]. Thus, the study of the molecular mechanisms of the maintenance and formation of gamete incompatibility seems fruitful for the further development of a synthetic theory of evolution [1; 5; 48-50].

Molecular mechanisms of gamete incompatibility

Gamete incompatibility is based on the species-specific structure of individual molecular mediators of gamete interaction. The interactions of gametes of all studied animals (with rare exceptions, for example, nematodes) occur similarly and include similar stages [14]. The gamete interactions were studied in most detail in sea urchins with external fertilization, using the example of which it is possible to demonstrate the stages of gamete interaction (Fig. 1) [14].

(1) Gamete interactions begin with the sperm's attraction by egg chemoattractants - small soluble molecules of diverse chemical nature from unsaturated alcohols and amino acids to proteins (Fig. 1, 1). (2) Then physical contact between the sperm and the egg stimulates the next stage of their interaction -the induction of an acrosomal reaction accompanied by exocytosis of the acrosome (a specialized vesicle at the apical end of the sperm filled with acrosomal proteins). The acrosomal reaction is stimulated by the specific recognition by the receptors on the sperm's surface of their ligands in the egg surface (Fig. 1, 2-4). (3) The release of acrosomal proteins leads to local destruction of the egg envelope and/or sperm

adhesion (Fig. 1, 3-4). (4) These processes make the contact of sperm and egg membranes possible, which can lead to the final stage of gamete interaction - gamete fusion (Fig. 1, 5; these processes are considered in more detail in the review by [14].

Figure 1. Stages of gamete recognition in sea urchins. Numbers denote the steps of gamete recognition, with

the description provided in the main text. From [14].

Gamete incompatibility can be implemented at any of the above stages. However, a detailed step-by-step study of gamete incompatibility was carried out only for sea urchins, while the data for other species are fragmentary [14].

(1) The chemoattractants of a sea urchin egg are represented by peptides, which often have species-specific differences in amino acid sequences (Fig. 1, 0-1) [52]. Their species-specificity determines the specificity of sperm attraction by the egg of 17 species belonging to several genera of sea urchins [52]. For example, Arbacia punctulata chemoattractant does not affect on the Lytechinus pictus spermatozoa [53-55].

A similar phenomenon of the selective action of chemoattractants on conspecific spermatozoa is shown for holothurians, ophiura, several bivalve mollusks, and sea anemones [14]. At the same time, L-tryptophan is an oocyte chemoattractant of Haliotis mollusks and does not differ between species [56].

(2) The acrosomal reaction of sea urchins is induced by the interaction of a specific receptor with sulfated polysaccharides of the egg membrane (Fig. 1, 2-3). These polysaccharides may have differences in the number and location of sulfate groups in the molecule, which is the basis of the species-specificity of these processes [25]. At the same time, in starfish, the induction of an acrosomal reaction is specific only at the subfamily level, while species-specificity has not been demonstrated at this stage for other animals [14].

(3) On the contrary, the stage of destruction of the egg envelope is species-specific in many studied groups [14]. In sea urchins, this species-specificity is based on sperm-specific adhesion of the to the egg envelope, determined by the structure of the acrosomal protein bindin located on the surface of the sperm membrane after the acrosomal reaction [17; 19]. In particular, it was experimentally shown that the variability of this protein is associated with reproductive isolation in sympatric species of three genera of sea urchins: Echinometra, Heliocidaris, Strongylocentrotus [17; 19; 57]. In Haliotis and Tegula mollusks, species-specificity of this process is achieved by the specific destruction of the egg envelope by the acrosomal protein lysin [58; 59]. It is also assumed that acrosomal protein polymorphism supports reproductive barriers between closely related species of bivalve mollusks of the genera Crassostrea [60; 61] and Mytilus [62].

(4) The fusion of membranes can also be species-specific, for example, in the fusion of gametes of Echinometra mathaei and E. oblonga [63]. However, we are not aware of the molecular basis of this species-specificity.

Gamete incompatibility in animals with internal fertilization - PCPZ

In animals with internal fertilization, the gamete interaction processes (Fig. 1) are influenced by the seminal fluid of the male and the physiological state of the female, and in many cases, these processes are complicated by the sperm storage, which is influenced by both factors (for more details, see [14]). In animals with internal fertilization, it is more appropriate to replace "gamete incompatibility" with a better term: postcopulatory prezygotic reproductive barriers (PCPZ). This concept includes several phenomenological similar reproductive isolation mechanisms, based, however, on different molecular processes.

Often, PCPZ is based on the ability of the male to influence the physiology of the female. For example, the female reproductive system of Anastrepha suspensa flies accelerates in the presence of conspecific males [64]. However, the seminal fluid proteins which the male transfer to the female during internal fertilization play a key role. For example, the components of conspecific seminal fluid

in Heliothis virescens moths and Allonemobius crickets stimulate the female to produce oocytes [65; 66].

Proteins of seminal fluid are diverse in both function and structure. For example, at least 127 different proteins were found in the seminal fluid of Callosobruchus maculatus beetle [67], more than 150 are known in Drosophila [68], and more than 900 are found in humans [69]. These proteins affect egg production, change the shape of the reproductive system's ducts, provide antimicrobial activity, and the female's readiness for the next fertilization. They can determine the duration of sperm storage, modulate sperm activity, and affect their potential competition [14; 70]. Finally, the role of these proteins in the receptacle's mechanical blocking has been shown (formation of mating plugs; [71]). Proteomic analysis of seminal fluid components is an urgent task, since many seminal fluid proteins belong to new families for science, and their functions are unknown. The data accumulated to date do not allow a comparative structural analysis of proteins with no known domains or homologs in the databases, and to analyze the degree of participation in the reproduction process. Moreover, due to the specificity of proteomic methods, seminal fluid proteome analysis is still far from complete even in model objects. So, in 2019, the authors report 132 seminal fluid proteins not previously described in Drosophila pseudoobscura, one of the key model objects of modern molecular biology [72].

Thus, the further development of the biological concept of "species", which is one of the crucial elements of evolutionary biology, is closely related to the study of the mechanisms of formation of reproductive barriers in the early stages of sympatric speciation. One of the promising and potentially universal, but poorly studied mechanisms of the formation of reproductive isolation in sympatry is gamete incompatibility based on the species-specific structure of gamete interaction proteins. Gamete incompatibility was studied mainly in species with external fertilization, among which complete data on all stages of gamete interaction are presented only for sea urchins, while fragmentary data are available for other species. In the case of invertebrates with internal fertilization, only insects are studied up today. Gamete incompatibility in this group is associated with seminal fluid and not gamete proteins, as in external fertilizers. Thus, the development of new model systems for the incompatibility of gamete invertebrates with internal fertilization— sympatric species of the mollusks of the subgenus Neritrema genus Littorina is relevant.

1.2 Subgenus Neritrema as a model for studying the microevolutionary consequences of

gamete incompatibility

Subgenus Neritrema as a model for the study of ecological speciation

On the Europeans coasts of North Atlantic, the subgenus Neritrema Recluz, 1869 of the genus Littorina Ferussac, 1822 consist of two groups of closely related species: "saxatilis" (L. saxatilis (Olivi 1792), L. arcana Hannaford Ellis 1978, L. compressa Jeffreys 1865) and "obtusata" (L obtusata (Linnaeus 1758), L. fabalis (Turton 1825) [73]. These groups differ in conchological features; however, the only reliable definitive sign within each group is the anatomy of the reproductive system [29; 73; 74]. All studied species coexist under sympatric conditions; however, for L. saxatilis and L. obtusata, there are populations, for example, on the White Sea, without their cryptic species from the corresponding cryptic groups [73]. Four studied species form clutches, while L. saxatilis is the only member of the subgenus that has switched to oviposition [73].

All studied species form ecotypes in sharp gradients of environmental factors of the tidal zone [28; 73]. However, only ecotypes of L. saxatilis have been studied in detail [28; 73]. In different populations of this species, two ecotypes are independently formed: wave and crab [75]. Individuals of the wave ecotype are adapted to the surf sections of the rocky shores; they have relatively smaller sizes, a thinner shell, and an enlarged aperture. On the contrary, the crab ecotype is adapted to rocky shores areas with predation of crabs and has an enlarged size and a thickened shell with a smaller aperture.

According to phylogenetic analysis, the Neritrema subgenus forms a monophyletic branch, within which there are two monophyletic sister groups of the cryptic species "saxatilis" and "obtusata" (Fig. 2) [73; 76]. However, for species of the "saxatilis" group, it is rarely possible to obtain branches with high supports, and the relative position of these species varies depending on the methods used. So, according to some reports, L. compressa forms a separate cluster from L. saxatilis/L. arcana, according to other sources, L. compressa clusters with L. arcana separately from L. saxatilis, and finally, it has been shown in some works that L. arcana forms a separate clade [76-78].

Despite the fact that an unambiguous resolution of the tritomy of the saxatilis group has not yet been achieved, it seems informative to study the physiological proximity of species of this group. In particular, the addition of the clustering based on proteomic data (presence/absence of protein in two-dimensional electrophoregrams) to classical molecular phylogenetic analysis could be fruitful (Fig. 2) [34; 40]. Proteomic data reflect the physiological similarity of the studied groups and can be informative in the case of recently diverging species when used in the context of molecular phylogenetic analysis [79].

Figure 2. (A) Dendrogram of consensus species proteomes obtained via neighbor-joining based on Jaccard

0.8 0.6 0.4 0.2 0.0 0.00 0,05 0.10 0,15 0.20 0.25 0.30

dissimilarities of protein occurrence frequency in samples of different species. The bootstrap support values are

shown. (B) The molecular phylogeny tree obtained via Bayesian inference using concatenated partial gene sequences from 28S rRNA, 12S rRNA and cytochrome oxidase C subunit I (COI) for 10 Littorinidae species: Echinolittorina marisrubri (E. mar), E. millegrana (E. mil), Littoraria ardouiniana (L. ard), L. melanostoma (L. mel), Littorina littorea (L. lit), L. saxatilis (L. sax), L. arcana (L. arc), L. compressa (L. comp), L. obtusata (L.

obt), L. fabalis (L. fab). From [40].

The general topology of the proteomic tree corresponds to molecular phylogeny: the studied genera (Echinolittorina, Littoraria, Littorina) and two subgenera of the genus Littorina (Neritrema, Littorina) form monophyletic groups. On the proteomic tree, it is possible to obtain high supports for species of the "saxatilis" group: L. saxatilis and L. arcana form a monophyletic branch, sister to L. compressa (Fig. 2) [40]. Moreover, L. saxatilis and L. arcana show the most significant physiological proximity, compared with other species [40]. This correlates well with the data that these are among the most recently diverged species of the subgenus, and gene flow may persist between them [73; 80].

Despite the coexistence in sympatry, the distribution of the studied species in the tidal zone is uneven, and they all have unique microniches, for example, L. arcana is more common in the upper part of the

tidal zone while L. compressa, on the contrary, in the lower [29; 32; 73; 80; 82; 83]. Species of the "obtusata" group always live on macrophytes, in contrast to species of the "saxatilis" group, which can also inhabit solid inorganic substrates.

It is considered that there is no gene flow between species from different cryptic groups [73]. However, it can persist within them. Species of the "obtusata" group, according to the sequencing of mitochondrial genomes, diverged more than 0.8 Mya [84]. However, there is evidence of the existence of hybrid zones of L. obtusata and L. fabalis [85; 86]. Moreover, according to recent data, these species may diverge with gene flow [86].

Under experimental conditions, the possibility of unidirectional hybridization of L. saxatilis and L. arcana was shown [87]. Genetic data do not contradict the presence of the gene flow: the only detected potentially species-specific for L. arcana molecular marker is absent in L. saxatilis populations in those places where L. arcana is not found. When these species cohabitate in sympatry, the marker (A2.8) is found not only in L. arcana but also in some L. saxatilis individuals [32; 80]. However, there are stable physiological differences between these species: females of L. saxatilis are ovoviviparous while females of L. arcana form clutches [73]. There is no literature data on gene flow between L. compressa and other species of the "saxatilis" group. However, this may be due to a lack of systematic study of gene flow between L. compressa and L. arcana/L. saxatilis.

Thus, the subgenus Neritrema includes groups that can be interpreted as different stages of speciation: ecotypes with limited gene flow; the grouping of species ranks with partial gene flow in the "saxatilis" group and the "obtusata" group; two isolated groups of cryptic species. It makes the Neritrema subgenus a convenient model for microevolutionary research [28; 33; 73].

Precopulative reproductive barriers between species of subgenus Neritrema

All Neritrema species are dioecious internal fertilizers [73]. These features of reproductive biology suggest the presence of precopulatory mechanisms of reproductive isolation. Partial precopulatory reproductive isolation has been shown between ecotypes of L. saxatilis [88-95]. In natural populations, the majority of copulating pairs included individuals of the same ecotype; however, in laboratory conditions, such high specificity was not observed - males showed low selectivity in the choice of a passive partner for copulation [91]. Likely, the spatial separation of ecotypes due to the choice of different substrates (habitat isolation) makes a pivotal contribution to the precopulatory restriction of gene flow between them [93]. At the same time, it is considered that partner size selectivity during copulation is one of the important factors limiting the gene flow between ecotypes [89; 93].

It can be assumed that similar mechanisms may limit the gene flow between different species of the Neritrema subgenus, however, precopulatory isolation has not been studied in this group at the species level before. Nevertheless, during our long-term studies of natural populations of species of

the Neritrema subgenus, we regularly met heterospecific copulating pairs, and we suggest the possibility of contact of heterospecific sexual products, and hence the realization of post-copulative prezygotic reproductive barriers. Thus, a systematic study of this issue is a necessary step in this work.

Postcopulatory prezygotic reproductive barriers between species of the genus Littorina

Regular contact of heterospecific sexual products in natural populations is one of the critical prerequisites for the implementation of PCPZ; however, several other factors are associated with this mechanism of reproductive isolation [14]. First of all, this is sympatry. Other important factors -polyandry and a high level of sperm competition at the intraspecific level - several models have shown that intraspecific and interspecific sperm competition (PCPZ) can be implemented based on the same mechanisms [14]. There is no study of Littorina sperm competition in the literature, but the non-uniform contribution of males to the offspring has been demonstrated for L. obtusata and L. saxatilis. Despite the copulation of a female with many males, one or more males make the most considerable contribution to the offspring, while other males do not leave offspring at all, or their contribution is much lower [96; 97]. The last important premise of gamete incompatibility is the reinforcement. Measuring of the reinforcement is a non-trivial and independent task; however, the potential interpretation of the Neritrema cryptic complexes as products of ecological speciation indirectly indicates a possible reinforcement. Moreover, the presence of the reinforcement between ecotypes of L. saxatilis is widely recognized [98].

Thus, one can assume the presence of post-copulative prezygotic reproductive isolation between species of the subgenus Neritrema. However, there is no data about the molecular mechanisms of gamete interactions or PCPZ in Caenogastropoda. Therefore, before proceeding to the study of the molecular mechanisms of PCPZ between Neritrema species, it is necessary to analyze possible strategies for identifying the molecules potentially involved in these processes [14].

The compartmentalization of gamete interaction proteins in the male organism, and the choice of strategy for their identification in mollusks of the subgenus Neritrema

Three compartments can be distinguished in the body of males of the genus Littorina, in the proteomes of which there may be proteins involved in the gamete interactions: (1) seminal vesicles, (2) prostate, (3-4) mamilliform glands and penial epithelial glands (Fig. 3) [79].

Figure 3. Schematic representation of the anatomical structure of the reproductive system of the male subgenus Neritrema. Different colors and arrows indicate tissues in which sex products and/or non-cellular components of

sperm are synthesized and/or stored. From [79].

(1) Seminal vesicles are a specialized organ of the male's reproductive system for mature reproductive product storage until fertilization. Seminal vesicles are located between the testis and the prostate. GIPs from sperm are one of the most promising for study - in mollusks of the genus Haliotis and Tegula with external fertilization, it is acrosomal proteins involved in gamete incompatibility [14].

(2) The prostate is the gland of the male reproductive system of littorinids, which reproductive products enter before insemination. It is a functional analog of the accessory glands of insects and the mammalian prostate - it synthesizes and secretes seminal fluid components [73]. As noted above, it was demonstrated that seminal fluid proteins play a crucial role in reproductive isolation in several insects. By analogy with them, the mollusks prostate's proteins are of great interest in the study of gamete incompatibility.

(3) The goblet glands located in the penial epithelium and the sperm canal can secrete components that are transmitted to the female during copulation [73; 99]. It is known that they secrete an acidic mucus whose function and composition have not been studied.

(4) Penial mamilliform glands consist of a secretory part, a reservoir, and a channel. The composition of the secretion and its function are not known, but it is assumed that it is involved in anchoring the penis during copulation [73; 100]. Each gland contains four types of secretory cells, one of which is multicellular groups of granular cells that might produce protein secretions [73; 100; 101]. These cells have a developed rough ER and Golgi complex, and their cytoplasm is filled with a large number of vesicles moving along the anterograde pathway [73; 100; 101].

The secret of the mammilliform glands and goblet glands can fall into the female receptacle. Therefore, the protein component of this secretion, by analogy with insects, can participate in the conditioning and storage of sperm [73; 100; 102]. Theoretically, the secret of these glands may be involved in the formation of reproductive barriers.

Thus, the cryptic species of the subgenus Neritrema provides an informative model for studying ecological speciation, but the data on the mechanisms limiting gene flow in this group are fragmentary. According to indirect data, we assume the possibility of gamete incompatibility to be between the studied species. For Caenogastropoda, not a single gamete interaction protein has been previously described; therefore, the identification of proteins potentially involved in gamete incompatibility is an independent fundamental task. At the same time, species of the subgenus Neritrema have internal fertilization and may become the second, after insects, the model for studying the gamete incompatibility in invertebrates with internal fertilization.

Chapter 2. Precopulatory reproductive barriers in the group of cryptic species of

mollusks of the subgenus Neritrema

To confirm the possibility of contact between heterospecific sexual products in natural populations of the studied species, copulating pairs were collected in three seasons (2015-2017) on the coast of the Barents Sea. The full table of found copulating pairs is given in Supplement 1.

In the case of all species, except L. arcana, homospecific copulations with females of their species predominate. Moreover, in all species, the number of clearly non-specific copulations with infected mollusks with parasitic castration, other males, etc. prevails over the number of copulations with mature females of other species.

L. saxatilis and L. arcana are regularly found in heterospecific copulating pairs. At the same time, we have not found a single heterospecific copulating pair with active partners of L. compressa (although heterospecific pairs with females of this species were found; Table 1). However, this may be the result of a small sample size for L. compressa - in three field seasons we found only ten pairs with L. compressa.

In the case of L. obtusata, on the contrary, we were able to detect high specificity: none of the 87 active partners detected did not copulate with heterospecific females. Active L. fabalis males in 12.5% of cases copulated with other species, some of which were females of L. obtusata. However, it is essential to note that, as in L. compressa, the sample size for this species is significantly lower.

These data indicate the presence of precopulatory reproductive barriers between the Neritrema species. Moreover, these barriers are much more substantial within the "obtusata" group than in the within the "saxatilis" group. However, at least single heterospecific copulations were found for all species (Table 1).

Table 1 - matrix of detected copulating pairs.

Females Males

L. saxatilis L. arcana L. compressa L. obtusata L. fabalis

L. saxatils + + - - +

L. arcana + + - - -

L. compressa + - + - -

L. obtusata - - - + +

L. fabalis + - - - +

Thus, we observe partial precopulatory isolation between species of the subgenus Neritrema. Moreover, the precopulatory barriers in the "saxatilis" group are significantly lower than in L. obtusata.

Nevertheless, even within the "obtusata" group, single copulations of male L. fabalis with female L. obtusata are found. Moreover, there are also single copulating pairs, including individuals of different cryptic groups, for example, L. fabalis/L. saxatilis. Such data suggest the incompleteness of precopulatory reproductive isolation. At the same time, there is evidence of a lack of gene flow between cryptic groups [73]. This data raises the question of the presence of additional mechanisms of reproductive isolation of individuals of these two cryptic groups.

Chapter 3. Identification of species-specific gamete interaction proteins of

mollusks of the subgenus Neritrema

The incomplete effectiveness of precopulatory reproductive barriers between species of the subgenus Neritrema transfers maintaining of reproductive barriers to another level of reproductive isolation - postcopulatory, for example, gamete incompatibility (postcopulatory prezygotic reproductive barrier; PCPZ). This mechanism of reproductive isolation can supplement partial precopulatory isolation: gamete incompatibility is often realized through competitive interactions of hetero and homospecific sperm [14]. Under the condition of regular homospecific insemination under polyandry conditions, single heterospecific copulations will not contribute to the offspring [14]. Neither PCPZ nor gamete interaction proteins have been studied in Caenogastropoda before, and the first step in their study is the search and analysis of gamete interaction proteins (GIPs) in Littorinidae.

To identify GIPs, a proteomic analysis of three compartments was performed: seminal vesicles, prostate, penis (mamilliform glands and the muscular part of the penis; Fig. 3)

Penis

The proteomic analysis of the mamilliform glands and the muscular fragment of the penis included the tissues from four species: L. saxatilis, L. arcana, L. obtusata, and L. fabalis. On electrophoregrams, there are 5 proteins specific for the muscular fragment and 13 proteins specific for the mamilliform glands (Fig. 4, b).

Figure 4. (a) An example of an electrophoregram (left) and a master gel (right), obtained from an analysis of all electrophoregrams. Red arrows - proteins specific for total lysates of the mamilliform glands; Green arrows -proteins specific for total lysates of the penial fragment without mamilliform glands; green dots are proteins specific for L. saxatilis/L. arcana; red dots are proteins specific for L. obtusata; blue dots are proteins specific for L. fabalis; purple dots are proteins specific for L. obtusata/L. fabalis. (b) A Venn diagram illustrating the number of proteins specific to different samples. [79].

Most proteins specific for mamilliform glands do not differ between species. The exception was three proteins specific for L. obtusata (Fig. 4a). We have not identified a single protein specific for mamilliform glands by mass spectrometry.

Using mass spectrometry, one protein was identified as endeplasmin. This protein has presented in all electrophoregrams, but its relative amount in the mamilliform glands statistically significantly greater than in the muscular fragment of the penis (pql, Fig. 4; Tab. 2) [79].

Table 2 - results of mass spectrometry identification of pql penial protein.

Name Accession number Species Protein MW (Da) Scorc Unique peptides % A A coverage Total spectral intensity Number of spectra

Endoplasmin A0A21ÛPZR8 Mizuhopecten yessoensis (Yesso scallop) 91323.1 70.76 9 5.2 2.26e+006 22

Table of identified unique peptide forpq 1

Peptide sequence Peptide MW (Da) Number of spectra Score b/y series

(R)ELISNASDALDKIR(Y) 1544.8279 1 6.44 b3/yj-y6-ys-y9-yl0-yi2

(K)GVVDSDDLPLNVSR(E) 1485.7544 4 16.25 b2-b4/yi-y2-yry6-y7-yry9-yn-yi2

(K)SILFVPK(T) 8U3.5026 2 10.34 b2-b3/yl-yJ-y3-ya-yJ

(R)SSGTLEMSTlK(f) 1153.5769 3 9.93 b2/y2-y7-y9

(K)TLEINPR(H) 842.473 1 5.45 b2/y]-y2-y3

(R)TLQAKEEDLK(L) 1174.6314 I 4.95 yi-y4-ya

(R)YITFLR(V) 812.4665 2 5.80 b2/y3-y4-y5

(K)YLTFIR(G) 812.4665 2 5.80 b2/yry4-y5

(R)YLTFLR(T) 812.4665 2 5.80 b2/y3-y4-y5

Endoplasmin, is a chaperone located in the endoplasmic reticulum [103]. It is involved in the folding of proteins along the anterograde pathway [103]. An increase in its relative content in the mamilliform glands may be associated with active synthesis and exocytosis of proteins, which confirms ultrastructural data and assumptions about the presence of a protein component in the secretion of the mamilliform glands. Some of the 13 identified proteins specific for these glands may be the part of this secret.

In addition to mamilliform proteins, we were able to detect proteins specific for the muscular part of the penis L. saxatilis/L. arcana and absent in other species, for example, L. fabalis. (Fig. 4, a; Fig. 5) [79]. We have previously described these proteins in total lysates of the penis but assumed that they are localized in the mamilliform glands [34].

Figure 5. Electrophoregram of total lysates of the basal part of the penis of L. fabalis (red) and L. saxatilis

(green). Yellow - proteins common to both species. f_№ - proteins of the muscular part of the penis; the same

proteins are marked with green arrows and in fig. 4, a.

The most likely compartment for the expression of these proteins is the several-cells glands in the epithelium of the basal part of the penis, penial filament, and sperm canal [73; 99]. In the part of the penis that carries the mamilliform glands, such epithelial glands are absent [73]. The most fruitful is their potential localization in the epithelium of the sperm canal. Sexual products move through the sperm canal during insemination, thus these proteins can be mixed with the sperm during insemination [73; 99]. It is noteworthy that f_1 - f_5 are represented by a series of proteins with the same molecular weight but different pI - they may be a series of isoforms of one protein.

In addition to proteins presumably specific for penial tissues, many other species-specific proteins were found, all of which were previously described by us in other tissues, whose function is not related to reproduction [34; 79]. At the same time, on electrophoregrams of total lysates of penial tissues, we were not able to detect a single species-specific protein between L. saxatilis and L. arcana closely related species.

Thus, we found three L. obtusata specific proteins of the mamilliform glands, and five proteins or five isoforms of one protein of the basal part of the penis-specific for L. saxatilis/L. arcana (f_1 - f_5). These proteins can be part of the sperm and participate in the conditioning of the reproductive products and/or the transmission of specific signals to the female. Therefore, they can be involved in reproductive isolation between cryptic groups.

Prostate

To identify species-specific proteins of the prostate in comparison with total lysates of head tissues, we performed an analysis of the prostate proteomes of individuals of five species: L. saxatilis, L. arcana, L. compressa, L. obtusata, L. fabalis in ready-made or self-made polyacrylamide gels for two-dimensional electrophoresis (NuPage Bis-Tris Zoom 4-16% (ThermoFisher Scientific) and classical

Laemmli electrophoresis in a tris-tricin system, respectively). On two-dimensional electrophoregrams, 317 proteins were detected, of which 89 proteins were found, presumably specific for the prostate, and present on electrophoregrams in only one of the five species studied (Fig. 6 a).

(б)

Т».

Figure 6. (а) Master gel obtained after analysis of electrophoregrams of total lysates of the prostate and head tissues of the studied species. The color indicates species-specific proteins, presumably specific for the prostate. Red - proteins, species-specific for L. fabalis; green - proteins, species-specific for L. obtusata; blue - proteins, species-specific for L. saxatilis/L. arcana; yellow - protein, species-specific for L. saxatilis/L. compressa;

purple - proteins, species-specific for L. compressa. (б) Fragment of electrophoregram with the superposition of channels of total prostate lysates of L. fabalis (red) and L. compressa (green). Red arrows -Lfp1-6 proteins, specific for L. fabalis. Purple arrows - Lcp1-2 proteins,

specific for L. compressa.

It is important to emphasize that the prostate is a specialized tissue secreting the components of seminal fluid, and therefore many house-keeping proteins expressed in this tissue will be present in other tissues, but in a relatively smaller amount. The absence of these proteins on the electrophoregrams of head tissues does not confirm their tissue specificity - it requires additional confirmation at the mRNA level. However, it is possible to indicate several major prostate proteins, interested for further study: six L. fabalis proteins named Lfp (Littorina fabalis prostate protein) 1-6 (Fig. 6 a, 6) and two L. compressa proteins, named Lcp (Littorina compressa prostate protein) 1-2 (Fig. 6 a, 6).

Thus, in the prostate proteome several species-specific proteins are potentially part of the seminal fluid. None of the detected proteins were identified using mass spectrometry. At the moment, there is not a single published transcript of the prostate or protein isolated from the prostate of mollusks, and, probably, many of these proteins belong to families not yet described.

Seminal vesicles

Due to the high amount of DNA, these samples are badly suited for two-dimensional electrophoresis. Moreover, we are interested in a specific group of proteins contained in a sperm vesicular compartment (e.g. acrosomal proteins). Unlike other tissues, to identify potential sperm recognition proteins of sperm, we did not perform proteomic analysis of total lysates, but induced exocytosis of vesicles, in sperm of L. obtusata without cell destruction. This extract is called "acrosomal", because in the original source [104] this extraction method was used to induce the acrosomal reaction of bivalve mollusks. Due to methodological difficulties, we obtained acrosomal extracts only for L. obtusata while we used total extracts of three other species: L. saxatilis, L. obtusata, and L. littorea (Fig. 7).

L. obtusata Total extracts

acrosomal extract L saxatilis L obtusata L. littorea

Figure 7. Acrosomal extract of L. obtusata (left), and total extracts of seed vesicles L. saxatilis, L. obtusata and L. littorea (right). The arrows are LOSP-A and LOSP-B - L. obtusata specific proteins.

There are two major proteins with masses of 21 and 16.5 kDa in the acrosomal and total extracts of L. obtusata (Fig. 7). Two other species lack major proteins with the same molecular weight on the electrophoregram (Fig. 7). These proteins may be involved in gamete incompatibility, and they are called LOSP-A and LOSP-B, respectively (Littorina obtusata sperm protein) [3 8]. None of these proteins could be identified using mass spectrometry.

In summary, we can conclude that the three analyzed compartments contain many of tissue-specific proteins that are potentially associated with gamete interaction processes. Some of these proteins are also species-specific, primarily: six proteins of the prostate of L. fabalis: Lfp1-6; two proteins of the prostate of L. compressa: Lcp1-2; five proteins of the presumably penial epithelium of L. saxatilis/L. arcana: f1-5; two sperm proteins of L. obtusata: LOSP-A and LOSP-B. The observed tissue and species specificity make them potential candidates for the role of proteins involved in gamete incompatibility. However, none of these proteins could be identified using mass spectrometry from available databases.

Chapter 4. Identification and description of the paraspermal protein LOSP

We have discovered several proteins that are potentially involved in gamete incompatibility. Despite the presence of species-specific proteins in the proteome of the prostate and tissues of the penis, we focused on the study of sperm (eu- or parasperm) proteins LOSP-A and LOSP-B. Earlier it was shown for several other mollusks with external fertilization, that it was sperm proteins involved in incompatibility gametes. Therefore, LOSP-A and LOSP-B are the most promising of the detected proteins [14].

We have not identified LOSP using mass spectrometry, therefore, to identify its primary structure after two-dimensional electrophoresis, the proteins were analyzed using Edman's N-terminal sequencing followed by RACE amplification of losp cDNA using a primer designed based on the obtained amino acid sequence. The results of the first five cycles of Edman's terminal sequencing of LOSP-A and LOSP-B were the same for both proteins, so the additional five cycles were carried out only for LOSP-A and in the further work, we were focused on LOSP-A. Using RACE amplification, the complete losp-A transcript sequence was obtained with one full reading frame from start to stop codon (Fig. 8; NCBI database number KP689104; protein identifier in UniProt database A0A0G3EXS2) [38].

1 |atg)gcagtflctgaggacttcgctactaacactcttggtgctggccgtgcttctggtagtc

1 mavlrtslltllvlavllvv

* * *

61 gctttctcc|CAC|cacacatcaaagcataaggggaaagggaaagctgccaccacgaagccg

21

AFSHHTSKHKGKGKAATTKV

121 aaagtccacaaacacgggccgaatcacaaaggcggcaagcaagagaaaggtggaaagacg

41

KVHKHGPNHKGGKQEKGGKT

181 tctacggatgatgatcccgttttttaccacaaggac|gac|gacagcgacaagaacgcctct 61 stdddpvfyhkd || d s d k n a s

241 |cgcggggatattctccagcaaggcacactggaggaaatccgccâg)ttctataaaaacgcc

RGDILQQGTLEEIRQ

F Y K N A

301 actgcggcacccgctaaagtcagtgctgaccgcggcgtggctgcagccgagcggccgtat 101 taapakvsadrgvaaaerpy

361 ggcgatcctggcgaag 121 g d p g e

* _

ga|t|ctc[gccgtggctgaagccgagcatggtgga|gctggtgctgac mmbwwctwt a

421 TAŒÏCCGTGGCTGAAGCCGAGCATGGCGGA&CTGGCGATGACCAC

141

V A E A E H G

gâ|A'

T G D D

161

4 81 ^GCATGGTGGAlGCTAATGCTGAAC AClGCCGTGGCTGAAGCCGAGCATGGCGGAlACTGGC

H G

A N A E H