Экспрессия гена мезоглеина в различных типах клеток медузы Aurelia aurita тема диссертации и автореферата по ВАК РФ 03.00.25, кандидат биологических наук Матвеев, Иван Владимирович

  • Матвеев, Иван Владимирович
  • кандидат биологических науккандидат биологических наук
  • 2007, Санкт-ПетербургСанкт-Петербург
  • Специальность ВАК РФ03.00.25
  • Количество страниц 74
Матвеев, Иван Владимирович. Экспрессия гена мезоглеина в различных типах клеток медузы Aurelia aurita: дис. кандидат биологических наук: 03.00.25 - Гистология, цитология, клеточная биология. Санкт-Петербург. 2007. 74 с.

Оглавление диссертации кандидат биологических наук Матвеев, Иван Владимирович

Содержание

1 СПИСОК ИСПОЛЬЗУЕМЫХ СОКРАЩЕНИЙ

2 ВВЕДЕНИЕ

3 Цели и задачи исследования.

4 Основные положения, выносимые на защиту.

5 ОБЗОР ЛИТЕРАТУРЫ

5.1 Мезоглея и мезоглеальные клетки кишечнополостных.

5.2 Зародышевые листки кишечнополостных.

6 МАТЕРИАЛЫ И МЕТОДЫ

6.1 Сбор материала.

6.2 Выделение РНК.

6.3 Дифференциальный дисплей (ДД).

6.4 Выделение тотальной ДНК A. aurita.

6.5 ПЦР на тотальной ДНК A. aurita.

6.6 Обратнотранскриптазная ПЦР (ОТПЦР).

6.7 Флюоресцентная гибридизация in situ.

6.8 Электрофоретическое разделение белков и их окрашивание в геле.

6.9 Получение антител против рА47.

6.10 Иммуноблот (Вестерн болот).

6.11 Иммуноцитохимия.

6.12 Кислый-мочевинный электрофорез.

6.13 Приготовление проб мезоглеина для MALDI и белкового секвенирования по Эдману.

6.14 Клонирование мРНК мезоглеина.

6.14.1 3' Rapid Amplification of cDNA Ends (3'11АСЕПЦР)

6.14.2 5'RACE ПЦР.

6.15 Анализ экспрессии мезоглеина в эпидермисе, мезоглее и гастродерме методом ОТПЦР.

6.16 Программное обеспечение.

7 РЕЗУЛЬТАТЫ.

7.1 Поиск генов, дифференциально экспрессирующихся в мезоглее методом Дифференциального Дисплея.

7.2 Выявление мажорного белка мезоглеи.

7.3 Заряд мезоглеина и условия его экстракции из мезоглеи.

7.4 Молекулярное клонирование мРНК мезоглеина.

7.5 ОТПЦР мРНК мезоглеина.

8 ОБСУЖДЕНИЕ.

9 ВЫВОДЫ

Рекомендованный список диссертаций по специальности «Гистология, цитология, клеточная биология», 03.00.25 шифр ВАК

Введение диссертации (часть автореферата) на тему «Экспрессия гена мезоглеина в различных типах клеток медузы Aurelia aurita»

Внеклеточный матрикс (ВКМ) имеется у всех многоклеточных животных и может составлять значительную часть объема их тканей (Албертс и др., 1994). ВКМ активно участвует в регуляции множества процессов, происходящих в организме, начиная с самых первых шагов эмбрионального развития. Он определяет форму контактирующих с ним клеток, их миграцию, пролиферацию, дифференцировку. В защитных реакциях простых в эволюционном отношении организмов ВКМ и клетки, его синтезирующие, играют ключевую роль. Молекулярный состав ВКМ сложен и активно изучается. Основная масса исследований, посвященных ВКМ, проводится на позвоночных животных, преимущественно млекопитающих, традиционных объектах лабораторных исследований. Результаты исследований ВКМ позвоночных непосредственно используются в медицине для создания новых способов лечения ран, лечебной косметики и т.д.

Одна из сложностей в изучении взаимодействий клеток и ВКМ у млекопитающих состоит в разнообразии клеточного состава их тканей. Взаимодействия клеток с ВКМ трудно отличить от взаимодействий между клетками различных типов. Кишечнополостные могут быть хорошей моделью для изучения взаимодействия клеток и ВКМ, т.к. они относительно просты по строению и клеточному составу.

В последнее время клонировано значительное количество консервативных генов различных видов животных из класса Кишечнополостных. На основании анализа их последовательностей исследователи приходят к выводу, что гены, отвечающие за регуляцию экспрессии, контроль трансляции, проведение внутриклеточных сигналов, апо-птоз, передачу внеклеточных сигналов, спецификацию миогенной дифференцировки клеток и взаимодействие между клетками и ВКМ, удивительно сходны с генами млекопитающих. Некоторые гены Кишечнополостных, такие как mesoderm specification factor Twist, оказались значительно ближе к генам позвоночных, чем родственные гены дрозофилы или нематод (Galliot, Schmid, 2002).

Объектом настоящей работы была выбрана сцифоидная медуза Aurelia aurita (Eukaryota; Metazoa; Cnidaria; Scyphozoa; Semaeostomeae; Ulmaridae; Aurelia.).

Жизненный цикл A. aurita состоит из четырех стадий: личинки - планулы, поли-поидной стадии, эфиры и медузы. Медуза достигает диаметра 30 см. Она охотится на мелкий планктон с помощью стрекательных клеток эпителия, покрывающего верхнюю поверхность зонтика. Жгутиковые клетки эпителия перемещают добычу к краю зонтика, откуда медуза, с помощью щупалец, перемещает добычу в рот.

Тело представителей этого вида, как и у других кишечнополостных, образовано двумя эпителиальными пластами, эпидермой и гастродермой, между которыми находится мезоглея. У взрослых медуз толщина мезоглеи составляет несколько сантиметров. Мезоглея выполняет функцию скелета, придавая определенную форму телу животного; она участвует также в транспорте и запасании питательных веществ (Chapman, 1966; Bouillon and Coppois, 1977; Weber and Schmid, 1985). Усилие, производимое мышечной системой зонтика, обеспечивает сокращение диаметра внешней части зонтика, тогда как эластичность мезоглеи обеспечивает медузе возврат к первоначальной форме после каждого мышечного сокращения (Bouillon and Coppois, 1977). Мезоглея участвует в регулировании плавучести медузы (Denton, 1963; Mackay, 1969). Мезоглея играет ключевую роль в контроле миграции клеток и морфогенезе (Schmid, 1992; Kleinman et al., 2003). Основную массу мезоглеи составляет внеклеточный мат-рикс (ВКМ), который у многих кишечнополостных не содержит клеток.

У медузы A. aurita и ряда других представителей классов Scyphozoa и Anthozoa мезоглея заселена свободными подвижными клетками (Chapman, 1966). У таких кишечнополостных мезоглея приобретает внешнее сходство с соединительными тканями других животных (Заварзин, 1945; Chapman D.M., 1974). Наличие у медузы А. aurita толстого слоя мезоглеи, заселенной почти исключительно клетками одного типа, предоставляет исключительные возможности для изучения влияния ВКМ на клетки и наоборот. Происхождение мезоглеальных клеток (Мк) в онтогенезе слабо изучено. Одни авторы полагают, что Мк имеют эктодермальное происхождение (Hyman, 1940; Werner, 1984), другие - что источником их развития служит гастродерма (Заварзин, 1945; Young, 1974). Принято считать, что выселение происходит в ходе позднего эмбрионального развития или, скорее, постоянно у взрослых организмов (Заварзин, 1945; Knight, 1971). Показано что пролиферативная активность Мк достаточна для самоподдержания этой популяции, без подсева клетками из эпителиальных пластов. Следовательно, популяция Мк способна самообновляться (Чага, 1996), но это не исключает возможности постоянного выселения Мк из эпителиев. Показано, что мезоглея или экстракт мезоглеи сцифоидной медузы Rhopilema nomadica является оптимальной подложкой для переживающих культур клеток пяти видов морских кишечнополостных группы anthozoa (Aiptasia sp., Anemonia sulcata, Stylophora pistillata, Heteroxenia fuscescence, Nephthea sp.) (Frank, Rinkevich, 1999). Возможно, изучение состава мезоглеи медузы поможет решить проблему культивирования постоянных клеточных линий беспозвоночных.

Полагают, что ВКМ мезоглеи синтезируется клетками эпителиев (Hausman, 1973; Singer, 1974). Участие Мк в регуляции состава ВКМ мезоглеи не очевидно, однако мы показали, что они являются активно синтезирующими (Shaposhnikova et al., 2005) и это позволяет предполагать, что Мк участвуют в формировании ВКМ мезоглеи. С помощью электрофоретического анализа белкового состава мезоглеи зрелых медуз А. aurita мы показали наличие в ней нескольких мажорных белков. Одним из них является белок с молекулярной массой 45/47 кДа. Мы получили поликлональные антитела против белков фракции 45/47 кДа и подтвердили их специфичность с помощью имму-ноблота. Проведенный нами иммуногистохимический анализ срезов A. aurita показал, что антиген 45/47 кДа локализуется в гранулах Мк и в апикальной части клеток эпидермы, а у зрелых медуз он выявляется также в составе эластических волокон. Следовательно, Мк A. aurita (наряду с эпидермальными клетками) определенно участвуют в процессах формирования межклеточного вещества мезоглеи (Shaposhnikova et al., 2005).

Получение нуклеотидных последовательности генов, экспрессирующихся в Мк позволит приблизиться к пониманию функций этих клеток. Выявление генов специфически экспрессирующихся в Мк, позволит судить о том, насколько специализированной является эта группа клеток. Такие гены можно будет, также, использовать как маркеры дифференцировки Мк, что позволит проследить их происхождение в онтогенезе.

Мы клонировали и секвенировали мРНК мажорного белка мезоглеи A. aurita с молекулярной массой около 45 кДа и назвали его мезоглеин, а также показали, что у взрослых медуз этот белок экспрессируется только в Мк.

3 Цели и задачи исследования.

Целью настоящей работы был поиск генов специфически экспрессирующихся в Мк. Были поставлены следующие задачи:

1. Сравнить транскрипты Мк с транскриптами клеток эпидермы и гастродермы с помощью метода дифференциального дисплея (ДД).

2. Определить нуклеотидную последовательности мРНК мажорного белка мезоглеи A. aurita с молекулярной массой около 45/47 кДа.

3. Проверить предположение о том, что ген мажорного белка мезоглеи с молекулярной массой 45/47 кДа специфически экспрессируется в Мк.

4 Основные положения, выносимые на защиту.

1. Клонирована и секвенирована мРНК мажорного белка ВКМ мезоглеи A. aurita -мезоглеина.

2. Мезоглеин содержит домены ZP и DSL, что характерно для экстраклеточных белков.

3. Мезоглеин синтезируют и экскретируют мезоглеальные клетки.

5 ОБЗОР ЛИТЕРАТУРЫ

5.1 Мезоглея и мезоглеальные клетки кишечнополостных.

Кишечнополостные (Coelenterata или Cnidaria) низшие многоклеточные животные, тело которых образовано двумя эпителиальными слоями. Между наружным (эпидерма) и внутренним (гастродерма) слоями тела расположена прослойка межклеточного вещества, называемая мезоглеей (Chapman DM, 1974; Догель, 1981). Степень развития мезоглеи отличается как в разных группах, так и на разных стадиях жизненного цикла от тонкой пластинки у гидры до обширной массы у зрелых сцифомедуз. У многих кишечнополостных мезоглея не содержит клеток, однако у ряда представителей этого типа мезоглея заселена мезоглеальными клетками (Заварзин, 1945; Chapman DM, 1974). По своей структуре мезоглея кишечнополостных может быть весьма сложно организована и сравнима с рыхлыми соединительными тканями других животных (Заварзин,1945).

Матрикс мезоглеи состоит из фибрилл, заключенных в аморфное вещество. Методами дифракции рентгеновских лучей и электронной микроскопии было показано, что основная масса мезоглеальных фибрилл имеет коллагеновую природу (Adams, 1978). Позднее биохимическими и иммунохимическими методами в составе матрик-са были обнаружены фибриллярный коллаген с высокой степенью гликозилирования, фибриллярный коллаген, сходный с коллагеном V типа позвоночных, а также не фибриллярный коллаген IV типа (Franc et al., 1984; Miura, Kimura, 1985; Sarras et al., 1991; Tillet et al., 1996). Коллагеновые фибриллы образуют в мезоглее пучки разной толщины (Chapman D., 1974). В мезоглее гидроидных и сцифоидных медуз имеются также волокна, отличающиеся по своим химическим и физическим свойствам от кол-лагеновых (Chapman G., 1959). Они выполняют функцию антагониста мускулатуры и потому названы эластическими волокнами. Располагаются они в мезоглее в направлении от гастро- к эпидерме, поэтому второе их название вертикальные волокна (Weber,

Schmid, 1985; Оскольский, 1985). Химическая природа эластических волокон не ясна.

Что касается присутствия в мезоглее кислых гликозамингликанов, важного компонента соединительных тканей многоклеточных животных, то гистохимический анализ показал отсутствие этих веществ у актиний, гидромедуз и сидячей сцифомедузы Lucernaria quadricornis, в мезоглее же мягкого коралла Gersemia fructicosa сульфа-тированные гликозамингликаны присутствуют в большом количестве (Оскольский, 1985). Мезоглея сцифомедуз Cyanea arctica и Aurelia aurita по этому показателю занимает промежуточное положение (Оскольский, 1985; Napara et al., 1996а). Кроме того, в мезоглее ряда видов кишечнополостных выявлены белки, сходные с фибриллином, а также с ламинином и фибронектином, входящими в состав базальных пластин (Schmid et al., 1991; Reber-Muller et al., 1995).

У представителей класса Hydrozoa мезоглея обычно не содержит клеток (Chapman G., 1966), но у гидроидных полипов, имеющих хитиновый перисарк, имеются подвижные гранулярные клетки (Заварзин, 1945; Knight, 1971).

У ряда представителей классов Scyphozoa и Anthozoa мезоглея заселена свободными подвижными клетками (Chapman G., 1966). Однако выявить закономерности их появления в мезоглее кишечнополостных в целом не удается. Например, в роде Cyanea у одного вида клетки в мезоглее имеются, у другого вида их нет (Наумов, 1961); на одной стадии жизненного цикла (сцифистома Chrysaora quinquencirrha) мезоглея содержит клетки, а на другой стадии (медуза Chrysaora quinquencirrha) клетки в мезоглее отсутствуют (Bynum, Black, 1974).

О функциях мезоглеальных клеток известно крайне мало. Описана способность этих клеток к амебоидному движению и фагоцитозу (Мечников, 1947; Napara et al., 1994).

У кишечнополостных, мезоглея которых заселена мезоглеальными клетками, она приобретает внешнее сходство с соединительными тканями других животных (Заварзин, 1945; Chapman, 1974). Хотя многие авторы исследовали механизмы синтеза мезоглеи, в том числе методом авторадиографии с 3Н-пролином (Hausman, Burnett, 1971; Singer, 1974; Young, 1974; Naparaet al., 1996b), возможная роль мезоглеальных клеток в формировании внеклеточного матрикса остается неясной.

Мезоглея кишечнополостных выполняет те же основные функции, что и рыхлые соединительные ткани других многоклеточных животных. Она является частью скелетной системы этих животных (Chapman DM., 1974); служит антагонистом мускулатуры (Elder, 1973); выполняет транспортную функцию и, возможно, служит местом резервирования питательных веществ (Chapman G., 1966); участвует в регуляции миграции и дифференцировки клеток в морфогенетических и регенерационных процессах (Sarras et al., 1993; Schmid et al, 1993; Stidwill, Christen, 1998; Frank, Rinkevich, 1999; Schmid et al., 1999). Таким образом, мезоглею, заселенную мезоглеальными клетками, можно рассматривать, как тканевую систему, сопоставимую по своим функциям с тканями внутренней среды других многоклеточных животных (Napara, Chaga, 1992b). Исследования взаимоотношений клеток и ВКМ, организации и синтеза межклеточного вещества мезоглеи у кишечнополостных, позволяют проследить ранние этапы становления этой тканевой системы. Одним из интереснейших объектов для такого рода исследований является медуза Aurelia aurita, один из представителей класса Scyphozoa.

Обыкновенная, или ушастая медуза A. aurita широко распространена в водах Мирового океана от арктических до тропических морей и обладает типичным жизненным циклом, в ходе которого чередуются полипоидная и медузоидная стадии (Догель, 1937). Одиночные полипы (сцифистомы), прикрепленные при помощи ножки к субстрату, живут, питаются и размножаются почкованием. В определенный период начинается стробиляция - полип делится путем ряда поперечных перетяжек, в результате чего получается стопка дисков, соединенных между собой центральным стволом, стробила. Каждый диск представляет собой будущую молодую медузу, называемую эфирой. Эфиры, считающиеся особой, личиночной стадией, последовательно отрываются от стробилы и переходят к плавающему образу жизни (Догель, 1981; Иванов и др., 1981). После стробиляции сцифистомы восстанавливаются и, достигнув обычных размеров, вновь приступают к почкованию. Превращение эфиры во взрослую медузу сопровождается выравниванием краев зонтика, формированием щупалец и ротовых лопастей, развитием системы пищеварительных каналов, появлением зачатков гонад. Медузы растут и, достигнув зрелости, приступают к половому размножению. Медузы раздельнополы. Оплодотворение и эмбриональное развитие протекает в специальных карманах ротовых лопастей самок. Образующиеся планулы некоторое время плавают, а затем прикрепляются к подходящему субстрату и превращаются в сцифистом. Таким образом, A. aurita обладает ярко выраженным чередованием полового и бесполого поколений (метагенезом), характерным для сцифомедуз, с хорошо развитым медузоидным (половым) поколением (Догель, 1981).

Сравнение особенностей жизненного цикла A. aurita из водоемов с разным гидрологическим режимом выявило такие особенности жизненного цикла беломорской популяции, как синхронизацию всех стадий цикла, строгую приуроченность их к определенным сезонам, короткую продолжительность жизни медуз (Напара, 1995). Оказалось, что скорость роста медуз в Белом море в несколько раз выше, чем в других морях. После превращения эфир в медуз наступает стадия быстрого роста, которая длится около 40 - 50 дней. Масса животных в этот период удваивается каждые несколько суток, и зрелые особи достигают значительных размеров диаметр зонтика наиболее крупных экземпляров составляет 30 - 40 см (Напара, 1995). Для поддержания высокой скорости роста требуется значительная интенсификация всех ростовых и синтетических процессов. Не исключено, что именно необходимость обеспечения интенсификации ростовых процессов у медуз A. aurita послужила причиной участия мезоглеальных клеток в формировании ВКМ. Благодаря особенностям жизненного цикла беломорской популяции медузы A. aurita являются необыкновенно привлекательным объектом для исследований процессов синтеза и организации внеклеточного матрикса.

В мезоглее медуз A. aurita на светооптическом уровне выделяются три компонента: аморфное основное вещество, анизотропные волокна и изотропные эластические волокна (Napara et al., 1994). Структура основного вещества мезоглеи значительно изменяется на протяжении жизненного цикла. У ранних сцифистом основное вещество мезоглеи представлено лишь тонкой прослойкой между эпителиальными пластами, тогда как у зрелых полипов мезоглея хорошо развита. У эфир и молодых медуз нежная мезоглея обладает слабой базофилией и содержит отдельные тонкие волокна, идущие в разных направлениях. По мере роста медуз объем мезоглеи быстро увеличивается, при этом количество и толщина волокон резко возрастает (Napara et al.; Напара, 1995). Коллагеновые волокна прямые и расположены в разных направлениях; эластические лежат более упорядоченно: наиболее толстые из них образуют слой под эпителием эк-сумбреллы, от которого вглубь мезоглеи уходят более тонкие волокна.

Мезоглея сцифомедузы A. aurita на всех стадиях ее жизненного цикла содержит многочисленные клетки (Napara et al., 1994). В ходе жизненного цикла A. aurita изменяется как морфология, так и пролиферативная активность мезоглеальных клеток (Мк). Первые Мк появляются на самых ранних стадиях развития сцифистом. Однако из какого эпителиального пласта они происходят остается неясным. По мере дальнейшего развития и роста сцифистом, количество Мк возрастает. У сцифистом эти клетки способны делиться, однако их пролиферативная активность низка и увеличение числа этих клеток на данной стадии жизненного цикла, по всей видимости, связано с выселением клеток-предшественников из эпителиев (Напара, Чага, 1995). В мезоглее стробил встречается два варианта свободных клеток, различающихся по морфологии и проли-феративной активности (Napara, Chaga, 1992b). Клетки полипоидной части стробилы по своим характеристикам идентичны Мк сцифистом и практически не делятся. Для Мк формирующихся эфир характерна высокая пролиферативная активность. Практически все Мк молодых медуз находятся в митотическом цикле, длительность которого составляет около 2 суток (Napara, Chaga, 1992а). Уровень пролиферативной активности Мк медуз, находящихся в фазе быстрого роста, оказывается вполне достаточным для того, чтобы полностью обеспечить наблюдаемое увеличение популяции этих клеток. В ходе полового созревания рост медуз постепенно останавливается, и размножение клеток в мезоглее прекращается. Таким образом, пролиферативная активность Мк связана со скоростью роста животных (Напара, 1995).

По мере развития A. aurita меняется не только пролиферативная активность Мк, но и их морфология. Клетки сцифистом имеют овальную форму и мелкие ядра с конденсированным хроматином. На стадии формирования эфиры в цитоплазме этих клеток появляются многочисленные вакуоли, похожие на гетерофагосомы (Напара, 1995). У поздних эфир и молодых медуз в этих клетках развивается мощный белок-синтезирующий аппарат, появляются специфические ацидофильные гранулы, фагоцитарные вакуоли исчезают, в ядрах появляются крупные ядрышки. По мере роста .•< медуз размеры Мк увеличиваются, а количество специфических гранул в их цитоплазме возрастает (Napara et al., 1994).

Мк обладают амебоидной подвижностью и способны фагоцитировать инородные частицы, например, при введении в мезоглею медуз взвеси кармина уже через 1 час появляются клетки с захваченными частицами (Napara et al., 1994).

Морфологический и гистохимический анализ показал, что Мк медуз накапливают в своей цитоплазме белковые гранулы и, по-видимому, выводят их путем экзоцитоза в окружающий матрикс мезоглеи (Napara et al., 1996а). Материал специфических гранул содержит катионные белки или гликопротеины с высоким содержанием лизина, цистеина и дисульфидных связей (Napara et al., 1996а). Гистохимические характеристики мезоглеи оказались сходными у эфир и медуз разного возраста. При использовании комплекса гистохимических реакций на белки и полисахариды основное вещество и анизотропные (коллагеновые) волокна окрашиваются практически одинаково, с той лишь разницей, что волокна, будучи более плотными структурами, всегда окрашиваются более интенсивно. Их гистохимические свойства соответствуют характеристикам гликозилированного коллагена (Naparaet al., 1996а). Эластические волокна A. aurita содержат нейтральные гликопротеины, белковый компонент которых имеет катион-ные свойства за счет высокого содержания лизина. Белки этих волокон также отличаются высокой концентрацией цистеина и дисульфидных связей (Schmid et al., 1991; Napara et al., 1996a).

5.2 Зародышевые листки кишечнополостных.

Кишечнополостные и Ctenophora, группы близкие к билатеральным животным, прекрасно подходят для отслеживания клеточных процессов и процессов развития, возникших у общего предка, и до сих пор преобладающих у билатеральных животных.

Тип кишечнополостных состоит из четырех классов: Anthozoa (corals, sea anemones), Cubozoa, Scyphozoa and Hydrozoa, из которых три последних формируют Medusozoa (медузоидные)

В то время как антозоа существуют исключительно в форме полипов, большинство медузоидных видов имеют жизненные циклы, включающие сидячий полип и пелагическую медузоидную стадию. В отдельных случаях одна из стадий может быть редуцирована или полностью отсутствовать.

С середины 19-го века кишечнополостных считали диплобластическими (diploblast) животными, состоящими из двух слоев клеток не имеющими мезодермы. В литературе устоялось представление о строении эмбриона, личинки и взрослого организма только из двух клеточных слоев эктодермы и эндодермы.

Представления о двухслойной организации породили несколько гипотез о филогении и эволюции зародышевых листков (Hyman, 1940; Bouillon, 1993; Technau and Scholz, 2003; Ball et al., 2004; Martindale et al., 2004). Диплобластическое строение личинки кишечнополостных трактовалось как унаследованный от предка признак, подтверждающий теорию Гакеля (Haeckel, 1874) о бластее-гастрее. По этим представлениям план строения билатеральных животных возник простым добавлением третьего зародышевого листка к плану строения диплобластических животных.

Развитие гидромедузы было описано Agassiz (1860), Schulze (1873), Hertwig and Hertwig (1878, 1880), Weissmann (1880), Hamann (1882) and Goette (1887, 1907). Происхождение поперечно-полосатых мышц от новообразованного третьего слоя, называемого энтокодон, не признавали мезодермальным, но интерпретировали как впячива-ние эктодермального слоя эпидермиса полипа.

Поскольку казалось, что поперечно-полосатые мышцы остаются прикрепленными к эктодерме, их не считали самостоятельными в онтогенезе. Таким образом строение медузы интерпретировали как модифицированное строение головы полипа с разросшейся между ртом и щупальцами гипостомальной частью, образующей зонтик медузы (Korschelt and Heider, 1890). Только появление электронной микроскопии обеспечило разрешение достаточное чтобы обнаружить, что энтокодон отделен от эктодермы и эндодермы слоем ВКМ (Boelsterli, 1977).

Следовательно энтокодон образует отдельный компартмент и может считаться мезодермой. В следствии диплобластический статус Hydrozoa нуждается в переосмыслении и энтокодон соотносится с мезобластемной выстилкой целомической полости Sipunculida (Воего et al., 1998). То, что энтокодон формируется только у Hydrozoa, совместно с малочисленностью данных, подтверждающих мезодермальное происхождение субэпидермальных поперечно-полосатых мышц у Cubozoa и Scyphozoa привело к формированию мнения, что энтокодон является тканью, встречающейся только у гидроидных и слабо напоминающей мезодерму (Collins et al., 2006).

В отличие от мышц билатеральных животных, происходящих из мезодермы и образованных пучками мышечных волокон, мышцы кишечнополостных представлялись эпидермальными складками образующими плоские пласты (Pantin, 1960; Chapman, 1966).

Несмотря на это, классификация кишечнополостных как диплобластических животных, уже подвергалась сомнению Hertwigs (Hertwig and Hertwig, 1878), который заметил, что Anthozoa обладают мезенхимальным мезодермальным слоем, сходным с таковым более эволюционно развитых животных. Они обнаружили мезодермальное расположенные поперечно-полосатые мышцы у некоторых медуз и выявили ламел-лу отделяющую эти мышцы от покрывающего эпителия (Hertwig and Hertwig, 1880). Krasinska (1914) разделяет два типа мышц у медузы, эпителиальные и субэпидермаль-ные мезодермальные мышцы. Это разделение поддерживает Hyman (1940, 1951), которая считает, что все случаи когда строение кишечнополостных сходно со строением трехслойных животных, имеют мезенхимальное происхождение, что, по ее мнению, говорит о примитивном способе образования мезодермы у кишечнополостных.

Как будет показано ниже, мезодермо-подобные структуры присутствуют не только у гидроидных медуз, но и у животных из классов Anthozoa, Cubozoa и Scyphozoa, как у полипов и взрослых животных, так и на разных стадиях развития. У этих животных они вносят вклад в образование субэпителиальных мышц эфиры или медузы. Поскольку у них отсутствует энтокодон, мезодермо-подобные структуры могут образовываться в результате трансдифференцировки или дифференцировки мезенхималь-ных клеток.

У билатеральных животных мезодерма это "зародышевый слой от которого происходит скелетно-мышечная система, соединительная ткань, кровь и внутренние органы такие как почки и сердце" (Wolpert, 1998). Скорее всего, в ходе эволюции, первым типом мезодермальных клеток были миоциты, постепенно образовавшие мышечную локомоторную систему, расположенную в организме так, чтобы обеспечить максимальную биомеханическую и физиологическую эффективность (Rieger and Laduner, 2001; Seipel and Schmid, 2005).

В телах большинства ныне живущих билатеральных животных (кроме артропод) эта мышечная система находится между внешним эпидермальным и внутренним пищеварительными слоями, а упругие структуры, такие как ВКМ, гидроскелет или кости, противодействуют силе мышечного сокращения. В конечностях позвоночных мышцы расположены между костями и эпидермисом при полном отсутствии эндо-дермальных слоев, что указывает на то, что функциональность мышц не зависит от мезодермального расположения, как такового, но зависит от принципа агонистов и от соответствующей анатомии. Теоретически, мышцы могли бы располагаться даже в эктодерме. У билатеральных животных из всего разнообразия клеток, тканей и органов происходящих из мезодермы, только ВКМ и прилежащая мышечная система имеют функциональные аналоги у кишечнополостных. Предполагается, что эти образования у кишечнополостных имеют мезодермальное происхождение.

У всех существующих групп животных формирование мезодермы коррелирует с гаструляцией, процессом начинающимся с движения эктодермальных клеток внутрь, в результате чего, формируется эндодерма и пищеварительный канал. В литературе разделяют эктомезодерму и эндомезодерму, в зависимости от того, происходят мезо-дермальные клетки из эктодермы или эндодермы (Hyman, 1951; Rieger and Laduner, 2001). Презумптивные мезодермальные клетки, однако, могут образовываться в течение всей гаструляции. Большинство эндодермальных клеток происходят от клеток изначально расположенных эпителиально.

Момент перехода от эпителиальной/эктодермалыюй линии клеток к эндодермаль-ной не вполне ясен. Такой переход может происходить рано, когда клетки начинают перемещаться вглубь, или позже, когда формируется примордиальный пищеварительный канал. Ситуация еще более запутывается в случаях когда отсутствует бластопор, как у некоторых Anthozoa или Phoronids, у которых гаструляция происходит как большой изгиб, направленный внутрь, или мультиполярная деламинация и иммиграция. Гаструляция такого типа часто встречается у кишечнополостных.

Большое разнообразие способов формирования мезодермы (Hyman, 1951) указывает на то, что эволюция различных строений тела требовала значительной пластичности развития организмов, с различными способами которыми клетки могли обрести свое мезодермальное расположение. Hyman (1951) пишет: "Термин «мезодерма» весьма вольно применяют ко всем клеткам, слоям клеток и клеточным массам, которые встречаются в ходе эмбрионального развития между эктодермой и эндодермой. Эктомезодерма групп Radiata и Protostomia, без сомнения, древнейшая из мезодерм. Она всегда мезенхималъная и состоит из интернализованых эктодермалъных клеток. Эндомезодерма (Deuterostomia), настоящая или дефинитивная мезодерма, включает всю мезодерму происходящую от или вместе с эндодермой. Она может формироваться как мезенхима или как первичная полоска, пластинка или сумка, более или менее эпителиального характера. Момент образования эндомезодермы, также, варьирует." Это определение общепринято у эмбриологов.

Кишечнополостные обладают двумя типами мышечных клеток. Экто- и эндо-дермальные слои личинок и полипов кишечнополостных состоят из эпителиальных клеток, имеющих в основании, в основном, гладкомышечные филаменты. Эти эпителиально-мышечные или мио-эпителиальные клетки часто несут жгутики или имеют кубовидную форму и имеют секреторную или пищеварительную функции. Эти клетки первыми дифференцируются в плануле гидроидных, сразу после того как образуется мезоглея, отделяющая эндо- и эктодермальные слои клеток (Groger and Schmid, 2001). Наличие мио-эпителиальных клеток рассматривается как признак, свидетельствующий о низком положении кишечнополостных на эволюционном древе. Однако жгутиковые мио-эпителиальные клетки, также встречаются у Bilateria таких как Brachyopodes или Amphioxus и являются производными мезодермы (Storch and Welsch, 1974).

Кроме мио-эпителиальных клеток у кишечнополостных описаны другие типы мышечных клеток. Эти клетки, в общем, имеют уплощено-вытянутую морфологию с большими базальными миофиламентами гладкого или поперечнополосатого типа (Calgren, 1949). Они могут быть эпителиальными или субэпителиальными и образовывать плоские пласты или объемные пучки. По сравнению с мио-эпителиальными эти клетки дифференцируются поздно, и часто бывают глубоко погружены в ВКМ и не соединены с эпителиальными слоями. В исследованных случаях такие мышечные клетки образовывались с участием мезодермы. Интересно, что у билатеральных и у медуз поперечнополосатые мышцы имеют сходный характер исчерчености (Krasinska, 1914; Bouillon et al, 1958; Chapman et al., 1962; Schuchert et al., 1993).

Гистологические и экспериментальные данные, полученные на морских Hydrozoa (Braverman, 1974; Bolsterli, 1977; Achermann, 1980; Schmid, 1992; Bouillon, 1993; Van de Vyver, 1993) и Scyphozoa (Hujer and Lesh-Laurie, 1995), свидетельствуют, что и мио-эпителиальные и мышечные клетки могут трансдифференцироваться друг в друга и в не мышечные типы клеток (нейроны, нематоцисты). Они могут автономно регенерировать органы медузы in vitro (Schmid, 1992). Следовательно, мышечные клетки кишечнополостных могут вновь включить программу стволовых клеток и демонстрируют непревзойденную в царстве животных пластичность дифференцировки. Более того, эти они являются источником клеток для развития мезодермальных структур, таких как энтокодон, при превращении полипа в медузу у гидроидных,

Эндодерма планулы гидроидных формируется деламинацией, полярной или муль-типолярной иммиграцией или ингрессией, но никогда не инвагинацией (Tardent, 1978). Истинно двухслойные личинка и полип гидроидных не обладают клетками мезодер-мального происхождения. Но зонтик гидромедузы состоит из трех или четырех слоев клеток. Один из слоев состоит из мононуклеарных мышечных клеток подобных мышечным клеткам билатеральных. Он находится субэпидермально в субумбрелле большинства медуз и эпидермально у некоторых Antho-, Narco- и Trachymedusae (все они относятся к Hydrozoa). У большинства гидромедуз поперечнополосатые мышцы образуются из энтокодона, третьего слоя клеток, который образуется между экто- и эндодермой (Seipel and Schmid, 2005). В экспериментах по трансплантации, энтокодон действует как автономный организатор развития медузы (Reisinger, 1957), проявляя сходство с такими-же свойствами бластопора билатеральных животных, выявленных в экспериментах по трансплантации у амфибий. Дополнительным подтверждением мезодермального характера энтокодона является сходство экспессирующихся в нем генов миогенной дифференцировки ( JellyDl, Id, Snail, Mef2, Seipel and Schmid, 2005), участвующих в образовании энтокодона и продуктов его дифференцировки - поперечнополосатых и гладких мышц зонтика медузы, с мезодермальными генами билатеральных ( Twist, Spring et al., 2000; Brachyury, Spring et al., 2002). Интересно, что большинство этих генов не экспрессируются во время дифференцировки эктодермаль-ных мио-эпителиальных клеток личинок (Spring et al., 2000; 2002; Muller et al., 2003). Таким образом, анализ экспрессии генов в клетках различных типов на различных этапах развития свидетельствует о существовании двух различных направлений дифференцировки для мио-эпителиальных клеток и мышечных клеток.

В отличие от ранних представлений о том, что мезодерма кишечнополостных носит примитивный мезенхимальный характер (Hyman, 1951) мезодерма энтокодона гидромедуз мезенхимальной не является, а образует отдельную трехмерную структуру (ме-зотелеальный компартмент), которая дифференцируется в субумбрелярные мышечные и нервные клетки (Seipel et al., 2004). Таким образом, в терминологии Hyman и в более строгих формулировках Pantin (1960) and Chapman (1966), требующих трехмерности мезодермальных структур, энтокодон классифицируется как настоящая мезодерма.

Животные классов Scyphozoa, Cubozoa и Anthozoa не имеют энтокодона, однако некоторые из них имеют другие структуры, предположительно, мезодермального происхождения.

Развитие планулы сцифоидных может проходить различными путями, включая разнообразные инвагинации и многополярные ингрессии (Franc, 1993). Личинка имеет типичное для кишечнополостных двухслойное строение. Необычный способ инвагинации наблюдается у Aurelia flavidula, у которой третий слой клеток образуется путем многополярной деламинации от эктодермы незадолго до и во время инвагинации эндодермы (Smith, 1881). Дальнейшая роль клеток третьего слоя в развитии не известна, возможно они участвуют в формировании мезоглеальных мезенхимальных клеток или дегенерируют. После прикрепления личинки к субстрату, образуется полип, по строеt нию сходный с Hydrozoa. В целом, анатомия сцифистомы (полипа) напоминает полип Anthozoa, Stauromedusa и Coronata (Stephanoscyphus), сцифистома обладает чертами как полипа, так и медузы (Werner, 1967).

Все сцифоидные полипы обладают мускулами-ретракторами и многочисленными амебоцитами в ВКМ. У сцифистом Aurelia aurita наблюдаются как гладкие так и поперечнополосатые миофибриллы в основании щупалец, внешнем около-ротовом диске и верхней части мускула-ретрактора (Chia et al., 1984). Ретрактор интерпретировали как плоскую эктодермальную ламеллу, направленную аборально, и растущую внутрь от перистомального поля, в котором дифференцируются мышечные волокна - предшественники мышц септ (Goette, 1887; Hein, 1900; Hargitt and Hargitt, 1910; Chapman, 1966). У полипов Cyanea palmstruchi, на ранней стадии развития (до формирования щупалец), из эктодермальных клеток вселяющихся в ВКМ из гипостомального поля, образуются тяжи мезэнтериальных мышц, также эктодермальные клетки выселяются из боковых стенок тела по мере роста мезэнтерия в сторону основания ноги (Widersten, 1966). У Stauromedusa Haliclystus octoradiatus ретрактор развивается похожим образом из клеток, мигрирующих от гипостомальной эктодермы в базальном направлении. Объемные тяжи гладких мышц полностью окружены ВКМ и не имеют контакта ни с эктодермой, ни с эндодермой ( Wietrzykowski, 1912).

Сцифоидные обладают выраженной медузоидной стадией с гладкими эпидермаль-ными и поперечнополосатыми субэпидермальными мышцами (Chapman et al., 1962; Chapman, 1968; 1999). В щупальцах Pelagia, сцифоидного организма не имеющего полипоидной стадии, гладкомышечные и нервные клетки образуют трубо-образные пучки (Krasinska, 1914). Эти пучки залегают глубоко в ВКМ и, в основном, не контактируют с экто- и эндодермальными слоями. Происхождение поперечнополосатых мышечных клеток в развитии эфиры и медузы не исследовано, но при отсутствии эн-токодона, оно определенно отличается от Hydrozoa.

Эмбриональное развитие Cubozoa не описано. Полипы не обладают мезентерием и ретракторами. У них нет элементов предположительно мезодермального происхождения.

Мышцы Anthozoa представлены двумя типами гладких мышц (Hyman, 1940; Amerongen and Peteya, 1980). В ходе развития личинки Anthozoa у октакораллов эндодерма образуется деламинацией (Tixier-Durivault, 1987), у гексокораллов инвагинацией и многополярной ингрессией (Van-Praet and Doumenc, 1987). У Actiniidae (гексо-кораллы) инвагинация происходит на оральном (бластопор) конце эмбриона и может прямо превращаться в действующий рот (Tardent, 1978). Вскоре после образования ротовой ямки и до прикрепления планулы, формируется мезентерий в виде билатеральных выростов эктодермального слоя на оральном конце, постепенно растущих к заднему концу. На ранних этапах этого процесса оба эпителия начинают синтезировать богатый коллагеном ВКМ. В этом матриксе залегают и дифференцируются ре-тракторы, амебоциты, иногда склеробласты и гонады (Hyman, 1940). Миофиламенты ретрактора погружены в ВКМ и большинство мышечных клеток отделены от эндо-дермальных эпителиальных мышц (Doumenc, 1976, 1979). Различные данные свидетельствуют о том, что все эти типы клеток (кроме, возможно, гамет) происходят от эктодермальных мезенхимальных клеток мигрирующих в ВКМ от орального полюса по мере дифференцировки мезентерия (Doumenc, 1977; 1979). Некоторые клетки сразу проникают в ВКМ, тогда как другие сначала мигрируют вдоль и внутри эндодермаль-ного слоя развивающегося мезентерия. Дифференцировка миофиламентов ретрактора запускается, когда мигрирующие клетки теряют контакт с эндодермой, образуют контакты между собой и формируют мышцы ретрактора. Некоторые элементы нервной системы развиваются похожим образом. Это напоминает об энтакодоне, клетки которого способны дифференцироваться в мышечные и нервные клетки, что указывает fia эволюционную связь между этими типами клеток (Seipel et al., 2004). Формирование мезенхимальных клеток из клеток эктодермального эпителия мигрирующих в ВКМ, также, наблюдается у коралла из группы alcyonarian Sympodium (Kovalevsky and Marion, 1883).

В общем, можно сказать, что мезентериальные мышцы-ретракторы у Scyphozoa и Anthozoa имеют эктобластемное происхождение и образуют гладкомышечные пучки, частично или полностью погруженные в ВКМ. Имеющиеся данные позволяют предположить, что полипы обоих классов кишечнополостных имеют трехмерное строение мышц мезодермального/мезенхимального происхождения. Последние исследования экспрессии генов мезодермальной/миогенной дифференцировки и patterning генов у Nematostella vectensis, относящейся к Anthozoa, не противоречат этому предположению (Martindale et al., 2004).

На основании приведенных данных можно составить две гипотезы о происхождении мезодермы:

1) "Мезодерма"кишечнополостных и происходящие от нее мышцы гомопластичны мезодерме билатеральных животных, и их сходство является результатом конвергентной эволюции.

2) Мезодермы кишечнополостных и билатеральных гомологичны, что предполагает наличие общего трехслойного предка.

В первом случае, кажется вероятным наличие общего двухслойного, плануло-подобного предка и последующее развитие трехслойности путем добавления третьего зародышевого листка. Плануло-подобный предок эволюционировал в двухслойный, полипоидный организм, который, возможно, дал начало сидячей, полипоидной группе Anthozoa, предположительно древнейшей группе кишечнополостных (Collins et al., 2006). Трехслойный полип и медуза могли быть потомками двухслойного полипа. Однако, оседлость, у ныне живущих видов, обычно сопровождается редукцией локомоторной и нервной системы, "изобретение"мезодермы, трехслойности и медузы оседлым, двухслойным полипом представляется маловероятным (Seipel and Schmid, 2005).

Во втором случае, кишечнополостные и билатеральные имеют общего до-кембрийского трехслойного предка, план строения которого включал эпидермальный слой, пищеварительную и половую систему, и мышечную локомоторную систему. Согласно второй гипотезе кишечнополостные являются трехслойными животными с двумя личиночными стадиями развития, вторая из которых - двухслойный полип. Эта гипотеза подтверждается исследованиями жизненных циклов и анатомии различных видов Hydrozoa (Bouillon, 1993). Редукция или полная потеря медузоидной стадии происходила неоднократно в эволюции медузообразных классов, наиболее она заметна у Hydrozoa (Tardent, 1978; Govindarajan et al., 2006). По этой гипотезе медуза является взрослым организмом, конечной стадией эмбрионального развития, а планула и полип являются первой и второй личиночной стадией.

В первой части литературного обзора, посвященной мезоглее и Мк, сделана попытка показать, что Мк хорошо изучены гистологическими, гистохимическими и им-муногистохимическими методами. Однако имеющихся данных не достаточно чтобы однозначно определить их функции и происхождение в онтогенезе.

Вторая часть литературного обзора, посвященная гипотезе о трехслойности кишечнополостных свидетельствует, что, казалось бы устоявшиеся представления о эволюции и эмбриологии продолжают развиваться.

В настоящей работе сделана попытка выяснить функцию Мк через определение ну-клеотидной последовательности мРНК белка, который синтезируют и экскретируют в ВКМ эти клетки. В дальнейшем полученный сиквенс можно будет использовать как маркер дифференцировки Мк, что позволит проследить их происхождение. Возможно, данные такого рода помогут исследователям, интересующимся происхождением мезодермы, уточнить их представления.

6 МАТЕРИАЛЫ И МЕТОДЫ

6.1 Сбор материала.

Объект исследования - представители вида Aurelia aurita (L) (ceM.Ulraaridae, отр. Semaestomae, кл. Scyphozoa). Животных отлавливали в июле-августе в Чупинской губе Белого моря. В работе использовали взрослых животных с диаметром зонтика не менее 10 см. Медуз собирали сачком на глубине до 2 м.

Животных препарировали, отделяя с помощью пинцета и скальпеля эпидерму, мезоглею, очищенную от эпидермы и гастральных каналов, и мезоглею, содержащую гастральные каналы.

6.2 Выделение РНК.

Для выделения РНК использовали набор реагентов Trizol (Invitrogen) согласно рекомендациям изготовителя или протокол с использованием гуанидинтиоцианата (Chomczynski, Sacchi, 1987).

РНК разделяли с помощью электрофореза в 1.5%-ном агарозном геле, содержащем 5 мкг/мл бромистого этидия в ТАЕ буфере (Sambrook et al., 1989). Чистоту выделения и сохранность РНК оценивали по четкости полос 18S и 28S рибосомных РНК, наблюдаемых в УФ свете. Количество РНК измеряли спектрофотометрически по поглощению УФ света с длиной волны 260 iim (Sambrook et al., 1989).

ДНК удаляли из препарата РНК, обрабатывая препарат ДНКазой, свободной от РНКазы. Каждая реакционная смесь, объемом 40 мкл, содержала около 12 мкг РНК, 1 ед ДНКазы (RNase-free; Roche-Boehringer-Mannheim). Реакцию проводили при комнатной температуре в течении 30 мин. Реакционную смесь депротеинизировали фенол-хлороформом, РНК осаждали этанолом (Sambrook et al., 1989).

6.3 Дифференциальный дисплей (ДД).

Использовали опубликованный протокол (Liang, Pardee, 1992). Метод состоит из трех этапов: (1) синтез кДНК, комплементарной мРНК; (2) ПЦР амплификация фрагментов кДНК (ДДПЦР); (3) визуализация амплифицированых фрагментов с помощью электрофореза в денатурирующем полиакриламидном геле (ПААГ).

Синтез кДНК. Обратную транскрипцию (ОТ) проводили в соответствии с рекомендациями фирмы производителя обратной транскриптазы MMulV (Fermentas, Литва) с заякоренным праймером ANK1 (AAGCTTTTTTTTTTTC). В каждую реакционную смесь объемом 20 мкл брали около 0.3 мкг тотальной РНК и 20 ед Ribonuclease Inhibitor (Fermentas, Литва).

ДДПЦР. Использовали заякоренный ANK1 праймер и произвольный RAPD5 (AACGCGCAAC) праймер. Реакционная смесь объемом 15 мкл содержала стандартный буфер для Taq ДНК полимеразы, 1.5 мМ MgC12, 0.02 мМ каждого dNTP, 1 МБк [а-Р33] dATP, 2 ед Taq, 10 пМ каждого праймера и 1 мкл продуктов ОТ, разведенных в 4 раза. Реакцию проводили по программе 95°С 1 мин, 36°С 1 мин, 72°С 1мин, 2 цикла; 95°С 1 мин, 39°С 1 мин, 72°С 1 мин, 40 циклов.

Денатурирующий электрофорез. Продукты ДДПЦР разделяли при помощи электрофореза в 6%-ном полиакриламидном геле толщиной 0.4 мм в ТВЕ буфере при денатурирующих условиях (8 М мочевина, 55°С, 2 Вт/см) (Sambrook et al., 1989). Гель помещали на фильтровальную бумагу Wattmann 1ММ и высушивали. Высушенный гель экспонировали с рентгеновской пленкой в течении ночи.

Клонирование и секвенирование. На радиоавтографе, представляющем результат ДД (рис. 1), выбирали те зоны, которые присутствуют на дорожках, соответствующих мезоглее, и отсутствуют на дорожках, соответствующих эпидерме и гастродерме. Такие зоны содержат фрагменты кДНК генов, возможно, специфически экспрессиру-ющихся в мезоглее. На рис. 1 три такие зоны обозначены стрелкой. Радиоавтограф I

27 совмещали с гелем и отмечали иголкой на геле местоположение интересующих зон. Гель, содержащий отмеченные зоны, вырезали, отмывали от мочевины в 20 мкл де-ионизованой воды в течение 20 мин и помещали в реакционную смесь для ПЦР. Содержащуюся в вырезанных зонах ДНК реамплифицировали с теми же праймерами, с которыми проводился ДДПЦР, и по той же программе в течение 30 циклов. Продукты реамплификации клонировали с помощью набора ТОРО ТА Cloning Kit фирмы Invitrogen. Клетки E.coli DH5a трансформировали продуктами лигазной реакции с помощью набора TransformAid (Fermentas).

- Вставки полученных плазмид секвенировали с помощью набора фирмы Медиген (Новосибирск) и в фирме Хеликс (С.Петербург). В результате секвенирования получили несколько десятков нуклеотидных последовательностей, из которых для дальнейшей работы выбрали последовательности aurpl, aurp52, aurp54 и aurp7.

6.4 Выделение тотальной ДНК A. aurita.

Препарированные гонады половозрелых самцов A. aurita резорбировали множественным иссечением и встряхиванием. Для получения суспензии сперматозоидов резорби-рованную массу фильтровали через мельничный газ. Сперматозоиды осаждали центрифугированием 10 мин при 8000 g. Осадок ресуспендировали в 50 мл CMFSS (0.3 М NaCl, 20 mM KCI, 15 тМ EDTA, 10-50 мМ Tris-HCl рН 7.6) и повторно центрифугировали 10 мин при 8000 g. Из промытого осадка сперматозоидов выделяли ДНК в системе фенол:хлороформ (1:1) и осаждали этанолом (Sambrook et al., 1989).

6.5 ПЦР на тотальной ДНК A. aurita.

Реакционные смеси, каждая объемом 30 мкл, содержали стандартный Taq-буфер, а также 1.5 мМ MgCl2, 0.02 мМ каждого dNTP, 2 ед Taq и 15 пМ каждого из двух праймеров к секвенированым фрагментам. Реакции проводили по программе 95°С 30 сек, 55-59°С (в зависимости от температуры плавления праймеров) 30 сек, 72°С 30 сек, 30 циклов. Использовали пары праймеров:

К фрагменту aurpl 5-TGCGGATGAATCAGATGCTGT-3' и 5'-GCGAATATGCGAAGGCTGAA-3'; к фрагменту aurp52 5'-CAAACACGGTCTAGGAATGTTAAT-3' и

5'-TTCACCTCATTAAAAATCACTGCT-3'; к фрагменту aurP54 5'-TTTGTCTGAAATTTGCCACAGC-3' и

5'-TCAAGGCCAAGGCAGTCAAG-3'; к фрагменту aurp7 5'-TTCTCTGCATTATGGCAACCAAA-3' и

5'-GGATGATATAGGTGTTGGCACAG-3'.

6.6 Обратнотранскриптазная ПЦР (ОТПЦР).

Обратную транскрипцию производили, как описано ранее. Реакционные смеси для ПЦР объемом 30 мкл содержали стандартный Taq-буфер, dNTP, Taq и праймеры в количествах, описанных для ПЦР на тотальной ДНК A. aurita. Реакционные смеси также содержали 1 мкл продуктов ОТ, разведенных в четыре раза. Реакции проводили по программе описанной выше для ПЦР на тотальной ДНК A. aurita.

Электрофорез продуктов ПЦР и ОТПЦР. Продукты ПЦР и ОТПЦР разделяли электрофорезом в 1%-ном агарозном геле, содержащем 5 мкг/мл бромистого этидия в ТАЕ буфере, и фотографировали в УФ свете (Sambrook et al., 1989). Электрофорез ДНК и РНК.

Электрофорез ДНК и РНК проводили в 1%-ном агарозном геле в ТАЕ (40 мМ Трис-ацетат, рН 7.5, 1 мМ EDTA). Гель после электрофореза окрашивали в растворе 0.5 мкг/мл бромистого этидия.

6.7 Флюоресцентная гибридизация in situ

Одноцепочечные ДНК зонды меченые биотином или дигоксигенином получали с помощью ПЦР (Стикланд, 1999).

Для получения биотинилированого зонда ПЦР смесь содержала: стандартный ПЦР буфер (50mM КС1, ЮтМ Tris- НС1 рН8.3,1.5тМ MgC12,0.2% желатина), 0.2тМ dATP dGTP dCTP, 0.13 dTTP, 0.07 биотин-11-dUTP, 30mM oligo(dT) или Arbitrary Primer, 0.05мкг/мкл ДНК матрицы, 2 ед. Taq ДНК полимеразы на реакцию.

Меченый дигоксигенином зонд получали также как описано в пред идущем абзаце, вместо биотин-11-dUTP добавляли эквимолярное количество dig-dUTP.

Контроль за интенсивностью мечения зонда и его длиной состоит из трех эта-пов(Чан, 1999):

1. Электрофорез зонда в агарозном геле как описано выше.

2. Для капиллярного переноса зонда из геля на нитроцельюлозную мембрану на бумажный фитиль концы которого помещены в 10xSSC(150mM NaCl, 15мМ цитрат натрия, рН 7.0) помещали гель, поверх геля помещали нитроцельюлозную мембрану, поверх мембраны стопку фильтровальной бумаги придавленной грузом. Перенос проводили в течение 2 часов (Sambrook et al., 1989).

3. Визуализация зонда на мембране обработкой комплексом стрептавидин- щелочная фосфатаза с последующей реакцией на щелочную фосфатазу. Использовали растворы: PBST (150mM NaCl, ЮтМ фосфат натрия, 0.1% Tween 20, рН 7.5), смесь для реакции на щелочную фосфатазу (0.1М NaCl, ЮмМ MgCl, 0.1М Tris- НС1, рН9.5, 0.165мг/мл BCIP, О.ЗЗОмг/мл NBT), Блокирующий раствор (1% обезжиренное сухое молоко, PBST).

Высушенную мембрану помещали последовательно в 5 мл PBST на 5 мин х 3 раза; в блокирующий раствор на 30 мин; в 5 мл PBST 3 раза по 5 мин; в раствор коньюгата стрептавидин-щелочная фосфатаза в PBST на 30 мин; в 5 мл PBST 3 раза по 5 мин; в 2мл смеси для реакции на щелочную фосфатазу на 30 мин; промывали в воде и высушивали.

Материал для in situ гибридизации фиксировали следующим образом: фрагменты медузы объемом около 1мл, включающие эпидермис, мезоглею и гастродерму вырезали и фиксировали в 4%ПФА/PBS или 4%ПФА/морская вода в течении 4х часов, далее фиксированный материал хранили в 80% спирте при 4С.

Для гибридизации использовали растворы : PBS (150шМ NaCl, 10mM фосфат натрия, РН 7.5), PBST, SSC (150mM NaCl, 15мМ цитрат натрия, рН 7.0), SSCT (SSC, 0.1% Tween 20), смесь для реакции на щелочную фосфатазу.

Для гибридизации in-situ на срезах использовали протокол (Яп и др., 1999) с некоторыми модификациями. Сначала изготавливали срезы на замораживающем микротоме. Кусочки фиксированного материала проводили через спирты 70% 50% 30% в PBS; заключали в ОСТ -20 фирмы Brite, помещали в изооктан, охлажденный до температуры замерзания на 20 сек., после этого в жидкий азот на 5 мин. Замороженные кусочки закрепляли в замораживающем микротоме, нагревали до -20С и нарезали на срезы толщиной 15-25 мкМ. Срезы помещали на предметные стекла покрытые полилизином. Срезы высушивали на воздухе и хранили при -20°С. Гибридизационная смесь содержала: 40-50% формамид, 10% декстрансульфат, 4xSSC, 0.5мкг/мкл тРНК, 0.5мкг/мкл ДНК спермы лосося обработанной ультразвуком, 0.05мкг/мкл биотинили-рованого зонда.

Для гибридизации зонд перед добавлением в гибридизационную смесь денатурировали при 80° С Юмин. Срезы выдерживали в PBST от 2 часов до 2 недель затем обрабатывали протеиназой К. Отмывали от протеиназы К. в PBST 3 раза по 5 мин. Повторно фиксировали в 4%PFA/PBS 10 мин. Гибридизацию проводили в течении 12и часов при 45-55°С. (в некоторых случаях препарат покрывали силиконированым покровным стеклом, которое приклеивали к предметному резиновым клеем ). Препарат отмывали от зонда в 4xSSCT 3 раза по 5 мин; обрабатывали раствором коньюгата стрептавидин-FITC в течение 30 мин; отмывали в 4xSSCT 3 раза по 5 мин; в течение 30 мин обрабатывали раствором антител против стрептавидина, коньюгированых с биотином; отмывали в 4xSSCT 3 раза по 5 мин; обрабатывали раствором коньюгата стрептавидин-FITC в течение 30 мин; окрашивали 0.5мкг/мл DAPI в течение 10 мин; отмывали водой 3 раза по 5 мин; высушивали на воздухе, заключали в глицерин и накрывали покровным стеклом.

Препараты, прошедшие гибридизацию и окрашенные DAPI, наблюдали в люминесцентный микроскоп (Axioscop Ceis) и фотографировали с помощью черно-белой цифровой камеры. Полученным с помощью различных фильтров микроскопа черно-белым изображениям ядер клеток, окрашенных DAPI, и зонда, окрашенного FITC, с помощью цифровой обработки, придавали искусственные цвета, затем изображения совмещали наложением. Для работы с цифровыми изображениями использовали Adobe Photoshop 4.0.

6.8 Электрофоретическое разделение белков и их окрашивание в геле.

Белковый состав эпидермы, гастродермы, мезоглеи и Мк сравнивали разделяя гомоге-наты соответствующих образцов с помощью диск электрофореза в полиакриламидном геле в присутствии додецилсульфата натрия по стандартной методике (Laemmli, 1970). Концентрация акриламида в гелях составляла 4-12%. Гель фиксировали в растворе, содержащем 10% уксусной кислоты и 40% этанола в течение 1 ч, затем окрашивали 0.25% Кумасси G-250 (Sigma), 10% уксусной кислоты и 40% в течение 20 мин и отмывали в нескольких сменах 7% уксусной кислоты.

6.9 Получение антител против рА47.

После разделения гомогената мезоглеи с помощью диск электрофореза фрагмент геля соответствующий зоне содержащей мажорный белок мезоглеи рА47 вырезали, гомогенизировали в PBS и смешивали с адьювантом в соотношении 1:1. Эту смесь внутри-кожно инъецировали двум взрослым кроликам. Через 4 недели кроликов повторно иммунизировали той-же смесью внутримышечно. Кровь забирали через неделю после последней иммунизации. Аликвоты сыворотки крови хранили при -20°С. Иммунную сыворотку назвали RA47.

6.10 Иммуноблот (Вестерн болот).

Процедура основана на опубликованной Towbin et al. (1979). После разделения белков с помощью диск электрофореза, их переносили на активированную метанолом polyvinylidene difluoride (PVDF) мембрану (0.45 mm pore size, Millipore Corporation, USA) в модифицированном Лэммли электродном буфере (25 mM Трис, 192 тМ глицин, рН 8.3, 0.001% SDS, 10% метанол) с помощью полусухого переноса.

Мембраны инкубировали в 20 мМ Трис-HCl, рН 7.5, содержащем 0.02% Tween-20, 1% казеинат натрия и 3% бычий сывороточный альбумин. Отмывку мембран проводили в растворе 20 мМ Трис-HCl, рН 7.5,150 мМ NaCl, и 0.02% Tween-20 (TBS-Tw). В этом же растворе разводили антитела. Окраску, связавшихся вторых антител конью-гированых с пероксидазой хрена (GAR, ICN Biomedicals, USA), проводили раствором тетрохлорида 3,3-диаминобензидина.

6.11 Иммуноцитохимия.

Фрагменты растущей медузы фиксировали в растворе Буэна в течение 24 часов и промывали 70% градусным этанолом. Фиксированные образцы заключали в парафин и изготавливали срезы 5-7 мкм толщиной. После депарафинизации остатки пикриновой кислоты отмывали 70%-ым этанолом, после чего срезы промывали в трех сменах TBS-Tw. Срезы инкубировали с 3%-ым лиофилизованым молоком в TBS-Tw в течение часа, промывали в четырех сменах TBS-Tw по 10 мин и инкубировали с RA47 в разведении 1:2000 в течение одного часа, промывали и инкубировали в растворе коньюгированных со щелочной фосфатазой антител goat-anti-rabbit Ig (GAR-АР, Sigma), затем окрашивали раствором BCIP-NBT (Sigma).

Все операции проводили при комнатной температуре (18°С). Окрашенные срезы покрывали 80%-ым глицерином и наблюдали в световой микроскоп. Для иммуно-флюоресценции использовали вторые антитела коньюгированые с FITC (GAR-FITC, Sigma). Такие препараты наблюдали в эпифлюоресцентный микроскоп Zeiss Axioplan с цифровой камерой (CCD camera, Sony) под управлением программного обеспечения KS100 software (Carl Zeiss, Germany). Для отрицательного контроля, некоторые срезы инкубировали с преиммунной сывороткой, с последующими обработками как описано выше. Микрофотографии готовили к публикации с помощью редактора изображений Adobe Photoshop 6.0.

6.12 Кислый-мочевинный электрофорез проводился, как описано в публикациях (Panyim, Chalkley, 1969; Podgornaya, Shaposhikova, 1998).

6.13 Приготовление проб мезоглеина для MALDI и белкового секвенирования по Эдману.

Пробы для MALDI спектроскопии (Pappin et al., 1993) и белкового секвенирования по Эдману (Edman degradation) готовили одинаково. Гомогенат мезоглеи разделяли методом диск-электрофореза в 7%-ном полиакриламидном геле в присутствии доде-цилсульфата натрия (Laemmli, 1970). Из геля вырезали зону, соответствующую 45/47 кДа, и использовали этот фрагмент геля для MALDI и белкового секвенирования.

MALDI анализ был проведен фирмой ПИННИ (Москва). Белковое секвенироваиие было проведено Protein Resource Center of The Rockefeller University (USA).

6.14 Клонирование мРНК мезоглеина.

Для клонирования мРНК мезоглеина использовали протокол, основанный на опубликованном (Matz et al., 1999).

Синтез кДНК. Для удаления ДНК из проб тотальной РНК пробы обрабатывали ДНКазой (RNAse free DNAse; Roche). ДНКазу удаляли фенол-хлороформом. Для обратной транскрипции использовали около 1 мкг тотальной РНК, праймер ml3rtl2v (5'-CAGGAAACAGCTATGACaagcttttttttttttv), специфический к поли-А последовательности мРНК, с адаптерной последовательностью и обратную транскрип-тазу SuperScriptll (Invitrogen). Реакцию проводили при условиях рекомендованных производителями обратной транскриптазы. Продукты обратной транскрипции разводили в 5 раз и хранили при -20°С.

6.14.1 3' Rapid Amplification of cDNA Ends (3'RACE ПЦР) с вырожденными праймерами проводили с помощью двух последовательных ПЦР реакций. В реакциях использовали гнездовые (nested) праймеры, специфические к пептиду YTFIENR праймеры (DGSP1, DGSP2) и STEP-OUT (Matz et al., 1999) праймеры (ml3r-heel, heel), специфические к адаптерной последовательности праймера, использовавшегося для обратной транскрипции.

Нуклеотидную последовательность частично вырожденных гнездовых праймеров, специфических к пептиду, генерировали с помощью программы CodeHope (Rose et al., 2003). К 5' концу генерированных CodeHope последовательностей добавили короткие произвольные последовательности, чтобы получить праймеры, имеющие температуру плавления около 60°С.

Первая 3'RACE ПЦР реакция содержала 1 мкл кДНК, праймеры DGSP1 (5 '-accggat aatacgcTAyacntty) и STEP-OUT праймер ml3r-heel (5'-gtaatacgactcactatagggccaggaaacagctatgac), Taq буфер (Fermentas), 2 ед. Taq (Хеликон, Москва), 0.2 мМ каждого dNTP и 1.5 мМ MgC12. ПЦР проводили по программе, состоящей из одного цикла с температурой отжига 45°С, 10 циклов touchdown ПЦР (Don et al., 1991) с температурой отжига, снижающейся с 70°С до 60°С, и 20 циклов с температурой отжига 60°С.

Вторая 3'RACE ПЦР реакция содержала 1 мкл продукта первой реакции, разведенного в 100 раз, праймеры DGSP2 (5'-aagaggccacaTATACATTTathgaraaymg) и STEP-OUT праймер heel (5'-gtaatacgactcactatagggc), остальные компоненты смеси -как в первой 3'RACE ПЦР реакции. ПЦР проводили по программе, состоящей из одного цикла с температурой отжига 55°С, 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 70°С до 60°С, и 25 циклов с температурой отжига 60°С.

Полученный ПЦР продукт дотировали в вектор pCRII с помощью набора ТОРО ТА (Invitrogen). Лигазной смесью трансформировали E.coli линии DH5a, как описано выше. Вставки выделенных из бактерий плазмид секвенировали в фирмах Омникс (С.Петербург), Силекс (Москва), ПИННИ (Москва).

Полученную в результате секвенирования нуклеотидную последовательность использовали для конструирования последовательностей трех гнездовых праймеров для 5'RACE ПЦР.

6.14.2 5'RACE ПЦР.

3' конец ранее полученной кДНК полиаденилировали с помощью фермента TdT (Fermentas) в соответствии с рекомендациями производителя фермента. 5'RACE ПЦР проводили в с помощью трех последовательных ПЦР реакций, использующих гнездовые (nested), специфические к полученному в результате 3'RACE фрагменту нуклео-тидной последовательности кДНК мезоглеина праймеры (5GSP1, 5GSP2, 5GSP3) и

STEP-OUT праймеры (ml3rtl2v, ml3r-heel, heel), специфические к олиго(дА) последовательности, добавленной к 3' концу кДНК.

Первая 5'RACE ПЦР реакция содержала полиаденилированую кДНК, праймеры 5GSP1 (5'-tcantttcgcttcgattgggt) и ml3rtl2v, Taq буфер (Fermentas), смесь Taq (Хели-кон, Москва):Vent (NEB) 20:1,0.2 мМ каждого dNTP и 1.5 мМ MgC12. ПЦР проводили по программе, состоящей из одного цикла с температурой отжига 38°С, и повторенных 2 раза 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 60°С до 50°С.

Вторая 5'RACE ПЦР реакция содержала 1 мкл продукта первой реакции, разведенного в 100 раз, праймеры 5GSP2 (5'-gcgttggagtanctgctgtctg) и ml3r-heel, остальные компоненты смеси, как в первой 5'RACE ПЦР реакции. ПЦР проводили по программе, состоящей из повторенных 2 раза 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 62°С до 52°С.

Третья 5'RACE ПЦР реакция содержала 1 мкл продукта второй реакции, разведенного в 100 раз, праймеры 5GSP3 (5'-actggaatgcgccaaatcc) и heel, остальные компоненты смеси, как в первой 5'RACE ПЦР реакции. ПЦР проводили по программе, состоящей из повторенных два раза 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 62°С до 52°С и 3 циклов с температурой отжига 57°С.

Полученный ПЦР продукт клонировали и секвенировали, как описано выше.

6.15 Анализ экспрессии мезоглеина в эпидермисе, мезоглее и гастродерме методом ОТПЦР. кДНК тотальной РНК из эпидермы, гастродермы и мезоглеи, полученную как описано для Дифференциального Дисплея, использовали как матрицу для ОТПЦР. ПЦР реакция содержала праймеры, специфические к кДНК мезоглеина 5'-gtttccttcgcacccactcg и 5'-tggatttggcgcattccag, остальные компоненты реакции, как описано для 3'RACE ПЦР. Реакцию проводили по программе, состоящей из 40 циклов с температурой отжига

57°С.

6.16 Программное обеспечение.

Для конструирования частично вырожденных праймеров на основе аминокислотной последовательности пептида использовали WWW сервис CodeHop (Rose et al., 2003). Для конструирования всех остальных праймеров использовали программу FastPCR (Kalendar, 2006).

Для вычисления молекулярной массы, теоретической кривой титрования и pi мезоглеина по его аминокислотной последовательности использовали программы pI/Mw (Gasteiger et al., 2005), ProtParam (Gasteiger et al., 2005) EMBOSS (Rice et al., 2000).

Для предсказания сайтов О-гликозилирования использовали NetOglyc и NetNglyc (Julenius et al., 2005).

Для предсказания того, является ли мезоглеин GPI-ancored белком, использовали big-PI Predictor (Eisenhaber et al., 2000).

Для поиска известных доменов и мотивов в аминокислотной последовательности мезоглеина использовали NCBI Conserved Domain Search online service (Marchler-Bauer, Bryant, 2004) и SMART (Letunic et al., 2006).

7 РЕЗУЛЬТАТЫ.

7.1 Поиск генов, дифференциально экспрессирующихся в мезоглее методом Дифференциального Дисплея.

Для выявления генов, специфически экспрессирующихся в клетках эпидермы, мезоглеи и гастродермы, каждую особь A. aurita разделяли на 3 соответствующие части как описано в разделе "Материалы и методы". Из каждого препарата выделяли тотальную РНК и сравнили эти РНК при помощи дифференциального дисплея (рис. 1). Чтобы исключить из анализа дифференциальные зоны, специфические для отдельных особей A. aurita, ДД повторен на РНК трех особей медуз. Продукты ДДПЦР на РНК из одинаковых тканей разных медуз нанесены в соседние карманы геля. На рис. 1 стрелками отмечены зоны, которые есть в мезоглее, но отсутствуют в эпидерме или гастродерме, и повторяющиеся в пробах РНК разных медуз. Это мезоглеальные дифференциальные зоны. Они содержат фрагменты кДНК, которые могут быть фрагментами дифференциально экспрессирующихся транскриптов.

Для того, чтобы добиться повторяемости наборов зон на РНК разных особей медузы и наблюдать при этом дифференциальные зоны, поставили около 100 ДДПЦР с различными произвольными праймерами и условиями реакций. Праймеры и условия ДДПЦР, с применением которых получили лучший результат, описаны в разделе ДДПЦР "Материалы и методы".

Участки геля, содержащие дифференциальные зоны (рис. 1), вырезали и использовали для реамплификации содержащихся в них фрагментов ДНК. Каждая вырезанная дифференциальная зона обычно содержит смесь фрагментов ДНК одинаковой длины. ДНК, реамплифицированая из вырезанных участков геля, была клонирована и секвенирована.

Секвенировано 10 фрагментов кДНК, полученных при помощи ДДПЦР. При их сравнении с известными генами в базах данных GenBank и EMBL при помощи про ч ч

Щ?. штт

I II III I II III I II III

Рис. 1: Радиоавтограф электрофореза продуктов ДДПЦР реакций на РНК трех особей A. aurita (I-III) с праймерами ANK1 и RAPD2. Продукты ДДПЦР с РНК из клеток эпидермы (Е), мезоглеи (М), гастродермы (G). Стрелками обозначены дифференциальные зоны. граммы BLAST (Altschul et al., 1997) 4 фрагмента показали высокую степень гомологии (87-100%) с различными генами бактерий. Поскольку РНК для ДДПЦР была получена из медуз, пойманных в природе, и контаминация бактериальной РНК весьма вероятна, такие фрагменты были исключены из дальнейшего анализа.

Один из фрагментов на 99% гомологичен гену AY033611.1 Homo sapiens placenta immunoregulatory factor PLIF mRNA. ПЦР на матрице тотальной ДНК A. aurita с праймерами к данному фрагменту не подтвердила его принадлежность медузе. При обработке тотальной РНК и при обратной транскрипции был использован ингибитор РНКазы, полученный из плаценты человека (Fermentas), и ОТПЦР показал наличие этого фрагмента только в препаратах к ДНК, полученных с использованием этого ингибитора. Поэтому данный фрагмент также был исключен из дальнейшего анализа.

Фрагмент aurp54 (рис. 2) на 98% гомологичен с гену AF161446 Homo sapiens HSPC328. Фрагменты aurpl, aurp7, aurp52 (рис. 2) не показали достоверной гомологии с известными генами содержащимися, в базах данных GenBank и EMBL.

Для того, чтобы проверить принадлежность секвенированых фрагментов A. aurita, провели ПЦР тотальной ДНК медузы с праймерами к этим фрагментам. Такая проверка позволила подтвердить принадлежность фрагментов aurp7, aurp52 и aurp54 медузе, но не фрагмента aurpl. ОТПЦР РНК нескольких особей A. aurita с праймерами к этому фрагменту дал продукт ожидаемого размера. На основании результатов ОТПЦР можно заключить, что aurpl принадлежит A. aurita.

Тканеспецифичная экспрессия генов фрагментами которых являются последовательности aurpl, aurp7, aurp52, aurp54, была проверена ОТПЦР на РНК из клеток эпидермы, мезоглеи и гастродермы. Для этого РНК из соответствующих клеток была обработана ДНКазой и проведена обратная транскрипция (ОТ) с праймером ANK1, комплементарным поли-А концу мРНК. Полученная кДНК была использована для ПЦР с праймерами к секвенированым фрагментам. С помощью ОТПЦР с праймерами к фрагментам aurpl, aurp52, aurp54 было показано, что они не тканеспецифичны.

Результат ОТПЦР с праймерами к фрагменту aurp7 представлен на рис. 3. На дорожках, содержащих продукты ОТПЦР на РНК из клеток эпидермы разных особей A. aurita (дорожки 1,4), видны зоны, представляющие продукты ОТПЦР. Продукты реакции на остальных дорожках отсутствуют (слабые зоны на них - праймеры). Таким образом, ОТПЦР показала, что фрагмент aurp7 специфичен для эпидермы.

Тканеспецифичная экспрессия гена фрагментом которого является последовательность aurp52 была проверена флюоресцентной гибридизацией in situ на срезах медузы. На рис. 4а приведена гибридизация одноцепочечного антисмыслового (комплиментарного к aurp52) ДНК зонда на срезе. В цитоплазме Мк, по периферии ядер, видны черные точки гибридзационного сигнала. На рис. 4Ь приведен отрицательный контроль -гибридизация с одноцепочечным смысловым зондом, на этом рисунке гибридизацион-ный сигнал отсутствует. Таким образом, ДНК зонд гибридизуется с РНК в клетках, однако зонд aurp52 гибридизуется как с РНК в Мк, так и с РНК в клетках эпидермы и гастродермы (данные не приведены) и тканеспецифичным не является, что согласуется с результатами проверки локализации его экспрессии методом ОТПЦР.

Секвенировано 4 фрагмента неизвестных генов A. aurita. Из них 1 дифференциально экспрессируется в эпидерме медузы. Генов, специфично экспрессирующихся в Мк, с помощью метода дифференциального дисплея, обнаружить не удалось. aurpl

GTGCTGCAGC CTTAGTTCAA AACAATGCGG ATGAATCAGA TGCTGTTAAT CCTTCCGTAT TAATGACTAG AATTGTTCAG CCTTCGCATA TTCGCGAAGA ATCAGAAGAT TTACACACTC CTGATACGAA TGAAATTCCT ATTGTAACTA AGAAAAACGG CAAAATATCT ACTGATCCGC ACGATCCGGA T aurp52

CAAACACGGT CTAGGAATGT TAATGTAAGG AAAGCTATAT CAAAGTATGA AGAATTAACT TCGTATATTA ACTTGTTTTA AGAATATGCT TTCAAACCAT ATTAGCAGTG ATTTTTAATG AGGTGAATAA TTTAATG aurp54

CCACAACTTT GATTCCCTTT GTCTGAAATT TGCCACAGCT TGACTGCCTT GGCCTTGATT TTGTGTCCTT CAACTTCATG aurp7

GTAGGAGACT AAACGGTTAT GAAGATTTTA TCGTCAGTAG GTAAGTAGAG CTAAGAGACG TAATACCGTT GGTTTTTATA CTAAGAAGAA CGGTTTGTTT TAACCGTCCC TATCAAATAT

Рис. 2: Нуклеотидные последовательности, полученные методом ДДПЦР. ,,

Е М G Е М G I Щ

L 1 2 3 4 5 6

Рис. 3: Электрофорез в 1% агарозном геле продуктов ОТПЦР, полученных с РНК из клеток эпидермы(Е), мезоглеи(М) и гастродермы(С) двух особей Aurelia aurita (I, II), с праймерми к фрагменту aurp7.

Рис. 4: Срезы медузы, гибридизованные in situ in situ с одноцепочечными ДНК зондами изготовленными на матрице клонированого фрагмента aurp52. На рис. За: FISH с антисмысловым зондом рис. 36: FISH со смысловым зондом. Стрелками обозначен гибридизационный сигнал. Масштабный отрезок 10 мкм.

7.2 Выявление мажорного белка мезоглеи.

Белковый состав гастродермы и эпидермы мезоглеи и Мк сравнили с помощью диск-электрофореза (Рис. 5 I). Для выделения Мк мезоглею обрабатывали коллагеназой и осаждали освободившиеся от ВКМ клетки центрифугированием. Выделенные клетки оставались живыми и подвижными. Ни один из проанализированных типов клеток не обладает очевидными специфичными мажорными белками. В каждом случае мажорным белком является актин, с молекулярной массой 42 кДа. Следующий по количеству белок, судя по его молекулярной массе около 32 кДа, является гистоном HI. Остальные белки имеют молекулярные массы от десятков до сотен кДа. Распределение и интенсивность полипептидов сходны в эпидерме и Мк, и оба они отличаются от гастродермы. Это сходство может свидетельствовать в пользу происхождения Мк от клеток эпидермы.

Гомогенат мезоглеи, который использовали для диск электрофореза, содержал, также, Мк, но их количество так мало, что на дорожке с мезоглеей, полипептиды характерные для Мк практически не видны (Рис. 5 I). Мажорные белки, видимые на этой дорожке, скорее всего являются компонентами ВКМ. Три зоны с молекулярными массами около 150 к Да, соответствуют коллагенам, которые являются мажорными белками ВКМ гидры (Sarras and Deutzmann, 2001). Самые верхние зоны, вероятно соответствуют фибрилину ( 330-340 кДа) (Har-El and Tanzer, 1993; Reber-Muller et al., 1995). Самый интересный полипептид мезоглеи обладает молекулярной массой 47 кДа (рА47). Белок с близкой массой, 45 кДа, наблюдали в ВКМ гидры. Он не реагировал ни с какими антителами против известных белков ВКМ позвоночных и не было никаких предположений о его природе (Sarras et al., 1991).

Поликлональные антитела против рА47,на иммуноблоте диск электрофореза, окрашивают соответствующую зону на дорожке с мезоглеей (Рис. 5 И, М). На дорожке с Мк антитела слабо окрашивают зону 47 кДа, более ярко окрашены зоны с массами

Рис. 5: (I) Диск электрофорез окрашенный Кумасси. Гастродерма (Г), эпидерма (Е), мезоглеальные клетки (Мк), мезоглея (М). Скобкой справа от рисунка обозначены 3 зоны соответствующие коллагенам. Слева от рисунка обозначены молекулярные массы маркерных белков в кДа. (II) иммуноблот окрашенный антителами RA47. Дорожки обозначены как на (I). Разведение сыворотки 1:3000.

120 кДа и 80 кДа (Рис. 5 II, Мк). Эти две зоны также окрашиваются на дорожке с эпидермой, но несколько слабее (Рис. 5II, Е). Гастродерма не содержит полипептидов с соответствующими антигенными детерминантами (данные не показаны).

На срезах медузы антитела против рА47 окрашивают волокна в ВКМ мезоглеи и гранулы в цитоплазме Мк (Рис. б). Поперечные срезы фибрилл окрашены как окружность с размытыми краями (Рис. 6 I, Ь, обозначены стрелками). Для окрашенных клеток, также, характерны размытые границы. На Рис. 6 II видны ярко окрашенные гранулы в цитоплазме Мк растущей медузы. Контуры клеток расплывчаты, они выглядят, как будто, окруженными не ярко окрашенным материалом. Вещество ВКМ окрашено слабо, и фибриллы других типов менее заметны чем выявленные иммуно-флюоресценцией (Рис. 6 I, Ь). Складывается впечатление, что материал гранул Мк экскретируется в ВКМ, где формирует фибриллы.

В клетках эпидермы, антиген равномерно распределен по цитоплазме, но окраска наиболее яркая в апикальной части клеток (Рис. б II, а).

Гастродерма не окрашивается RA47 (данные не приведены), что согласуется с биохимическими данными.

Иммунохимичиские и биохимические данные позволяют заключить, что Мк и клетки эпидермы синтезируют один из мажорных белков мезоглеи, являющийся компонентом "эластических"волокон.

Рис. 6: Иммуноцитохимическая окраска срезов медузы антителами против р47. Разведение сыворотки 1:2000. (I) Визуализация окраски антителами коньюгироваными с FITC: а - фазовый контраст; b - иммунофлюоресценция. Поперечные срезы "эластических "вол окон обозначены стрелками. (II) Визуализация окраски антителами коньюгироваными с щелочной фосфатазой и NBT-BCIP: а - эпидермис и прилегающая часть мезоглеи; b - фрагмент из толщи мезоглеи, Масштабный отрезок 5 мкм.

7.3 Заряд мезоглеина и условия его экстракции из мезоглеи.

Гистохимические данные (Napara et al., 1996а) позволяют предположить, что мезо-глеин имеет положительный заряд. Для того чтобы проверить это предположение, гомогенат мезоглеи был разделен с помощью кислого электрофореза в присутствии мочевины (Panyim and Chalkley, 1969) (рис. 7). В результате такого разделения выявили 5 зон, соответствующих положительно заряженным белкам. С помощью имму-ноблота обнаружили, что одна из полученных зон окрашивается антителами против мезоглеина.

Соответствие молекулярной массы белка, содержащегося в данной зоне, массе мезоглеина, подтвердили с помощью диск-электрофореза и иммуноблота (рис. 7, II).

Чтобы выяснить, при каких условиях мезоглеин экстрагируется из мезоглеи, применяли экстрагирующие растворы с различными рН и ионной силой. Оказалось, что мезоглеин хорошо экстрагируется при рН ниже рН 3, а ионная сила раствора почти не имеет значения.

II III

1234 56 123456

Рис. 7:1 - Кислый-мочевинный гель-электрофорез мезоглеи, окрашенный Кумасси (1). Иммуноблот фореза окрашенный преиммунной сывороткой (2) и антителами против мезоглеина (3). II Диск-электрофорез зон вырезанных из геля кислого-мочевинного фореза (1-5) и гомогената мезоглеи (6). Номера дорожек соответствуют номерам зон на 1(1). Справа приведены молекулярные массы маркерных белков. III - Иммуноблот диск электрофореза, окрашенный антителами против мезоглеина. Стрелки указывают на зоны, соответствующие мезоглеину.

7.4 Молекулярное клонирование мРНК мезоглеина.

С помощью электрофоретического анализа белкового состава мезоглеи зрелых медуз A. aurita были обнаружены нескольких мажорных белков. Антитела к одному из них, белку массой 45/47 кДа, окрашивают белковые гранулы в цитоплазме мезоглеальных клеток; у зрелых медуз они также окрашивают волокна в ВКМ мезоглеи и апикальную часть клеток эпидермы (Shaposhnikova et al., 2005). На основании этих данных можно заключить, что Мк A. aurita участвуют в процессах формирования ВКМ мезоглеи, наряду с эпидермальными клетками.

Масс- спектрометрический анализ набора пептидов (MALDI), полученных из белка массой 45/47 кДа трипсинолизом, не позволил обнаружить в базах данных аминокислотной последовательности данного белка.

Попытка получить N-концевой фрагмент аминокислотной последовательности интересующего белка методом белкового секвенирования по Эдману (Edman degradation) не дала результата. Возможно, N-конец белка 45/47 кДа блокирован.

Белковое секвенирование по Эдману пептидов, полученных из белка 45/47 кДа трипсинолизом, дало 4 аминокислотных последовательности (DDAQGHYTCNADE; DSXYSNAH; YTFIENR; CTSGCEGNNI). Сравнение полученных последовательностей с белками в базах данных показало, что пептиды не принадлежат ни одному из известных белков.

Молекулярное клонирование мРНК этого белка дало нуклеотидную последовательность длиной 1421 нп. Последовательность содержит открытую рамку считывания длиной 1249 нп и вариант сигнала полиаденилирования (АТТААА) на 18 нп выше поли-А последовательности на З'конце (рис. 8).

Теоретическая транскрипция открытой рамки считывания дает гипотетический белок длиной 416 аминокислотных остатков (аа) и расчетной молекулярной массой 47223 Да (ProtParam).

Все 4 аминокислотных последовательности пептидов содержатся в последовательности гипотетического белка (рис. 8).

Сравнение последовательности гипотетического белка с последовательностями белков содержащимися в базах данных показало, что это новый белок. Мы назвали его мезоглеин.

Нуклеотидная последовательность мРНК мезоглеина размещена в GenBank (Accession Number DQ467654). Была клонирована, также, мРНК мезоглеина, отличающаяся от приведенной на 22 нп. Она размещена в GenBank (Accession Number EF093532).

1 CTTGTCTTGGCGCAGACGAAGACAGAAGAGGCCCCTGGTGCAGAAAAGGTTAACTGGTAC L S W

R R R

R! Q К R| PLVQKRLTGT 20 61 AGAAGGCATCAAAATGAAGTTTTTTGTCTCCATCGTTTTCTTGCTTGCATCTTTTGAGGA

EGIKMKFFVSIVFLLASFEE 40 121 GATGTCCTTGCAACAGATCTCCGACGCAATCATCCCATGCGTGGCTCGAGATGATGCACA

M s D A Я. 60

181 GGGGCATTATACATGT^

241 AAGCAAC AATTGTTTi^G AGATTCAAGATСGGAAGTATСATGTGGGATAAACTTСATGAG

SEVSCGINFMR 100

N N

R D S R

301 GATTGAGATCGACAGAAAGTACTTCGACCCTGCTAAATATTCCCGCATCAGCTTGAAGGA

IEIDRKYFDPAKYSRISLKD 120 361 CGAAGGCTGTAAATCTACTCTCTCAAAGACGAAAATCGTCTTGGATTCAGCACCACAGAA

EGCKSTLSKTKIVLDSAPQN 140 421 TTGTGGATCAACAAAGGTTGAAAACGAGAATTACATCATCTACCAAAACGAGGTTTTTAT

CGSTKVENENYI IYQNEVFM 160 4 81 GAAAGCTATCCCAACTGGTAAAATCGTAACAAGGGAACATGACGTCAAGGTTACGTTTTC

К A I P[|GKIVTREHDVKVTFS 180 541 ATGTTCATACAACAAATCTGGAATGGTCAGCATTGAAGCTTTCAATCCAATTACCATTGT

CSYHlKSGMVSIEAFNPITIV 200 6 01 TGATGTCAAAGAAGATGGATTTGGCGCATTCCAGTTTCATTTCAAAATGTATACAGACAG

DVKEDGFGAFQFHFKMYTPS 220 661 CAGNTACTCCAACGCACATTCGAAATACCCAATCGAAGCGAAANTGACTGACAACTTGTA ySWAHSKYPIEAKXTDNLY 24 0 721 CTTTGAAGCAAACACCACTGCAAGTGATAATGATTTGGNGATTCTGATCGATCAGTGTTA

FEAilTTASDNDLXILIDQCY 260 781 TGCAACACCTACCATGGAACGCAACAATGCACTCAAATACACTTTTATCGAGAATAGATG

ATPTMERNNALKYTFiaWRC 280 841 TGCTTTGGAAGATAATGTGAAATTCGTGAAAGCAGAACGCAAGAAGCAAAGATTCAGCAT

ALEDNVKFVKAERKKQRFSM 300 901 GCAAGCATTTACATTCATCCAAAAGATTTCAACTGTCTACGTTCACTGCGTCGTATTCAT

QAFTFIQKISTVYVHCVVFM 320 961 GTGCAGAAAATCCGCAAAAACAGGACAGTGTACGAGTGGGTGCGAAGGAAACAATATCAA

CRKSAKTGQCTSGCgGN WIN 340 021 CGGAGCTCGTAGGGATCTTTCAAGCTACGCTGGCGGTGATAAAAAATCCTATTCCAAATA

GARRDLSSYAGGDKKSYSKY 360 081 CAACCTGTTGGATATTGGACCACTTTACCGGAAAGAACGTAGCATTGGAACTGAAAAAAA NLLDIGPL

R К E R

I G T E К К 380 141 GAGTCACCCAACACACTTTACAACGATCGGTTTGGTCGCTGGAGTCTGCAGTCTTATGTT

SHPTHFTTIGLVAGVCSLMF 400 201 TGGTGATTGCAGGAGTGGTTCTCAAAATGAGAAGATCCAGACGTGGAAATAATATTCCAA

GDCRSGSQNEKIQTWK* 416

261 TGAATGAAGTCATTGCTGAGCCACAAGAAAAATGTGATAATGAAAATCTTCTTTAATCAA 321 GAGACGAATCATTATTAATCACCATAAAGCAATGATTTATTGATTAATCAAAGAGCATTA

381 TAAACAATTAAA rGTTATTTCATAACCATCAAAAAAAAAAA

Рис. 8: Нуклеотидная последовательность мРНК мезоглеина и его теоретическая аминокислотная последовательность. Домен DSL отмечен пунктирным подчеркиванием. Домен ZP отмечен подчеркиванием. Предполагаемые сайты расщепления протеазой фурин (furin) отмечены рамкой. Пептиды, полученные методом белкового секвениро-вания по Эдману, отмечены жирным курсивом. Сайт сигнала полиаденелирования отмечен серым и рамкой. Стоп кодон обозначен звездочкой. Возможные сайты N-гликозилирования и О-гликозилирования отмечены серым.

7.5 ОТПЦР мРНК мезоглеина.

В результате анализа экспрессии мезоглеина в эпидерме, гастродерме и мезоглее методом ОТПЦР (рис. 9) было показано, что ПЦР продукт ожидаемого размера наблюдается только в реакциях с РНК из мезоглеи.

II

E M G Е М G

Шя щщ «м*

L 1 2 3 4 5 6

Рис. 9: Электрофорез в 1%-ном агарозном геле продуктов ОТПЦР, полученных с РНК из клеток эпидермы(Е), мезоглеи(М) и гастродермы(С) двух особей Aurelia aurita, с праймерами комплиментарными мРНК мезоглеина.

8 ОБСУЖДЕНИЕ.

Такие как у A. aurita, Мк, многочисленные и белок синтезирующие, отсутствуют у многих других кишечнополостных. Поэтому существование Мк воспринимается как биологический курьез - частный случай выселения экто- или эндодермальных клеток в ВКМ. Однако, взгляды на происхождение трехслойных животных, изложенные в разделе "Литературный обзор", заставляют воспринимать Мк как возможное свидетельство в пользу одной из гипотез о происхождении мезодермы.

Недостаточная изученность Мк не позволяет однозначно сказать, являются ли они отдельной клеточной популяцией с определенной функцией.

Для того чтобы уточнить представления о функциях и происхождении Мк, мы попытались получить сиквенсы генов специфически экспрессирующихся в этих клетках с помощью метода дифференциального дисплея, однако попытка была не удачной. После этого мы применили другой подход - сравнили спектры белков эпидермы, га-стродермы, мезоглеи и Мк с помощью диск электрофореза, и для дальнейшего анализа выбрали один из мажорных белков специфичный для мезоглеи. Белковое секве-нирование по Эдману пептидов, полученных из этого белка трипсинолизом, дало 4 аминокислотных последовательности. На основании одной из этих последовательностей изготовлены вырожденные праймеры которые использовали для клонирования мРНК белка.

Отсутствие 5' нетранслируемого района в последовательности мРНК и отсутствие метионина на N-конце гипотетической последовательности белка указывает на то, что полученная нуклеотидная последовательность является частичной последовательностью мРНК мезоглеина. То, что масса мезоглеина, определенная с помощью диск-электрофореза, близка к массе, рассчитанной по гипотетической аминокислотной последовательности, позволяет предположить, что клонированная последовательность лишь ненамного короче полной последовательности мРНК мезоглеина.

В результате поиска известных доменов в гипотетической аминокислотной последовательности мезоглеина были обнаружены домены Delta/Serrate/Lag-2 (DSL) и Zona Pelucida (ZP), а также 3 сайта узнавания протеазы фурин (furin), 2 возможных сайта N-гликозилирования и 1 возможный сайт 0-гликозилирования. Расположение доменов и сайтов показано на рис. 8.

Домен Zona Pelucida (ZP) встречается в большом количестве различных экстраклеточных белков. В настоящее время известно около 680 белков, содержащих этот домен. Функции ZP-содержащих белков разнообразны - от структурных компонентов в оболочке яйца или в "слизистых домиках"аппендикулярий до компонентов, передающих механическую нагрузку (mechanotransducers) в крыле дрозофилы, или рецепторов у млекопитающих и других позвоночных (Jovine et al., 2005).

ZP-содержащие белки могут подвергаться посттрансляционному расщеплению фурино-подобными эндопептидазами (furin-like endopeptidases), как это было показано для белков млекопитающих ZP2 и ZP3 (Litscher et al., 1999). Мезоглеин содержит три возможных сайта узнавания протеазы фурин (рис. 8): первый RRRR - перед доменом DSL (позиции 4-7 аа), второй RDSR - между DSL и ZP доменами (позиции 86-89 аа), третий RKER - ниже домена ZP (позиции 370-373 аа).

У многих ZP-содержащих белков есть трансмембранный домен, или GPI-anchor, прикрепляющий эти белки к клеточной мембране. Такие белки экскретируются после того, как фурин-подобная протеаза разрезает белок между ZP-доменом и местом крепления белка к клеточной мембране. У мезоглеина не обнаружено ни трансмембранного домена, ни GPI-anchor. Известны другие ZP-содержащие белки, не имеющие трансмембранного домена и GPI-anchor, например белки семейства oikosins (Jovine et al., 2005).

Домен DSL встречается в экстраклеточных белках или в экстраклеточной части мембранных и трансмембранных белков. Этот домен необходим для активации рецепторов - членов семейства Lin-12/Notch. Домен DSL может служить связующим звеном при олигомеризации DSL-содержащих белков, в результате которой образуется активный лиганд, взаимодействующий с экстраклеточной частью Lin-12/Notch белков (Fitzgerald, Greenwald, 1995; Yuan et al., 2001).

Белки семейства Lin-12/Notch являются трансмембранными белками, пересекающими клеточного мембрану один раз. Они участвуют в различных процессах, определяющих направление дифференцировки клеток у беспозвоночных и позвоночных (Kiyota, Kinoshita 2002).

Кроме мезоглеина существуют другие белки, содержащие ZP и DSL домены, например Strongylocentrotus purpuratus predicted protein UniProt Accession No. UPI0000583FF7 similar to Neurogenic locus Notch protein precursor.

Теоретическая кривая титрования, построенная на основании аминокислотной последовательности, имеет изоэлектрическую точку 9.03, что подтверждает предположение о положительном заряде мезоглеина. Сильный позитивный заряд не характерен для ZP-содержащих белков. Только 12.5% белков этого семейства имеют теоретическую изоэлектрическую точку выше pi 8. Средняя теоретическая изоэлектрическая точка ZP-содержащих белков pi 6.3 а средняя изоэлектрическая точка ZP доменов pi 6.2.

На основании того, что изоэлектрическая точка мезоглеина сдвинута в щелочную область, можно сделать вывод, что при нейтральном рН мезоглеин заряжен положительно. Положительный заряд белка должен способствовать его хорошей растворимости, однако в ходе экспериментов по экстракции мезоглеина из мезоглеи, было показано что белок хорошо экстрагируется только при кислом рН. Эти данные позволяют предположить, что мезоглеин прочно связан с ВКМ.

Есть расхождение между результатами окраски антителами и ОТПЦР. При окраске антителами к мезоглеину иммуноблотов диск-электрофореза мезоглеи, Мк, эпидермы и гастродермы, кроме зоны соответствующей мезоглеину, окрашиваются также зоны 80 кДа и 120 кДа на дорожках, соответствующих Мк и эпидерме. Возможно, мезоглеин синтезируется в виде белка- предшественника, который подвергается посттрансляционному расщеплению. При окраске срезов медузы антитела к мезоглеину окрашивают Мк, волокна в ВКМ мезоглеи и клетки эпидермы. Возможно, в клетках эпидермы есть мезоглеин, но экспрессия его гена у взрослых медуз в клетках эпидермы шла на более ранних стадиях онтогенеза. Аминокислотная последовательность мезоглеина составляет около 416 аа из них больше половины занимает домен ZP (246 аа), поэтому одно из объяснений расхождения результатов состоит в том, что, возможно, антитела узнают домен ZP других ZP содержащих белков в клетках эпидермы. Результаты ОТПЦР представляются достовернее окраски антителами, т.к. праймеры обеспечивают большую специфичность, чем поликлональные антитела. Таким образом, мезоглеин дифференциально экспрессируется в Мк взрослых медуз.

На основании полученных данных можно предположить, что мезоглеин является структурным элементом ВКМ мезоглеи.

Поскольку показано, что ZP-содержащие белки могут выполнять роль элементов, передающих механическую нагрузку (Jovine et al., 2005), можно предположить, что мезоглеин модифицирует механические свойства ВКМ мезоглеи, делая ее более прочной. Это подтверждается субъективным наблюдением, что тело медуз, достигших максимальных размеров, более жесткое, чем у молодых медуз.

Наличие в мезоглеине домена DSL позволяет предположить, что мезоглеин может направлять дифференцировку какого-то типа клеток. Возможно DSL мезоглеина является сигналом для клеток, выселившихся из эпителия в мезоглею, направляющим их дифференцировку в Мк.

На основании данных о том, что у взрослых медуз мезоглеин экспрессируется исключительно в Мк и эти клетки содержат крупные гранулы окрашиваемые антителами к мезоглеину, можно предположить, что Мк являются специализированной группой клеток, обогащающей ВКМ мезоглеином.

9 ВЫВОДЫ

1. Нуклеотидная последовательность мРНК мезоглеина - мажорного белка мезоглеи A. aurita с молекулярной массой около 45/47 кДа составляет 1421 нуклеотидных пар.

2. Мезоглеин содержит ZP и DSL домены, а также предполагаемые сайты протеазы фурин, что характерно для экстраклеточных белков.

3. Мезоглеин дифференциально экспрессируется в мезоглеальных клетках и экскретируется во внеклеточный матрикс мезоглеи.

10 СПИСОК ЛИТЕРАТУРЫ

Албертс В., Брей Д., Льюис Дж., Рэфф М., Роберте К., Уотсон Дж. 1994. Молекулярная биология клетки, 2 изд. (1994; англ изд. 1989), Мир, Москва,3,с.34б,348.

Догель В.А. 1937. Тип кишечнополостных (Coelenterata)// Руководство по зоологии. M.JL, 1.1. С.268-369.

Догель В.А. 1981. Зоология беспозвоночных. М.: Высшая школа. 606с.

Заварзин А.А. 1945. Очерки эволюционной гистологии крови и соединительной ткани. Медгиз. Москва.

Иванов А.В., Полянский Ю.И., Стрелков А.А. 1981. Большой практикум по зоологии беспозвоночных. Издание 3-е в трех томах. М. Высшая школа.

Мечников И.И. 1947. Лекции о сравнительной патологии воспаления. М.: Медгиз, 200 с.

Напара Т.О. 1995. Исследование клеток и вещества мезоглеи на разныч стадиях клеточного цикла Aurelia aurita (Cnidaria, Scyphozoa) //Кандидатская диссертация.

Наумов Д.В. 1961. Сцифоидные медузы морей СССР. М. Л.: Акад.наук СССР. 98 с.

Оскольский А.А. 1985. Гистологическое изучение мезоглеи некоторых кишечнополостных. Дипломная работа. ЛГУ. с. 104.

Стикланд Ю.Е. 1999. Получение зондов и их мечение. В кн Молекулярная клиническая диагностика. Методы. Ред. Херрингтон С. и Макги Дж. М. Мир,320-371

Чага О.Ю, Беме К, Напара Т.О. 1996. Пролиферативная активность и рост популяции клеток мезоглеи у сцифоидной медузы Aurelia aurita. 2. Мезоглеальные клетки сцифистом. Цитология. 38(1): с.22-27

Чан В.Т.-В. 1999. Гибридизация нуклеиновых кислот. В кн Молекулярная клиническая диагностика. Методы. Ред. Херрингтон С. и Макги Дж. М. Мир, 375-394

Яп Э, Мартинес-Монтеро Х-К,Макги Дж. 1999. Выявление мРНК в клинических препаратах с помощью неизотопной гибридизации in situ. В кн Молекулярная клиническая диагностика.Методы. Ред. Херрингтон С. и Макги Дж. М. Мир, 223-242.

Achermann , J. 1980. The fate and regeneration capacity of isolated ecto- and endoderm in polyps of Podocoryne carnea M. Sars (Hydrozoa, Athecata). In: Developmental and Cellular Biology of Coelenterates (ed. P. and R. Tardent), Elsevier Biomedical Press, p. 273-279.

Adams E. 1978. Invertebrate collagens. Science. 202: 591-8.

Agassiz , L. 1860. Contributions to the Natural History of the United States of America. Boston. Truber and Co. Vol. 3. ALLMAN, G. (1853). On the Anatomy and Physiology of Cordylophora. Phil. Trans. London.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402.

Amerongen , H.M. and PETEYA, D.J. 1980. Ultrastructural study of two kinds of muscle in sea anemones. The existence of fast and slow muscles. J. Morph. 166:145-154.

Ball, E.E., Hayward, D.C., Saint, R. and Miller, D.J. 2004. A simple plan - Cnidarians and the origin of developmental mechanisms. Nat. Rev. Genet. 5: 567-577.

Boero , F., Gravili, C., Pagliari, P., Piraino , S., Bouillon, F. and Schmid, V. 1998. The cnidarian premises of metazoan evolution: from triploblasty, to coelom formation, to metamery. Ital. J. Zool. 65: 5-6.

Boelsterli U. 1977. An electron microscopic study of early developmental stages, myogenesis, oogenesis and cnidogenesis in the anthomedusa, Podocoryne carnea M. Sars. J Morphol. 154(2):259-89.

Bouillon, J. 1993. Classe des hydrozoaires. In Grasse, P.-P. (Ed.), Traite de Zoologie. Cnidaires, Ctenaires, Vol. Ill, Fascicule 2. Masson, Paris, p. 29-416.

Bouillon J, Coppois G. 1977. Etude comparative de la mesoglee des cnidaires. Cahiers Biol. Marine 13: 339-368.

Bouillon, J., Castiaux, P. and Vandermeerssche, G. 1958. Musculature de la Med use Limnocnida Tanganyicae (Hydromeduse). Extrait du Bulletin de Microscopie appliquee (2) t. 8, n 4, aout, p. 81-87.

Braverman, M. 1974. The cellular basis for colony form in Podocoryne carnea. Am. Zool. 14: 673-698.

Bynum M.A., Black R.E. 1974. Ultrastructure of mesoglea in strobilae of Chrysaora quinquencirrha (Scyphozoa) // J. Exp. Zool. V. 187, N 3. P. 323-334.

Calgren 0. 1949. A survey of the Ptychodactiaria, Corallomorpharia and Actinaria. K.V.A. Handl. 1:1-121.

Chapman, D.M. 1966. Evolution of the scyphistoma. Symp. Zool. Soc. Lond. 16: 51-75.

Chapman, D.M. 1968. A new type of muscle cell from the subumbrella of Obelia. J. Mar. Biol. Assoc. UK. 48: 667-688.

Chapman D.M. 1974. Cnidarian histology. Coelenterate biology. Reviews and new perspectives. Eds. Muskatine L., Lenhoff H, Acad. Press. NY - SF -London, pp. 1-93.

Chapman, D.M. 1999. Microanatomy of the bell rim of Aurelia aurita (Cnidaria: Scyphozoa). Can. J. Zool. 77: 34-46.

Chapman, D.M., Pantin, C.F.A. and Robson, E.A. 1962. Muscle in Coelenterates. Rev. Canad. Biol. 21: 267-278.

Chapman G. 1959. The mesoglea of Pelagia noctiluca. Q J Microsc Sci. 100: 599-610.

Chapman G. 1966. The structure and function of the mesoglea. Cnidaria and their evolution, ed. Rees. Symp. Soc. London. V.16. P. 147-168.

Chia F.S., Amerongen H.M. and Peteya D. 1984. Ultrastructure of the neuromuscular system of the polyp of Aurelia aurita L.1758 (Cnidaria, Scyphozoa). J. Morph. 180: 69-79.

Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162(1): 156-159.

Collins A.C., Schuchert P., Marques A.C., Jankowsky Т., Medina M., Schierwater B. 2006. Medusozoan phylogeny and character evolution clarified by new large and small subunit rDNA data and an assessment of the utility of phylogenetic mixture models. Syst. Biol. 55: 97-115.

Denton EJ. 1963. The buoyancy mechanism of sea creatures. Endeavour 22: 85-87.

Don RH, PT Cox, BJ Wainwright, К Baker, and JS Mattick. 1991. Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19: 4008.

Doumenc, A.D. 1976. Etudes ultrastructurale des stades parenchymula, actinella et edwardsia de l'Actinie Cereus pedunculatus Pennant. Arch. Zool. Exp. Gen. 117: 2985 ff.

Doumenc, A.D. 1977. Etudes dynamique de la morphogenese au cours des phases actinella et edwardsia de l'actinie Cereus pedunculatus Pennant. Arch. Zool. Exp. Gen. 118: 79-102.

Doumenc, A.D. 1979. Structure et origine des systemes squelettiques et neuromusculaires au cours de 1'organogeneses des stades postlarvaires de l'actinie Cereus pedunculaturs. Arch. Zool. Exp. Gen. 120: 431-476.

Eisenhaber В., Bork P., Yuan Y., Loeffler G., Eisenhaber F. 2000. Automated annotation of GPI anchor sites: case study C.elegans. TIBS 25(7): 340-341.

Fitzgerald K., Greenwald I. 1995. Interchangeability of Caenorhabditis elegans DSL proteins and intrinsic signalling activity of their extracellular domains in vivo. Development 121:4275-4282.

Franc, A. 1993. Classe des Scyphozoaires. In Grasse, P.-P. (Ed.), Traite de Zoologie. Cnidaires, Ctenaires, Vol. Ill, Fascicule 2. Masson, Paris, p. 597-884.

Franc S, Franc JM, Garrone R. 1984. Fine structure and cellular origin of collagenous matrices in primitive animals: Porifera, Cnidaria and Ctenophora. Front Matrix Biol; 3:143-56.

Frank U, Rinkevich B. 1999. Sciphozoan jellyfish's mesoglea supports attachment, spreading and migration of anthozoans' cells in vitro. Cell Biol. Intern. 23(4): 307-311.

Galliot В., Schmid V. 2002. Cnidarians as a Model System for Understanding Evolution and Regeneration. Int. J. Dev. Biol. 46: 39-48.

Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins M.R., Appel R.D., Bairoch A. 2005. Protein Identification and Analysis Tools on the ExPASy Server. (In) ed. John M. Walker: The Proteomics Protocols Handbook, Humana Press.

Goette, A. 1887. Entwicklungsgeschichte der Aurelia aurita und Cotylorhiza tuberculata. Leipzig.

Goette, A. 1907. Vergleichende Entwicklungsgeschichte der Geschlechtsindividuen der Hydroidpolypen. Z. wiss. Zool. 87: 1- 331.

Govindarajan, A.F., Boero, F. and Halanych, K.M. 2006. Phylogenetic analysis with multiple markers indicates repeated loss of the adult medusa stage in Campanulariidae (Hydrozoa, Cnidaria). Mol. Phyl. Evol. 38: 820-834.

Groeger, H. and Schmid, V. 2001. Larval development in Cnidaria: a connection to Bilateria. Genesis 29:110-114.

Haeckel, E. 1874. Die Gastrea-Theorie, die phylogentische Klassification des Tierreichs und die Homologie der Keimblatter. Jena Z. Naturw. 8:1-55.

Hamann, 0. 1882. Der Organismus der Hydroidpolypen. Jena. Z. Naturw. 15:1- 72.

Har-el R, Tanzer ML. 1993. Extracellular matrix. 3: Evolution of the extracellular matrix in invertebrates. FASEB J. 7(12):1115-23.

Hargitt, C.W. and Hargitt, G.T. 1910. Studies on the development of Sycphomedusae. J. Morph. 21: 217-262.

Hausman RE, Burnett AL. 1971. The mesoglea of Hydra. IV. A qualitative radioautographic study of the protein component. J Exp Zool. 177:435-46.

Hausman R. 1973. The mesoglea. Biology of Hydra. Eds. Burnett A. London: Acad. Press N.-Y., P.393-453.

Hein, W. 1900. Untersuchungen uber die Entwicklung von Aurelia aurita. Z. Wiss. Zool. 67:1-40.

Hertwig, O. and Hertwig, R. 1878. Der Organismus der Medusen und seine Stellung zur Keimblattertheorie. Jena.

Hertwig, O. and Hertwig, R. 1880. Der Organismus der Medusen und seine Stellung zur Keimblattertheorie. Leipzig.

Hujer, A. and Lesh-Laurie, G.E. 1995. Effect of mono-and divalent cations on polyp morphogenesis in isolated tentacles of Aurelia aurita (Scyphozoa). Dev. Gen. Evol. 205:122-127.

Hyman, L.H. 1940. The invertebrates: Protozoa through Ctenophora (Vol. I). McGraw-Hill, New York. 726 p.

Hyman, L.H. 1951. The invertebrates: Platyhelminthes and Rhyncocoela

Vol. II). McGraw-Hill Book Co, New York.

Jovine L., Costel C. Darie, Eveline S. Litscher, and Paul M. Wassarman. 2005. Zona pellucida domain proteins. Annu. Rev. Biochem. 74: 83-114.

Julenius K., Molgaard A., Gupta R., Brunak S. 2005. Prediction, conservation analysis and structural characterization of mammalian mucin-type O-glycosylation sites. Glycobiology, 15:153-164.

Kalendar R. 2006. FastPCR, PCR primer design, DNA and protein tools, repeats and own database searches program. www.biocenter.helsinki.fi/bi/programs/fastpcr.htm

Kiyota T, Kinoshita T. 2002. Cysteine-rich region of X-Serrate-1 is required for activation of Notch signaling in Xenopus primary neurogenesis. Int J Dev Biol. 46(8): 1057-1060.

Kleinman HK, Philp D, Hoffman MP. 2003. Role of the extracellular matrix in morphogenesis. Curr Opin Biotechnol 14: 526-532.

Knight D. P. 1971. Sclerotization of the Calyptoblastic hydroid Laomedea flexuosa. 2. Histochemical demonstration of phenol oxidase and attempted demonstration of peroxidase. Tiss. and Cell. 3(1): 57-64.

Korschelt, K. and Heider, K. 1890. Lehrbuch der vergleichenden Entwicklungs-geschichte der wirbellosen Tiere. Jena. Gustav Fischer.

Kovalevsky, A. et Marion, A.F. 1883. Documents pour l'histoire embryogenetique des Alcyonaires. Ann. Mus. Hist. Nat. Marseille. Vol. 1. Pt. 2.

Krasinska, S.V. 1914. Beitrage zur Histologie der Medusen. Inaugural-Dissertation, Universitat Zurich, Wilhelm Engelmann, Leipzig und Berlin.

Laemmli U.K. 1970. Cleavage of structural protein during the essambly of the head of the bacteriophage T4. Nature 4: 680-682.

Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. 2006. SMART

5: domains in the context of genomes and networks. Nucleic Acids Res. 34(Database issue): D257-260.

Liang P., Pardee A.B. 1992. Differential display of eukaryotic messenger RNA by means of polymerase chain reaction. Science. 257: 967-971.

Litscher E.S., Qi H., Wassarman P.M. 1999. Mouse zona pellucida glycoproteins mZP2 and mZP3 undergo carboxy-terminal proteolytic processing in growing oocytes. Biochemistry. 38:12280-12287.

Mackay NC. 1969. Sulphate regulation in jellyfish. Сотр. Biochem. Physiol. 30: 481-488.

Marchler-Bauer A, Bryant SH. 2004. CD-Search: protein domain annotations on the fly. Nucleic Acids Res. 32: 327-331

Martindale, M.Q., Pang, K., Finnerty, J.R. 2004. Investigating the origins of triploblasty: "mesodermal"gene expression in a diploblastic animal, the sea anemone Nematostella vectensis (phylum, Cnidaria, class Anthozoa). Development 131: 2463-2475.

Matz M., Shagin D., Bogdanova E., Britanova O., Lukyanov S., Diatchenko L., Chenchik A. 1999. Amplification of cDNA ends based on template-switching effect and step-out PCR. Nucleic Acids Res. 27(6): 1558-1560.

Miura S, Kimura S. 1985. Jellyfish mesoglea collagen. Characterization of molecules as ala2a3 heterotrimers. J Biol Chem. 260:15352e6.

Mueller, P., Seipel, K., Yanze, N., Reber-Mueller, S., Streitwolfengel, R., Stierwald, M., Spring, J., Schmid, V. 2003. Evolutionary aspects of developmentally regulated helix-loop-helix transcription factors in jellyfish. Dev. Biol. 255: 216-229.

Napara TO, Oskol sky AA, Chaga OY. 1994. Mesogleal cells of Aurelia aurita (Cnidaria, Scyphozoa). I. Morphology of mesogleal cells and of the matrix of mesoglea. Tsitologiia. 36:623-30.

Napara TO, Chaga OY. 1992a. Proliferative activity and growth of the mesogleal cell population in scyphomedusae Aurelia aurita (L.). I. Mesogleal cells of young and mature medusae. Tsitologiia. 34(6):59-66.

Napara TO, Chaga OY. 1992b. Proliferative activity and growth of the mesogleal cell population in scyphomedusae Aurelia aurita (L.). II. Mesogleal cells of strobilae and ephyrae. Tsitologiia. 34(8):33-7.

Napara TO, Oskol sky AA, Chaga OY. 1996a. Mesogleal cells of Aurelia aurita (Cnidaria, Scyphozoa). II. Ultrastructural and histochemical analysis. Tsitologiia. 38:456-64.

Napara TO, Oskolsky AA, Shaposhnikova TG, Chaga OY. 1996b. Mesogleal cells of Aurelia aurita (Cnidaria, Scyphozoa). III. An autoradiographic analysis of the synthesis of extracellular matrix of mesoglea. Tsitologiia. 38: 465-74.

Pantin, C.F.A. 1960. Diploblast animals. Proc. Linn. Soc. Lond. 171:1-14.

Panyim S., Chalkley R. 1969. The heterogeneity of histones. I. A quantitative analysis of calf histones in very long polyacrylamide gels. Biochemistry, 8:3972-3979.

Pappin DJ, Hojrup P, Bleasby AJ. 1993. Rapid identification of proteins by peptide-mass fingerprinting. Curr Biol 3: 327-332.

Podgornaya O.I., Shaposhikova T.G. 1998. Antibodies with the cell-type specificity to the morula cells from haemolymph of ascidian Styela rustica, Cell Structure and Function, 23: 349-355.

Reber-Muller S, Spissinger T, Schuchert P, Spring J, Schmid V. 1995. An extracellular matrix protein of jellyfish homologous to mammalian fibrillins forms different fibrils depending on the life stage of animal. Dev Biol. 169: 66272.

Reisinger, E. 1957. Zur Entwicklungsgeschichte und Entwicklungsmechanik von Craspedacusta (Hydrozoa, Limnotrachylina). Z. Morph. Oekol. Tiere 45: 656-698.

Rice P., Longden I., Bleasby A. 2000. EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics, 16: 276-277.

Rieger, R. and Ladurner, P. 2001. Searching for the stem species of Bilateria. Belg. J. Zool. 131: 27-34.

Rose TM, Henikoff JG, Henikoff S. 2003. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design. Nucleic Acids Res. 31(13): 3763-3766.

Sambrook J., Fritsch E. F., Maniatis T. 1989. Molecular Cloning. A laboratory Manual (2nd Edition). New York: Cold Spring Harbor Laboratory.

Sarras Jr MP, Deutzmann R. 2001. Hydra and Niccolo Paganini (1782-1840) e two peas in a pod? The molecular basis of extracellular matrix structure in the invertebrate, Hydra. Bioessays. 23:716-24.

Sarras Jr MP, Madden ME, Zhang X, Gunwar S, Huff JK, Hudson BG. 1991. Extracellular matrix (mesoglea) of Hydra vulgaris. I. Isolation and characterization. Dev Biol. 148:481-94.

Sarras Jr MP, Zhang X, Huff JK, Accavitti MA, St John PL, Abrahamson DR. 1993. Extracellular matrix (mesoglea) of Hydra vulgaris. III. Formation and function during morphogenesis of hydra cell aggregates. Dev Biol. 157:38398.

Schmid V, Bally A, Beck K, Haller M, Schlage WK, Weber C. 1991. The extracellular matrix (mesoglea) of hydrozoan jellyfish and its ability to support cell adhesion and spreading. Hydrobiologia. 216/217: 3-10.

Schmid V, Baader C, Bucciarelli A, Reber-Muller S. 1993. Mechanochemical interactions between striated muscle cells of jellyfish and grafted extracellular matrix can induce and inhibit DNA replication and transdifferentiation in vitro.

Dev Biol. 155:483-96.

Schmid V, Ono S, Reber-Muller S. 1999. Cell-substrate interactions in cnidaria. Microscopy Research And Technique. 44(4): 254-268.

Schmid V, 1992. Transdifferentiation in medusae. Int Rev Cytol 142: 213261.

Schuchert, P., Reber-Mueller, S. and Schmid, V. 1993. Life stage specific expression of a myosin heavy chain in the hydrozoan Podocoryne carnea. Diff. 54:11-18.

Schulze, F.E. 1873. Ueber den Bau von Syncoryne sarsi und der zugehorigen Meduse Sarsia tubulosa.

Seipel, K. and Schmid, V. 2005. Evolution of striated muscle: jellyfish and the origin of triploblasty. Dev. Biol. 282:14-26.

Seipel, K., Yanze, N. and Schmid, V. 2004. Developmental and evolutionary aspects of the basic helix-loop-helix transcription factors Atonal-like 1 and Acheate-scute homolog 2 in jellyfish. Dev. Biol. 269: 331-345.

Shaposhnikova T, Matveev I, Napara T, Podgornaya O. 2005. Mesogleal cells of the jellyfish Aurelia aurita are involved in the formation of mesogleal fibres. Cell Biol Int. 29(11): 952-958.

Singer J. 1974. Electron microscopic and autoradiographic study of mesogleal organization and collagen synthesis in sea anemone Aiplasia diaphana. Cell. Tiss. Ress. 149: 537-554.

Smith, F. 1881. The gastrulation of Aurelia flavidula, Per. & Les. Bull. Mus. Сотр. Zool. Harvard Col. 22:115-136.

Spring, J., Yanze, N., Joesch, C., Middel, A.M., Winninger, B. and Schmid, V. 2002. Conservation of Brachyury, Mef2 and Snail in the myogenic lineage of jellyfish: a connection to the mesoderm of Bilateria. Dev. Biol. 244: 372-384.

Spring, J., Yanze, N., Middel, A.M., Stierwald, M., Groeger, H. and Schmid,

V. 2000. Ancestral role of the mesoderm specification factor twist in the life cycle of jellyfish. Dev. Biol. 228: 363-375.

Stidwill RP, Christen M. 1998. Alteration of fibronectin affinity during differentiation modulates the in vitro migration velocities of Hydra nematocytes. Cell Motil Cytoskeleton. 41(l):68-73.

Storch, V. and Welsch, U. 1974. Epithelialmuscular cells in Lingula unguis (Brachyopoda) and Branchiostoma lanceolatum (Acrania). Cell Tiss. Res. 154: 543-545.

Tardent, P. 1978. Coelenterata, Cnidaria. In Seidel, F. (Ed), Morphogenese der Tiere. Gustav Fischer Verlag, Jena, p. 83-289.

Technau, U., Scholz, C.B. 2003. Origin and evolution of endoderm and mesoderm. Int. J. Dev. Biol. 47: 531-539.

Tillet E, Franc JM, Franc S, Garrone R. 1996. The evolution of fibrillar collagens: a sea-pen collagen shares common features with vertebrate type V collagen. Comp Biochem Physiol В Biochem Mol Biol. 113(2):239-46.

Tixier-Durivault, A. 1987. Sous-classe des Octocorallaires. In Grasse, P.P. (Ed.), Traite de Zoologie. Cnidaires, Anthozoaires, Vol. Ill, Fas. 3. Masson, Paris, p. 3-188.

Van DE Vyver, G. 1993. Reproduction sexuee-embryologie. In Grasse, P.-P. (Ed.), Traite de Zoologie. Cnidaires, Ctenaires, Vol. Ill, Fas. 2. Masson, Paris, p. 417-471.

Van Praet, M., Doumenc, D. 1987. Ordre des Antipathaires. In Grasse, P.P. (Ed.), Traite de Zoologie. Cnidaires, Anthozoaires, Vol. Ill, Fas. 3. Masson, Paris, p. 189-256.

Weber C, Schmid V, 1985. The fibrous system in the extracellular matrix of hydromedusae. Tissue and Cell 17: 811-822.

Weissmann, A. 1880. Zur Frage nach dem Ursprung der Geschlechtszellen bei den Hydroiden. Ueber den Ursprung der Gechlechtszellen bei den Hydroiden. Zool. Anzeiger.

Werner, B. 1967. Morphologie, Systematik und Lebendsgeschichte von Stephanoscyphus (Scyphozoa, Coronata) sowie seiner Bedeutung fur die Evolution der Sycphozoa. Zool. Anz. 30: 297-319.

Werner B. 1984. Stamm Cnidaria, Neseltiere. Lehrbuch der Speziellen Zoologic. Jena. G. Verlag Fischer. Bd 1. T. 2. S.ll-305.

Widersten, B. 1966. On the development of septal muscles, supporting fibrils and periderm in the scyphistoma of semaeostome Sycphozoa. Arkiv Zool. 18: 567-575.

Wietrzykowski, W. 1912. Recherche sur le development des Lucernaires. Arch. Zool. Experimentale et generale. 5ieme serie, X, 1-95, pi. I a III.

Wolpert, L. 1998. Principles of Development. Oxford University Press, Current Biology LTD, London.

Young J. A. 1974. The nature of tissue regeneration after wounding in the sea anemona Calliactis parasitica (Couch). Mar. biol. Ass. U. K. 54(3): 559-617.

Yuan Z.R., Okaniwa M., Nagata I., Tazawa Y., Ito M., Kawarazaki H., Inomata Y., Okano S., Yoshida Т., Kobayashi N., Kohsaka T. 2001. The DSL domain in mutant JAG1 ligand is essential for the severity of the liver defect in Alagille syndrome. Clin. Genet. 59: 330-337.

Похожие диссертационные работы по специальности «Гистология, цитология, клеточная биология», 03.00.25 шифр ВАК

Заключение диссертации по теме «Гистология, цитология, клеточная биология», Матвеев, Иван Владимирович

1. Нуклеотидная последовательность мРНК мезоглеина - мажорного белка мезо глеи А. aurita с молекулярной массой около 45/47 кДа составляет 1421 нуклеотидных

2. Мезоглеин содержит ZP и DSL домены, а также предполагаемые сайты протеазы

фурин, что характерно для экстраклеточных белков. 3. Мезоглеин дифференциально экспрессируется в мезоглеальных клетках и

экскретируется во внеклеточный матрикс мезоглеи.

Список литературы диссертационного исследования кандидат биологических наук Матвеев, Иван Владимирович, 2007 год

1. Молекулярная биология клетки, 2 изд. (1994; англ изд. 1989), Мир, Москва,3,с.34б,

2. Догель В.А. 1937. Тип кишечнополостных (Coelenterata)// Руководство по зоологии. М.Л., 1.1. 268-

4. Зоология беспозвоночных. М.: Высшая школа. 606с. Заварзин А.А. 1

5. Очерки эволюционной гистологии крови и соединительной ткани. Медгиз. Москва. Иванов А.В., Полянский Ю.И., Стрелков А.А. 1

6. Вольшой практикум по зоологии беспозвоночных. Издание 3-е в трех томах. М.. Высшая школа. Мечников И.И. 1

7. Лекции о сравнительной патологии воспаления. М.: Медгиз, 200 с. Напара Т.О. на разныч 1

8. Исследование клеток и веш,ества клеточного цикла Aurelia aurita мезоглеи (Cnidaria, стадиях 8сурЬогоа)//Кандидатская диссертация. Наумов Д.В. 1

9. Сцифоидные медузы морей СССР. М. Л.: Акад.наук СССР. 98 с. Оскольский А.А. 1

10. Гистологическое изучение мезоглеи некоторых кишечнонолостных. Дипломная работа. ЛГУ. с.

12. Получение зондов и их мечение. В кн Молекулярная клиническая диагностика. Методы. Ред. Херрингтон и Макги Дж. М. Мир,320-371 Чага О.Ю, Веме К, Папара Т.О. 1

13. Пролиферативная активность и рост популяции клеток мезоглеи у сцифоидной медузы Aurelia aurita.

14. Мезоглеальные клетки сцифистом. Цитология. 38(1): с.22-27 61

15. Гибридизация нуклеиновых кислот. В кн Молекулярная клиническая диагностика. Методы, Ред. Херрингтоп и Макги Дж. М. Мир, 375-394 Яп Э, Мартинес-Монтеро Х-К,Макги Дж. 1

16. Выявление мРНК в клинических препаратах с помощью неизотопной гибридизации in situ. В кн Молекулярная клиническая диагностика.Методы. Ред. Херрингтон и Макги Дж. М. Мир, 223-

17. Achermann J, 1980. The fate and regeneration capacity of isolated ecto- and endoderm in polyps of Podocoryne carnea M. Sars (Hydrozoa, Athecata). In: Developmental and Cellular Biology of Coelenterates (ed. P. and R. Tardent), Elsevier Biomedical Press, p. 273-

18. Invertebrate collagens. Science. 202: 591-

19. Contributions to the Natural History of the United States of America. Boston. Truber and Co. Vol. 3. ALLMAN, G. (1853). On the Anatomy and Physiology of Cordylophora. Phil. Trans. London. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1

20. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3

22. Ultrastructural study of two kinds of muscle in sea anemones. The existence of fast and slow muscles. J. Morph. 166:145-

23. Ball, E.E., Hayward, D.C., Saint, R. and Miller, D.J. 2004. A simple plan Cnidarians and the origin of developmental mechanisms. Nat. Rev. Genet. 5: 567-

24. Boero F., Gravili, C, Pagliari, P., Piraino S., Bouillon, F. and Schmid, V. 1998. The cnidarian premises of metazoan evolution: from triploblasty, to coelom formation, to metamery. Ital. J. Zool. 65: 5-6. 62

26. Classe des hydrozoaires. In Grasse, P.-P. (Ed.), Traite de Zoologie. Cnidaires, Ctenaires, Vol. Ill, Fascicule

29. Etude comparative de la mesoglee des cnidaires. Cahiers Biol. Marine 13: 339-

30. Bouillon, J., Castiaux, P. and Vandermeerssche, G. 1

31. Musculature de la Meduse Limnocnida Tanganyicae (Hydromeduse). Extrait du Bulletin de Microscopie appliquee (2) t. 8, n 4, aout, p. 81-

32. Braverman, M. 1974. The cellular basis for colony form in Podocoryne carnea. Am. Zool. 14: 673-

34. Ultrastructure of mesoglea in strobilae of Chrysaora quinquencirrha (Scyphozoa) J. Exp. Zool. V. 187, N 3. P. 323-

35. Calgren 0. 1949. A survey of the Ptychodactiaria, Corallomorpharia and Actinaria.K.V.A. Handl. 1:1-

37. Evolution of the scyphistoma. Symp. Zool. Soc. Lond. 16: 51-

38. Chapman, D.M. 1968. A new type of muscle cell from the subumbrella of Obelia. J. Mar. Biol. Assoc. UK. 48: 667-

40. Cnidarian histology. Coelenterate biology. Reviews and new perspectives. Eds. Muskatine L., Lenhoff H. Acad. Press. NY SF London, pp. 1-

42. Microanatomy of the bell rim of Aurelia aurita (Cnidaria: Scyphozoa). Can. J. Zool. 77: 34-

43. Chapman, D.M., Pantin, C.F.A. and Robson, E.A. 1

44. Muscle in Coelenterates. Rev. Canad. Biol. 21: 267-278. 63

45. Chapman G. 1966. The structure and function of the mesoglea. Cnidaria and their evolution, ed. Rees. Symp. Soc. London. V.16. P. 147-

46. Chia F.S., Amerongen H.M. and Peteya D. 1

47. Ultrastructure of the neuromuscular system of the polyp of Aurelia aurita L.1758 (Cnidaria, Scyphozoa). J. Morph. 180: 69-

49. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162(1): 156-

50. Collins A.C., Schuchert P., Marques A.C., Jankowsky Т., Medina M., Schierwater B. 2

51. Medusozoan phylogeny and character evolution clarified by new large and small subunit rDNA data and an assessment of the utility of phylogenetic mixture models. Syst. Biol. 55: 97-

52. Denton EJ. 1963. The buoyancy mechanism of sea creatures. Endeavour 22: 85-87. Don RH, PT Cox, BJ Wainwright, К Baker, and JS Mattick. 1

53. Touchdown PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19: 4

55. Etudes ultrastructurale des stades parenchymula, actinella et edwardsia de lActinie Cereus pedunculatus Pennant. Arch. Zool. Exp. Gen. 117: 2985 ff. Doumenc, A.D. 1

56. Etudes dynamique de la morphogenese au cours des phases actinella et edwardsia de Iactinie Cereus pedunculatus Pennant. Arch. Zool. Exp. Gen. 118: 79-

58. Structure et origine des systemes squelettiques et neuromusculaires au cours de lorganogeneses des stades postlarvaires de 64

59. Eisenhaber В., Bork P., Yuan Y., Loeffler G., Eisenhaber F. 2

60. Automated annotation of GPI anchor sites: case study C.elegans. TIBS 25(7): 340-

62. Interchangeability of Caenorhabditis elegans DSL proteins and intrinsic signalling activity of their extracellular domains in vivo. Development 121:4275-4

63. Classe des Scyphozoaires. In Grasse, P.-P. (Ed.), Traite de Zoologie. Cnidaires, Ctenaires, Vol. Ill, Fascicule

66. Fine structure and cellular origin of collagenous matrices in primitive animals: Porifera, Cnidaria and Ctenophora. Front Matrix Biol; 3:143-

68. Sciphozoan jellyfishs mesoglea supports attachment, spreading and migration of anthozoans cells in vitro. Cell Biol. Intern. 23(4): 307-

70. Cnidarians as a Model System Understanding Evolution and Regeneration. Int. J. Dev. Biol. 46: 39-

71. Gasteiger E., Hoogland C, Gattiker A., Duvaud S., Wilkins M.R., Appel R.D., Bairoch A. 2

72. Protein Identification and Analysis Tools on the ExPASy Server. (In) ed. John M. Walker: The Proteomics Protocols Handbook, Humana Press. Goette, A. 1

73. Entwicklungsgeschichteder Aurelia auritaund Cotylorhiza tuberculata. Leipzig. Goette, A. 1

74. Vergleichende Entwicklungsgeschichte der for Geschlechtsindividuen der Hydroidpolypen. Z. wiss. Zool. 87: 1-

75. Govindarajan, A.F., Boero, F. and Halanych, K.M. 2

76. Phylogenetic analysis with multiple markers indicates repeated loss of the adult medusa stage 65

78. Larval development in Cnidaria: a connection to Bilateria. Genesis 29:110-

79. Haeckel, E. 1874. Die Gastrea-Theorie, die phylogentische Klassification des Tierreichs und die Homologie der Keimblatter. Jena Z. Naturw. 8:1-

80. Hamann, 0. 1882. Der Organismus der Hydroidpolypen. Jena. Z. Naturw. 15:1- 72. Har-el R, Tanzer ML. 1

81. Extracellular matrix. 3: Evolution of the extracellular matrix in invertebrates. FASEB J. 7(12):1115-

83. Studies on the development of Sycphomedusae. J. Morph. 21: 217-

84. Hausman RE, Burnett AL. 1971. The mesoglea of Hydra. IV. A qualitative radioautographic study of the protein component. J Exp Zool. 177:435-

85. Hausman R. 1973. The mesoglea. Biology of Hydra. Eds. Burnett A. London: Acad. Press N.-Y., P.393-

86. Untersuchungen uber die Entwicklung von Aurelia aurita. Z. Wiss. Zool. 67:1-

87. Hertwig, 0 and Hertwig, R. 1878. Der Organismus der Medusen und seine Stellung zur Keimblattertheorie. Jena. Hertwig, 0. and Hertwig, R. 1880. Der Organismus der Medusen und seine Stellung zur Keimblattertheorie. Leipzig. Hujer, A. and Lesh-Laurie, G.E. 1

88. Effect of mono-and divalent cations on polyp morphogenesis in isolated tentacles oi Aurelia aurita (Scyphozoa). Dev. Gen. Evol. 205:122-

89. Hyman, L.H. 1940. The invertebrates: Protozoa through Ctenophora (Vol. I). McGraw-Hill, New York. 726 p. Hyman, L.H. 1951. The invertebrates: Platyhelminthes and Rhyncocoela 66

90. Zona pellucida domain proteins. Annu. Rev. Biochem. 74: 83-

91. Julenius K., Molgaard A., Gupta R., Brunak S. 2

92. Prediction, conservation analysis and structural characterization of mammalian mucin-type 0-glycosylation sites. Glycobiology, 15:153-

94. FastPCR, and PCR primer design, DNA repeats own database searches program. www.biocenter.helsinki.fi/bi/programs/fastpcr.htm Kiyota T, Kinoshita T. 2

95. Cysteine-rich region of X-Serrate-1 is required for activation of Notch signaling in Xenopus primary neurogenesis. Int J Dev Biol. 46(8): 1057-1

97. Role of the extracellular matrix in morphogenesis. Curr Opin Biotechnol 14: 526-

99. Sclerotization of the Calyptoblastic hydroid Laomedea flexuosa.

100. Histochemical demonstration of phenol oxidase and attempted demonstration of peroxidase. Tiss. and Cell. 3(1): 57-

102. Lehrbuch der vergleichenden Entwicklungs-geschichte der wirbellosen Tiere. Jena. Gustav Fischer. Kovalevsky, A. et Marion, A.F. 1

103. Documents pour lhistoire embryogenetique des Alcyonaires. Ann. Mus. Hist. Nat. Marseille. Vol. 1. Pt.

105. Beitrage zur Histologie der Medusen. InauguralDissertation, Universitat Zurich, Wilhelm Engelmann, Leipzig und Berlin. Laemmh U.K. 1

106. Cleavage of structural protein during the essambly of the head of the bacteriophage T

108. Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. 2006. SMART 67

110. Differential display of eukaryotic messenger RNA by means of polymerase chain reaction. Science. 257: 967-

111. Litscher E.S., Qi H., Wassarman P.M. 1

112. Mouse zona pellucida glycoproteins mZP2 and mZP3 undergo carboxy-terminal proteolytic processing in growing oocytes. Biochemistry. 38:12280-12

114. Sulphate regulation in jellyfish. Сотр. Biochem. Physiol. 30: 481-

115. Marchler-Bauer A, Bryant SH. 2004. CD-Search: protein domain annotations on the fly. Nucleic Acids Res. 32: 327-331 Martindale, M.Q., Pang, K., Finnerty, J.R. 2

116. Investigating the origins of triploblasty: "mesodermal"gene expression in a diploblastic animal, the sea anemone Nematostella vectensis (phylum, Cnidaria, class Anthozoa). Development 131: 2463-2

117. Matz M., Shagin D., Bogdanova E., Britanova 0., Lukyanov S., Diatchenko L., Chenchik A. 1

118. Amplification of cDNA ends based on template-switching effect and step-out PCR. Nucleic Acids Res. 27(6): 1558-1

120. Jellyfish mesoglea collagen. Characterization of molecules as ala2a3 heterotrimers. J Biol Chem. 260:15352e

121. Mueller, P., Seipel, K., Yanze, N., Reber-Mueller, S., Streitwolfengel, R., Stierwald, M., Spring, J., Schmid, V. 2

122. Evolutionary aspects of developmentally regulated helix-loop-helix transcription factors in jellyfish. Dev. Biol. 255: 216-

123. Napara TO, Oskol sky AA, Chaga OY. 1

124. Mesogleal cells of Aurelia aurita (Cnidaria, Scyphozoa). I. Morphology of mesogleal cells and of the matrix of mesoglea. Tsitologiia. 36:623-30. 68

125. Napara TO, Chaga OY. 1992b. Proliferative activity and growth of the mesogleal cell population in scyphomedusae Aurelia aurita (L.). II. Mesogleal cells of strobilae and ephyrae. Tsitologiia. 34(8):33-

126. Napara TO, Oskol sky AA, Chaga OY. 1996a. Mesogleal cells of Aurelia aurita (Cnidaria, Scyphozoa). II. Ultrastructural and histochemical analysis. Tsitologiia. 38:456-

127. Napara TO, Oskolsky AA, Shaposhnikova TG, Chaga OY. 1996b. Mesogleal cells of Aurelia aurita (Cnidaria, Scyphozoa). III. An autoradiographic analysis of the synthesis of extracellular matrix of mesoglea. Tsitologiia. 38: 465-

129. Diploblast animals. Proc. Linn. Soc. Lond. 171:1-

130. Panyim S., Chalkley R. 1969. The heterogeneity of histones. I. A quantitative analysis of calf histones in very long polyacrylamide gels. Biochemistry, 8:3972-3

132. Rapid identification of proteins by peptide-mass fingerprinting. Curr Biol 3: 327-

133. Podgornaya O.I., Shaposhikova T.G. 1

134. Antibodies with the cell-type specificity to the morula cells from haemolymph of ascidian Styela rustica, Cell Structure and Function, 23: 349-

135. Reber-MuUer S, Spissinger T, Schuchert P, Spring J, Schmid V. 1995. An extracellular matrix protein of jellyfish homologous to mammalian fibrillins forms different fibrils depending on the life stage of animal. Dev Biol. 169: 66

136. Reisinger, E. 1957. Zur Entwicklungsgeschichte und Entwicklungsmechanik 69

137. Rice P., Longden I., Bleasby A. 2000. EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics, 16: 276-

139. Searching for the stem species of Bilateria. Belg. J. Zool. 131: 27-

140. Rose TM, Henikoff JG, Henikoff S. 2003. GODEHOP (COnsensusDEgenerate Hybrid Oligonucleotide Primer) PGR primer design. Nucleic Acids Res. 31(13): 3763-3

141. Sambrook J., Fritsch E. F., Maniatis T. 1

142. Molecular Gloning. A laboratory Manual (2nd Edition). New York: Gold Spring Harbor Laboratory. Sarras Jr MP, Deutzmann R. 2

143. Hydra and Niccolo Paganini (1782-1840) e two peas in a pod? The molecular basis of extracellular matrix structure in the invertebrate, Hydra. Bioessays. 23:716-

144. Sarras Jr MP, Madden ME, Zhang X, Gunwar S, Huff JK, Hudson BG. 1

145. Extracellular matrix (mesoglea) of Hydra vulgaris. I. Isolation and characterization. Dev Biol. 148:481-

146. Sarras Jr MP, Zhang X, Huff JK, Accavitti MA, St John PL, Abrahamson DR. 1

147. Extracellular matrix (mesoglea) of Hydra vulgaris. III. Formation and function during morphogenesis of hydra cell aggregates. Dev Biol. 157:38

148. Schmid V, Bally A, Beck K, Haller M, Schlage WK, Weber G. 1991. The extracellular matrix (mesoglea) of hydrozoan jellyfish and its ability to support cell adhesion and spreading. Hydrobiologia. 216/217: 3-

149. Schmid V, Baader G, BucciareUi A, Reber-Muller S. 1

150. Mechanochemical interactions between striated muscle cells of jellyfish and grafted extracellular matrix can induce and inhibit DNA replication and transdifferentiation in vitro. 70

152. Cell-substrate interactions in cnidaria. Microscopy Research And Technique. 44(4): 254-

153. Transdifferentiation in medusae. Int Rev Cytol 142: 213

154. Schuchert, P., Reber-Mueller, S. and Schmid, V. 1

155. Life stage specific expression of a myosin heavy chain in the hydrozoan Podocoryne carnea. Diff. 54:11-

157. Ueber den Bau von Syncoryne sarsi und der zugehorigen Meduse Sarsia tubulosa. Seipel, K. and Schmid, V. 2

158. Evolution of striated muscle: jellyfish and the origin of triploblasty. Dev. Biol. 282:14-

159. Seipel, K., Yanze, N. and Schmid, V. 2

160. Developmental and evolutionary aspects of the basic helix-loop-helix transcription factors Atonal-like 1 and Acheate-scute homolog 2 in jellyfish. Dev. Biol. 269: 331-

161. Shaposhnikova T, Matveev I, Napara T, Podgornaya O. 2

162. Mesogleal cells of the jellyfish Aurelia aurita are involved in the formation of mesogleal fibres. Cell Biol Int. 29(11): 952-

163. Electron microscopic and autoradiographic study of mesogleal organization and collagen synthesis in sea anemone Aiplasia diaphana. Cell. Tiss. Ress. 149: 537-

164. Smith, F. 1881. The gastrulation of Aureliaflavidula,Per. Les. Bull. Mus. Сотр. Zool. Harvard Col. 22:115-

165. Spring, J., Yanze, N., Joesch, C, Middel, A.M., Winninger, B. and Schmid, V. 2

166. Conservation of Brachyury, Mef2 and Snail in the myogenic lineage of jellyfish: a connection to the mesoderm of Bilateria. Dev. Biol. 244: 372-

167. Spring, J., Yanze, N., Middel, A.M., Stierwald, M., Groeger, H. and Schmid, 71

168. Ancestral role of the mesoderm specification factor twist in the life cycle of jellyfish. Dev. Biol. 228: 363-

170. Alteration of fibronectin affinity during differentiation modulates the in vitro migration velocities of Hydra nematocytes. Cell Motil Cytoskeleton. 41(l):68-

172. Epithelialmuscular cells in Lingula unguis (Brachyopoda) and Branchiostoma lanceolatum (Acrania). Cell Tiss. Res. 154: 543-

174. Coelenterata, Cnidaria. In Seidel, F. (Ed), Morphogenese der Tiere. Gustav Fischer Verlag, Jena, p. 83-

176. Origin and evolution of endoderm and mesoderm. Int. J. Dev. Biol. 47: 531-

177. Tillet E, Franc JM, Franc S, Garrone R. 1996. The evolution of fibrillar collagens: a sea-pen collagen shares common features with vertebrate type V collagen. Comp Biochem Physiol В Biochem Mol Biol. 113(2):239-

179. Sous-classe des Octocorallaires. In Grasse, P.P. (Ed.), Traite de Zoologie. Cnidaires, Anthozoaires, Vol. Ill, Fas.

180. Masson, Paris, p. 3-188. Van DE Vyver, G. 1

181. Reproduction sexuee-embryologie. In Grasse, P.-P. (Ed.), Traite de Zoologie. Cnidaires, Ctenaires, Vol. Ill, Fas.

182. Masson, Paris, p. 417-471. Van Praet, M., Doumenc, D. 1

183. Ordre des Antipathaires. In Grasse, P.P. (Ed.), Traite de Zoologie. Cnidaires, Anthozoaires, Vol. Ill, Fas.

185. Weber C, Schmid V, 1985. The fibrous system in the extracellular matrix of hydromedusae. Tissue and Cell 17: 811-

186. Weissmann, A. 1880. Zur Frage nach dem Ursprung der Geschlechtszellen 72

187. Morphologie, Systematik und Lebendsgeschichte von Stephanoscyphus (Scyphozoa, Coronata) sowie seiner Bedeutung fur die Evolution der Sycphozoa. Zool. Anz. 30: 297-

188. Stamm Cnidaria, Neseltiere. Lehrbuch der Speziellen Zoologic. Jena. G. Verlag Fischer. Bd 1. T. 2. S.11-

189. Widersten, B. 1966. On the development of septal muscles, supporting fibrils and periderm in the scyphistoma of semaeostome Sycphozoa. Arkiv Zool. 18: 567-

191. Recherche sur le development des Lucernaires. Arch. Zool. Experimental et generale. 5ieme serie, X, 1-95, pi. I a III. Wolpert, L. 1

192. Principles of Development. Oxford University Press, Current Biology LTD, London. Young J. A. 1974. The nature of tissue regeneration after wounding in the sea anemona Calliactis parasitica (Couch). Mar. biol. Ass. U. K. 54(3): 559-

193. Yuan Z.R., Okaniwa M., Nagata L, Tazawa Y., Ito M., Kawarazaki H., Inomata Y., Okano S., Yoshida Т., Kobayashi N., Kohsaka T. 2001. The DSL domain in mutant JAGl ligand is essential for the severity of the liver defect in Alagille syndrome. Clin. Genet. 59: 330-337. 73

Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания. В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.