Экспрессия ParaHox-генов в онтогенезе полихеты Nereis virens (Annelida, Polychaeta) тема диссертации и автореферата по ВАК РФ 03.00.30, кандидат биологических наук Кулакова, Милана Анатольевна

  • Кулакова, Милана Анатольевна
  • кандидат биологических науккандидат биологических наук
  • 2008, Санкт-ПетербургСанкт-Петербург
  • Специальность ВАК РФ03.00.30
  • Количество страниц 152
Кулакова, Милана Анатольевна. Экспрессия ParaHox-генов в онтогенезе полихеты Nereis virens (Annelida, Polychaeta): дис. кандидат биологических наук: 03.00.30 - Биология развития, эмбриология. Санкт-Петербург. 2008. 152 с.

Оглавление диссертации кандидат биологических наук Кулакова, Милана Анатольевна

Введение.

Обзор литературы.

1. История вопроса.

2. Гены, содержащие гомеобокс и их структурная эволюция.

2.1. Структура гомеобокса и гомеодомена.

2.2. Классификация суперсемейства гомеобоксных генов.

2.3. Кластерные гены ANTP-класса.

2.3.1. №кластер.

2.3.2. Яох-кластер.

2.3.3. РагаНох-кластер.

2.3.4. EHGbox-кластер.

2.4. Взгляды на молекулярную филогению кластеров класса ANTP.

3. Функциональная значимость кластерных генов ANTP-класса для эволюции Bilateria.

3.1. Гены NK-кластера и их функции.

3.2. Гены Нох-кластера и их функции.

3.2.1. Нох-гены вторичноротых (Deuterostomia).

3.2.2. Т/ох-гены первичноротых (Protostomia).

3.2.2.1. Яох-гены Ecdysozoa.

3.2.2.2. Лох-гены Lophotrochozoa.

3.3. Гены Т'агаЯох-кластера и их функции.

3.3.1. РагаНох-гены вторичноротых (Deuterostomia).

3.3.1.1. Иглокожие.

3.3.1.2. Хордовые.

3.3.2. РагаНох-гены первичноротых (Protostomia).

3.3.2.1. ParaHox-тепы Ecdysozoa.

3.3.2.2. ParaHox-тены Lophotrochozoa.

3.3.2.2.1. Моллюски.

3.3.2.2.2. Кольчатые черви.

4. Основные этапы онтогенеза нереидных полихет.

4.1. Дробление.

4.2. Гаструляция.

4.3. Органогенез.

4.4. Постларвальный рост.

Материалы и методы.

1. Поиск и клонирование фрагментов РагаНох-генов.

2. Характеристики рекомбинантной плазмиды T-Easy Vector.

3. Анализ экспрессии Мч'-РагаЯат-генов.

3.1. Принцип метода гибридизации in situ с применением РНК-зонда.

3.2. Подготовка матрицы для синтеза РНК-зонда.

3.3. Синтез DIG-меченого РНК-зонда.

3.4. Сбор личинок и ювенильных червей.

3.5. Фиксация материала.

3.6. Гибридизация in situ на тотальных препаратах (WMISH).

4. Гистологическая окраска для анализа морфологии объекта.

5. Рабочие растворы и реагенты.

Результаты.

1. Характеристики некоторых этапов онтогенеза Nereis virens.

1.1. Гаструляция.

1.2. Органогенез.

1.3. Постларвальный рост.

2. Экспрессия Nvi-РагаНох-геноъ.

2.1. Осевая экспрессия Nvi-РагаНох-тенов.

2.1.1. Экспрессия Nvi-РагаНох-генов в формирующихся ганглиях вентрального нервного ствола.

2.1.2. Экспрессия Nvi-ParaHox-генов в пищеварительном тракте.

2.2. Экспрессия Nvi-РагаНох-геяов, не связанная с аксиальной спецификацией.

2.2.1. Экспрессия Nvi-Gsh.

2.2.1.1. Экспрессия в простомиуме.

2.2.1.2. Экспрессия в дефинитивной кишке.

2.2.2. Экспрессия Nvi-Xlox.

2.2.3. ЭкспрессияNvi-Cad.

2.2.3.1. Ранняя фаза ларвальной экспрессии.

2.2.3.2. Промежуточная фаза ларвальной экспрессии.

2.2.3.3. Поздняя фаза ларвальной экспрессии.

2.2.3.4. Постларвальная экспрессия.

Обсуждение результатов.

1. Осевая экспрессия Nvi-ParaHox-генов.

1.1. Аспекты временной экспрессии Nvi-РагаНох-геиоъ.

1.2. Пространственная колинеарность экспрессии Nvi-РагаНох-геяов.

1.2.1. Экспрессия Nvi-РагаНох-геяов в нейроэктодерме.

1.2.2. Экспрессия Nvi-ParaIiox-генов в пищеварительном тракте.

2. Экспрессия Nvi-ParaHox-rsnoB, не связанная с осевой спецификацией.

2.1. Экспрессия РагаНох-теяов в головном мозге.

2.2. Эмбриональная фаза экспрессии Nvi-Cad.

2.3. Экспрессия Nvi-Cad в зоне роста.

3. Различия в ларвальной и постларвальной экспрессии Nvi-РагаНох-теяов.

Рекомендованный список диссертаций по специальности «Биология развития, эмбриология», 03.00.30 шифр ВАК

Введение диссертации (часть автореферата) на тему «Экспрессия ParaHox-генов в онтогенезе полихеты Nereis virens (Annelida, Polychaeta)»

Одной из центральных проблем биологии вообще, и биологии развития в частности, является проблема становления морфологии во всей ее сложности и многообразии, как на уровне отдельного организма, так и на филогенетическом уровне. Современный взгляд на эволюцию, как на процесс, приведший к возникновению морфологического разнообразия жизни, невозможен без понимания ее молекулярного фундамента.

Структурно и функционально консервативные гены, стоящие на вершинах регуляторных каскадов программ развития, в последние два десятилетия стали объектом пристального внимания для исследователей, чьи интересы находятся в сфере молекулярных основ эволюции, генетики и эмбриологии (Акаш. 1995; Carroll. 2001; Davidson, 2001). Регуляторные гены, координирующие развитие Metazoa, принадлежат к ограниченному числу очень древних, консервативных семейств. Их возникновение, эволюция и апцестральные функции заслуживают самого пристального внимания. Такие гены, как Pax, Нох, ParaHox, En. Dll и многие другие регуляторные гены из иных семейств, обладают эволюционно «законсервированной» структурой и функцией, но именно они координируют события, сопутствующие ароморфозам и идиоадаптациям.

Согласно «новой (молекулярной) филогении» (de Rosa, R. eí al. 1999), всех билатеральных животных можно объединить в три филогенетические категории: Denterostomia (хордовые, полухордовые, иглокожие), Ecdysozoa (членистоногие, нематоды, киноринхи, приапулиды и пр.) и Lophotrochozoa (аннелиды, плоские черви, моллюски, сипункулиды, брахиоподы, мшанкп и форониды). Так сложилось, что главными модельными объектами молекулярной биологии оказались представители первых двух эволюционных ветвей — такие например, как мышь, шпорцевая лягушка (Deuterostomia) и дрозофила (Ecdysozoa^). Именно на этих организмах впервые были показаны основные закономерности развития и выявлены ключевые гены регуляторных каскадов. Животные третьей эволюционной ветви (Lophotrochozoa) в основной своей массе морские беспозвоночные. Их исследование затруднено, поскольку содержание и репродукция морского организма в лабораторных условиях - уже сама по себе нетривиальная задача. Те немногие из Lophotrochozoa, что доступны исследователям (пиявки, дождевые черви, наземные и пресноводные моллюски) утратили личиночное развитие и сильно видоизменили многие морфогенетические программы.

Между тем, морские Lophotrochozoa - это колоссальная по уровню морфологического разнообразия группа животных. Без исследования ее типичных, а еще лучше архаичных, наиболее приближенных к анцестральному для Bilateria предку, форм, мы не получим адекватного представления о молекулярных механизмах эволюции.

В основу данной работы положена идея о консерватизме структуры и функции регуляторных генов РагаНох-кластера. РагаНох-кластер традиционно рассматривается, как ¡¡аналогичный, т.е. сестринский по отношению к Яо.т-кластеру комплекс, представленный тремя генами: Gsh/Gsx, Xlox/Pdx и Cad/Cdx, расположенными на хромосоме от 3' к 5' концу, соответственно. Предполагается, что гены ParaHox-кластера такие же универсальные пространственные спецификаторы, как и Яох-гены. Они осуществляют осевой паттернинг на своем уровне, отчасти перекрываясь с Лох-генами и пространственно, и функционально.

Экспрессия РагаНох-тъноъ у Lophotrochozoa на сегодняшний день почти не исследована. Присутствие всех трех генов этой группы показано для моллюсков (Barucca et al., 2006), сипункулид (Ferrier, Holland, 2001), олигохет (Park et al. 2006) и полихет (Frobius, Seaver. 2006). Очень не многое пока известно о функции Нох/РагаНох-тенов в репаративных морфогенезах у беспозвоночных. По-прежнему остается загадкой роль, которую играют Нох/РагаНох-комппексы в личиночном развитии Lophotrochozoa. Не прослежена динамика их экспрессии по ходу метаморфоза классической, для этой эволюционной группы, сферической ресничной личинки - трохофоры. Для того чтобы решить эти задачи наилучшим образом, важно не ошибиться в выборе объекта. Эррантная, гомономно-сегментированная полихета Nereis virens, в отличие от уже исследованных представителей Annelida, таких как пиявки и сидячая полихета Chaetopterus - менее специализирована. Кроме того, наличие в онтогенезе Nereis virens трохофоры значительно увеличивает ценность этого объекта для изысканий в сфере молекулярных основ эволюции. Nereis virens — сезонный объект, размножающийся раз в году, но, не смотря на этот недостаток, количество получаемых эмбрионов и личинок от одной самки этого вида позволяет проводить на генетически-однородном, синхронном материале, самые разнообразные исследования.

Для того чтобы оценить, какие из функций консервативного регуляторного гена можно назвать исходными, проще всего ретроспективно оценить его паттерны у представителей всех трех ветвей Bilateria. В этом случае, мы сможем сказать, что в его функциях является общим, и, следовательно, древним, а что - частным новоприобретением или коопцией (Arenas-Mena et al. 2000).

Цель и задачи исследования. Основная цель представленной работы - как можно более полно охарактеризовать экспрессию генов РагаНох-кластера у полихеты Nereis virens, чтобы дать сравнительную характеристику общим и частным закономерностям экспрессии этих регуляторов у типичного представителя ветви Lophotrochozoa Эти данные позволят говорить об особенностях Рага/7ох-экспрессии на уровне большой таксономической категории - Eumetazoa и помогут лучше представить гипотетического предка всех Bilateria.

Были поставлены следующие задачи:

1. Выявить паттерны экспрессии РагаНох-генов на разных стадиях ларвального и постларвального онтогенеза Nereis virens.

2. Провести сравнительный анализ особенностей ларвальной и постларвальной экспрессии.

3. Исследовать характер экспрессии РагаНох-тенов, на предмет возможной осевой упорядоченности.

Обзор литературы

1. История вопроса

Идея о том, что для понимания морфологической эволюции необходимо идентифицировать гены, которые управляют морфогенезами, выглядит вполне очевидной. Анализ изменений в этих генах в ходе эволюции животных, позволяет приблизится к пониманию причин морфологических нововведений. Полагается, что морфологическую эволюцию, большею частью, определяют модификации в структуре и функции генов, контролирующих развитие. Первые гены, контролирующие развитие, были обнаружены в лаборатории Томаса Моргана (Bridges, Morgan, 1923, пит. по Papageorgiou, 2007) обнаружены еще в первой четверти XX века. , однако, после того, как в 1932 году Томас Хант Морган опубликовал свое знаменитое обращение "Восход генетики", эволюцию долго рассматривали, как изменение аллельного состава популяции. И конечно, макроэволюционные изменения (появление крыльев у насекомых, конечностей у тетрапод, совершенство и многообразие оптических систем и многое другое) этим не объяснялись. В начале 80-х годов, Гулд (Gould, 1972) постулировал механизмы, способные дать гомологичные структуры и, в то же время обеспечить быстрые морфологические изменения: гетерохрония (изменение относительного времени событий развития) и аллометрия (дифференциальный рост частей) (цит. по Гилберт и др., 1997). Ко времени, когда Гулд говорил о гомологии морфологической, становилась очевидна гомология молекулярная - были открыты первые генные семейства с выраженной гомологией у разных групп организмов. Фитч (1970г.) вводит в молекулярную биологию два понятия, заимствованных из зоологии: a) Серийная гомология (или паралогичность), - явление гомологии последовательностей в пределах одного индивида (например множественные последовательности ^/-семейства, глобиновые гены, гены иммуноглобулинов, паралогические группы 7/ох-генов) b) Специфическая гомология (или ортологичность), - межвидовая гомология последовательностей (вышеуказанные примеры генных семейств у разных видов).

Согласно гипотезе Бриттена и Коэна (Britten, Kohen, 1968; циг. по Гилберг и др., 1997), тандемные семейства идентичных последовательностей ДНК возникают в результате «скачкообразной репликации» неповторяющейся "архетипической" последовательности. Затем эти дуплицированные копии могут подвергаться независимым мутациям» и отбору. В 1940-х гг. такие гены были обнаружены. Понятие морфологической и молекулярной гомологии увязались между собой самым удивительным образом. Удача улыбнулась Уоддингтону и Гольдшмидту которые идентифицировали у насекомых мутации, при которых сегмент одного типа трансформировался в сегмент другого типа. У некоторых из описанных мутантов части антенны были заменены гомологичными частями ноги, например, кончик антенны был заменен коготком. У других мутантов вся антенна была заменена ногой. Некоторые мутанты вместо гальтер (жужжальца мухи на третьем грудном сегменте) имели крылья, приобретая, таким образом, сходство с более примитивными четырехкрылыми насекомыми. Мутации такого рода были описаны еще в позапрошлом веке, а сам термин «гомеозис» (от греческого homoiösis -уподобление, подобие) введен Уильямом Бэтсоном (William Beatson) в 1894 году: «Превращение антенны насекомого в ногу, глаза ракообразного - в антенну, лепестка - в тычинку и тому подобное - все это примеры одного рода. Поэтому я предлагаю термин «гомеозис», поскольку главное здесь не в том, что произошло некое изменение, а в том, что одно, изменившись, приобрело сходство с чем-то другим» (цит. по Рэфф, Кофмеп, 1986). Уоддингтон и Гольдшмидт полагали, что такие «гомеозисные мутанты» - ключ к пониманию отношений между генетикой, эмбриологией и эволюцией (цит. по Гилберт и др., 1997).

Поиск, клонирование и секвенирование последовательностей, ответственных за гомеозисные трансформации, осуществлялся независимо, тремя группами ученых в Калифорнии, Индиане и Базеле (Bender et al., 1983; Garber et al., 1983; Scott et al., 1983 - цит. по Papageorgiou, 2007). Работы производились на дрозофиле. Оказалось, что все эти гены - серийно гомологичны и кодируют транскрипционные факторы с очень характерным консервативным ДНК-связывающим доменом, который договорились называть гомеодоменом, а кодирующий его нуклеотидный фрагмент из 180 пар оснований - назвали гомеобоксом. Сами гомеозисные, гомеобокс-содержащие гены фигурируют в литературе под аббревиатурой - //ох-гсны (от homeotic и homeobox). Оказалось, что они собраны у дрозофилы в кластер, или генный комплекс, то есть, линейно сцеплены. Кроме того, выяснилось, что экспрессируются они упорядоченно вдоль передне-задней оси и в согласии со своим положением на хромосоме, то есть первый ген (на 3 ' конце ДНК) экспрессируется в передней части эмбриона, а последний (на 5' конце ДНК) в задней его части. Поскольку #ах-гены включены в установление сегментной специфичности вдоль основной оси тела, можно было предположить, что именно они, а вернее изменения

-9в их структурных или регуляторных частях, приводят к наблюдаемым различиям в морфологии членистоногих. По сути, с этого момента, в руках у исследователей оказался инструмент, которым «управляется» морфологическая эволюция.

Льюис (Lewis, 1978) выдвинул первую молекулярную модель морфологической эволюции у насекомых. Согласно его гипотезе, эволюция плана тела у насекомых - целиком зависит от появления новых Лох-генов. Эти новые Нох-гены возникали путем дупликации, а затем дивергировали, что и приводило к появлению новых сегментных структур. К тому, чтобы сделать такое предположение были палеонтологические, эмбриологические и зоологические предпосылки. Тем не менее, Льюис оказался не прав, потому что вскоре аналогичный набор Яох-генов нашли у позвоночных (Fibi et al. 1988; Ranginib et al., 1989; Godsave et al. 1994; Burke et al. 1995; lloegg, Meyer, 2005), причем мутации этих генов тоже приводили к пространственным сдвигам в структурах, лежащих вдоль оси тела.

Вскоре выясиилось, что уровень специфической гомологии у Нох-последовательностей так высок, что в некоторых случаях можно было компенсировать мутантный фенотип дрозофилы гомологичной последовательностью мыши или человека (Awgulewitsch, Jacobs, 1992; Malieki et al., 1992). Стало очевидным, что /fax-гены появились очень давно, во всяком случае, еще до разделения Bilateria на первично- и вторичноротых, которое произошло примерно 600 млн. лет назад. Диверсификация сегментов не могла определяться появлением новых Яох-генов.

Открытие этих и многих других эволюционно-консервативных генных семейств, имеющих стереотипный паттерн экспрессии, породило целый ряд новых вопросов. Одна из таких загадок получила название - «//аг-парадокс» (Wray, 2002). Суть парадокса в том, что несравнимая по уровню морфологического разнообразия совокупность билатеральных животных, использует один и тот же набор регуляторов для построения принципиально разных тел. Разрешить этот пародокс возможно, если предположить, что основная вариабельная «часть» программ развития приходится на гены, находящиеся в регуляторной иерархии выше («upstream») и ниже («down-stream») по отношению к Нох-кластеру.

Антонио Гарсиа-Беллидо (Antonio Garcia-ßellido. 1975) выдвинул идею о том, что Лох-гены - селекторы (переключатели), которые делают выбор между альтернативными состояниями детерминации на уровне метамера. Универсальность и удивительная консервативность Яох-генов становится вполне объяснимой, если предположить, что эти регуляторные гены работают, как устойчивые бинарные переключатели. Такие гены могут быть только «включены» или только «выключены» в каждом конкретном метамере, потому что любые другие варианты приводят к гомеозисным трансформациям, которые у высокодифференцированных членистоногих несовместимы с жизнью. Если это так, то эволюция касалась только Лох-подчиненных генов, то есть генов-ннтерпретаторов Нох-кода. Великолепные экспериментальные работы Шона Кэрролла (Sean В. Carroll), вышедшие во второй половине 90-х, наглядно показывают селекторную функцию Лох-генов и их эволюционную роль в диверсификации планов тела у артропод. В частности, Кэроллу удалось доказательно продемонстрировать то, каким образом шла эволюция придатков тела у насекомых (Carroll et al., 1995; Carroll et al., 2001 ; Galant. Can-oil, 2002; Carroll, 2005).

Работы Томаса Кофмана (Thomas С. Kaufman), и Майкла Эйкема (Michael Akam), прекрасно иллюстрируют богатство и одновременно универсальность механизмов морфологической эволюции (Akam et al. 1994; Akam, 1995: Abzhanov, Kaufman, 2000a; Hughes, Kaufman, 2002a; Hughes, Kaufman, 2002b). В последние годы вышли работы, в которых строгая метамерная селекторность Лох-генов не подтвердилась (Akam. 1998a,b; Akam. 2000). Эти гены способны к значительно более пластичной регуляции, и являются бинарными переключателями, скорее, на уровне отдельных клеточных клонов, а не метамеров в целом. Важно, что при удивительном консерватизме кодирующей части (хотя, и здесь есть интересные примеры модификаций), основным инструментом морфологической эволюции является тонкая игра на уровне сложно организованных, модульных регуляторных зон самих Лох-генов и их мишеней, во всех плоскостях регуляторной иерархии. Это наглядно подтверждено в исследованиях Дэвида Стерна (David L. Stern) (Stern, 2003), который изучал тонкие аспекты экспрессионной активности одного из Лох-генов у нескольких видов рода Drosophila и показал, что некоторые морфологические различия между этими видами - напрямую связаны с незначительными вариациями в активности данного гена, а это, в свою очередь, обусловлено дивергенцией его регуляторных сайтов.

Важное обобщение, проистекающее из консерватизма структуры и функции Лох-генов, сделал Слэк (Slack et al., 1993). Он ввел понятие «зоотипа» и «филотипической» стадии, которую проходят в своем развитии все билатеральные животные и которая характеризуется пространственно-колинеарной экспрессией Лох-генов. Такое принципиальное сходство легко объяснить общностью происхождения современных билатеральных животных от единого предка, который тоже использовал Яох-гены для регионализации тела вдоль передне-задней оси. Анализ аминокислотной последовательности гомеодоменов и фланкирующих гомеодомен участков, у животных из разных эволюционных ветвей, сильно изменили устоявшуюся филогению билатеральных животных (de Rosa el al. 1999). Оказалось, что эволюционное древо билатеральных животных делится у основания на два больших ствола (рис. 1): BTopH4HopoTbie=Deuterostomia (хордовые, полухордовые, иглокожие) и riepBH4HOpoTbie=Protostomia, которые, в свою очередь, подразделяются на Lophotrochozoa (брахиоподы, немертины, аннелиды, моллюски, плоские черви и др.) и Ecdysozoa (артроподы, онихофоры, нематоды, приапулиды и др.) (de Rosa et al. 1999). Сами термины - Ecdysozoa и Lophotrochozoa, не нашли пока синонимов в русском языке. Термин Ecdysozoa - происходит от греческого слова «ecdysis» - линька, поскольку все представители ветви Ecdysozoa животные линяющие, покрытые жёсткой кутикулой. Их рост сопровождается периодическими линьками, когда старые покровы сбрасываются, и животное быстро растёт, или, скорее, «расправляется» пока новые покровы не отвердели.

Fruit fly Onychophorari Н Nematode ^jgh Priapulid ■ о а®

4Bt

Pc*~ Рсл- Раь Peo- Pe*

ЧГ й ES m ® ¡£i

1М-Й pattSJ из ra

Poivchaete

Nrf- IY» ™ N* Nn- Nñ-Btxl odasшna □ b

Ш7 LorG Lixt20 LoxS Lot2 Loxi r"j ra □ □ ra

Lt

LMíal Lgtart I.HW Ho,7 Hax£ UHaD

- NemerteanTP □ П Ш □ □

Фг m pntu Ut atxxG a OtvtC Oí OftmC OttxxF г i 3 toiB ÍWÍ ЬахЛ Рта S (ш£ fj»7 ftxHfjí Ь

Я— Fia (worms Щ Ш СО аШИШ Э

Pw~ лLF. ftО- ft«- f\u

Sastead ТГ Ж m § ffi tt вшьтм1™ w Siiii ir "er

Moitse Amphioxus

Sp Sp

Sea urchin

Sp Sp Sp Sp Sp Sp Sp

B ^ag gg Н'-ч^ n^VÍQ Нс^ицз* Ha^u^t

Рис. 1. Новая «молекулярная» филогения Bilateria. В - Bilaíeria; D -Deuterostomia; Р - Protostomia; L - Lophotrochozoa; E - Ecdysozoa. В красной рамке - полный набор (комплемент) Нох-генов Lophotrochozoa, найденный у Nereis virens (из de Rosa ct al., 1999).

Термин Lophotrochozoa - произошёл от двух других зоологических терминов -Lophophorata и Trochophora. Lophophorata - группа животных, которая неожиданным образом вошла в состав Protostomia, а раньше рассматривалась как самостоятельная группа, у которой был недавний общий предок с вторичноротыми животными. Trochophora - ресничная сферическая личинка, характерная для большинства Lophotrochozoa.

Эта новая «молекулярная» филогения, совпала с выстроенной ранее, но не принятой всерьез филогенией по 18s рДНК (Field et al., 1988) и, несколько позже, по митохондриальной ДНК (Cohen et al. 1998b). Сравнительный анализ последовательностей Яодг-генов свидетельствовал, что общий предок билатеральных животных, находящийся в основании этих трех эволюционных ветвей, уже обладал, по меньшей мере, семью //ox-генами (de Rosa et al., 1999) и тремя ParaHox-тенши (Jimenez-Guri et al. 2006). Как выглядел этот общий предок, какие процессы вели к его возникновению и чем вызвана беспрецедентная радиация его потомков -вопросы, составляющие парадигму современной науки об эволюции Metazoa.

За последние пять лет, механизмы, лежащие в основе морфологической эволюции, стали в значительной степени понятны. Появились замечательные экспериментальные подходы, позволяющие тонко настраивать работу интересующего гена, выключать его в нужный момент развития или стимулировать его эктопическую экспрессию. Появились новые модельные объекты - такие, как представители эволюционной ветви Lophotrochozoa (моллюски, полихеты, плоские черви), которые, в отличие от традиционных (дрозофила, нематода, мышь) менее специализированы, а потому более ценны для понимания анцестральных функций ключевых генов развития. Вероятно, благодаря молекулярно-генетическим исследованиям этой группы животных, в ближайшее десятилетие основополагающие этапы морфологической эволюции Bilateria, будут доступны для теоретической реконструкции на молекулярном, то есть базовом, уровне.

Похожие диссертационные работы по специальности «Биология развития, эмбриология», 03.00.30 шифр ВАК

Заключение диссертации по теме «Биология развития, эмбриология», Кулакова, Милана Анатольевна

выводы

1. Метаморфоз несегментированной личинки Nereis virens - трохофоры - в сегментированную метатрохофору сопровождается пространственно-колинеарной экспрессией генов РагаНох-кластера в пищеварительной и нервной системах.

2. Ларвальная экспрессия трех Nvi-ParaHox-генов в пищеварительном тракте полихеты ассоциирована с четко дифференцируемыми отделами трехчастной дефинитивной кишки и может осуществлять осевую регионализацию зачатка.

3. Постларвальная активность Nvi-РагаНох-геков в нейроэктодерме, колинеарна в пределах каждого нейромера, а не целого организма, и затрагивает единичные клеточные группы вдоль передне-задней оси каждого постларвального нейромера.

4. Ларвальная экспрессия Нох- и РагаНох-генов Nereis virens отличается от их постларвальной экспрессии, подтверждая теорию первичной гетерономности сегментов.

5. Nvi-Cad важный участник гаструляционных топологических преобразований и эта функция ортологов cad консервативна для Bilateria.

6. Все гены РагаНох-кластера демонстрируют индивидуальные (не колинеарные) паттерны экспрессии, и эти паттерны эволюционно консервативны.

HpiLio.weiiue 1 Nvi-Gsh ga gag tgt ccg aat ggt cta gaa gtg acc cac tta gta tgt aga ecpnglevthlvcr tgg ccg att att caa cgc att tgg aaa taa cag ccc ttt att gag wpiiqriwkoqpfie taa att agc gca caa aaa aag gga tat ttt tgc ggc att tcc cac oisaqkkgyfcgish ctc ggt ggc cta ctg aac aga aac tca gag gtt gta gag gtt ggc lggllnrnsevvevg tct tct gag atg ttt tag tgt ctg gga agg gag tga agg ggt ctt ssemfbclgrejrgl cag aat ggt caa taa ttt ggc tat ttt ggg qngqofgyfg

HHTpOH 177 n.O, taaatgatacagggagcaaat tt gttgt tatgagatct tacatacacct taaaacat t cgagctcagcaagacatcatatcctgaatggacagaagttaccgtattcatccccctg atctcttgatggcctaattgtgcaaaatttttaattgatgaatttatttgtctctttt gca ggg ggt gca cca gtt act aac gca gac ata gaa gat gct aac ggc ggapvtnadiedang aaa aga atc cgc aca gct ttc acc agc acc caa cta ctc krirtaftstqll gag tt e gaa aga gaa ttt tcc agc aac atg tac tta tcc aga ctc aga BS e r e f s s n m y l s r l r r lata gaa atc gcc acc tat ctc aat cta tcg gaa aaa cag gtc x e i a t y l n l s tac e aag k aag Q gaa V ggt k gtc

Iatc tgg ttc caa aat cgt cgc gtg aagI i w f q n r r v k y k K e g V acg gat tct cgc gat aaa tgc cga tgt ttg cgc acg tgc tca tca t D s R D K c R c L R t c S S tca cgt ggt agc aag aga tca act tcc cct agc gag tgt tcc atg s R g S K R S T s p S E c s M aac tac gaa ggt cac aga cat agc gat gag gag gac att gtt ctg

N Y E g H R H S D E E D I V L acg gaa act gac tct aaa gaa att aac gta gaa gac gac act gac t E T D S K E I N V E D D t D cat aat gtc act tgt cca caa agc ttt tcg cca tga

H N V t c P Q S F S p stop

3' UTR 464 n.o. caatttgccgcagttgtaaacaaatgggacacttgcttaactgttgtacgagacgaga aagacaatac caag t acat t aat g at gct agaat catcgacat taa t t t g aag t gaca tgtttaaccattaccattgacctgaccaccaaatatgatgtgcttatatacataatat gtgcttaaactgtaggctcaatcaacatttgtgaaagtttgtaattttgatttttaaa at cag tatctttctatgatcattactgttgcattc cacc c t g t gat aagcaataac aa atttacttacacaccaatcaacacatcaatcaaatcacttgattcaatcaaatatcac ttgattcaatcatctatcacttgattccctacgtgtcttgcaataacattgtgcctgt g cat tatattatat tacat ta cat t gaaaac attttacctgtatttgtattttgatgt aaatactttattgttattta

Nvi-XIox

Интрон 571 и.о.

ATCCTCCTGGGGCGAGAGATGATAAAAAGGCAAAGAAAAAAGACTGGATCTCCACCAAAC AAAGAAAA TAAT TACGACTCTA TAAGAAAAATAG T T G G С T T TAñCC СAAAGAATAAGA TATA AGAAATAGT T TCAAAGCAGTTTTTGCACTTTTTGTGCAGTTTTTATATTTTTTTGTGCAGTT TTTATACTTTGTGTGCAGTTTTTATАСТАТTTGTGCAGTTTTTATACTTTTTGTGCATAAAA CTGGCTGTTTGCATGTATGTG TGAACGC TAAAAG GTT TCAT CGT С АС С СAAAG ТСАТТАТСТ GTTCTGTTCTGTGCAAAATGCCACGTTCACCTTTGCTTTGAAACATTATCAGGATTTTCCAG СATG TCAC CATCATGGGCCTGTGTAG TAGACA T СAC TGCA T G CAC GACAT ТС СААССАССАА T T G T GATAAA СAAAT T G С ACAAC T AAAACAAG TCCACACATATCACAGGTAT СACAGG T AC A С T G T T GGAG GGACGGATCCACT CAGT TCC GAT TTTGATATCTGTTACCC AAAT TATAAT TTC AATAT TTTAATT ТСA

GGA GCC AAC CTG GAC TTC ACT GAC GA GANLDFTDE h AAC AAG CGC ACG AGG n к r t r t gcc tac act cgc tct cag ttg a y t r s q l

GAG TTG J

ШШ ■

2*1 в

AAA GAA TTC CAT TTT AAC AAA TAC АТС TCT CGC CCC AGG AGG АТС GAj Я К H n К s Е

CTG GCT ТСС ATG СТА AGС ТТА АСС GAA AGG CAC АТС s M Е H aaa att tgg ttc ca i к i w f q g aat cga aga atg aaa tgg aaa aag gac gaa gca aag cga cgg ccg cgc с n r r mkwkkdeakrrpr ct ctc tcg gaa tca gac gac aac aaa gat тсс тсa gat gct ggc gac атс plsesddnkdssdagdi

TCG TGT АСА AAA CAA GAA GTG CCG GAT AAG GAC AAT GAT GAG AAT GGC AA SCTKQEVPDKDNDENGN

С AGT GCT CTT GAG AAC AAA AAT GAC AGС AAA GGT GAA CGC ATT GAT GCA A SALENKNDSKGERIDA at gaa cag gac ttt tcg аса gaa gac aga gtt tca cca gac tct gca tat neqdfstedrvspdsay tca gaa gac atg аса aag aga gga cag gat тсс cct tca cct gat aaa ac se dmtkrgqdsps pdkt

G AGA ACT GTG TGA CTT CCT GTA AAT ATT GAA CCT TAA TTC TCA АТС AGT T RTVJLPVNIEPOFSIS

CA GAG TCT GCA AAA CTC ATT GTG CAA AGA ACA GTC TAA АСС TTG GTG CAT SESAKLIVQRTVOTLVH

TAA CAT TTT TCA TTA GAT TTT CAT GTA GCC TTA CTT ATT GTT CAC TTT GA OHFSLDFHVALLIVHFD с tta tat gtt cag cat caa tta agt agc aaa gaa taa taa aag tga aaa g

LYVQHQLSSKE Stop 3' UTR 382 и.о. acttcagt cgaaaaataac ac tac t atagat gaact at tacatatag tgacctact gag gcaat tata ttttctcttaattaaacaatgtaagaaaaatataatcagtgccataactcaggagatattggataatt t t t t с t t taat gaatасс сaaagag gcaacgacac с gag g gaaagggcaat gcttcactt gtaaaatg gctggtgggtcttgttaatttttcattgatgcaatttatgtaatcatgcaatgtttgaaaatgttatt ttcattcgactttgtgttgataatcattgtaaataaataacaaaatcacaatcagaaaaaaaaaaagc ttgtcatagctgtttcctg ^çctatactgagtcgtatтлеa

Nvi-Cad

AGT CGG AAA ATT TCT CAG CTT GTT ТСС TTC ATA ACA TAC АТС GTC TGC SRKISQLVSFITYIVC

TAC TGC GCA CAG TAT TTT CAT AAC AGС TTC ACT CTG rGC TGT CAA CTC YCAQYFHNSFTL?CQL tac att ttg aaa ggc aaa aag gca gtc aat agc aaa att tat cac ста y i l к g к к a v n s к i y h l ctt cag ctc taa tct tgg gga aaa aaa ttc att cg a gtg ttt act tgt l q l 0 s v) g к к f i r v f t с gga ata ctt tga cag tca ctg ttc ttt gat gtt ata tcg taa cac ttt g i L j q s l f f d v i s 0 h f ccg ttt cgt gtc gtc ctt ata att ata att ctt tat gat cca ttg tcg p f r v v l i x i i l y d p l s ttg gtc aaa aat tcc ttt aac gtc att aga gat ttt tga tgt аса tcc l v к n s f n v i r d f a с t s ggc tga ttt att tat ttt атс ttt gat gtt aat gtt ttt aat ttt ttt g J f i y f i f d v n v f n f f ttg ggt cgt cca cca ttt gtg act ttg att gtt tta tta aaa cgt ttg l g r p p f v t l i v l l к r l аса ttt att ttt tca gga aag аса aga аса aag GAC AAA TAC AGA GTC t f i f s g к t r t к D к Y R V

GTT V TAC Y ACT t GAT D CAT H CAG Q AGA R ictg gag ttg gag aaa gaa ttc cat tacl

L E L E К E F H Y

Itca aga tac att аса at с aga aga aaa gct gag ctt gct cag aac CTCl s R Y I T I R R К A E L A Q N L aat ctg tca gaa aga caa gtc aag att tgg ttc cag aac agg cgt gct1

N X. S E R Q V К X W F Q N R R A

SE к нитрон 274 п.о.

G ТААТ ТACATATAAAG Т ТAT G GАААСATАА Т Т С Т Т С ТААААА Т Т АААТA GGCC ТAAG Т Т G TCTAGGCCTAATCCGGAATGTAATTTAATCCATCCAGCTGGATATGAAGCAATTATAATG GGTCTATATAGACCCTAATATTAATAAAGCTATTTTAATGAACAAATGTTGAAAATTGAG TGGGTTAGTGTGTTAATAGAGTCAACTACGCCTGTAGACACGTTAATTGTTAAATGATTA TTTTCTAACAAATATTTTTCCATTTTAATTTTAG

GAA CGC AAA CAG AAC AAG aaa cgg gaa gat ggt atg caa gga gcc gga erkqnkkredgmqgag

AGC GGC GCC GTC AAC GTC AAG ACG GAA CTT TCG CCA GGA ACG TCA GGA SGAVNVKTELSPGTSG

AGC AGC GTC ACG TCA CCA ACG CCA AAT TTG ACG TCA CCA GGC ATG GCA SSVTSPTPNLTSPGMA

CAC CCT ATG GGC CCG TCA CCG H P M G P S P

И ь ^ "Ч « ь

32И

С — \ • • 1* ( *■ щ 9 " . Г'

34Ь

11 ! I / у т к ш

5(Ж

Заключение

Идея о возникновении «мегакластера», состоящего из NK-, Нох-, и ParaHox-кластеров, каждый из которых на заре становления Triploblastica паттернировал один из трех зародышевых листков, отчасти подтверждается нашей работой. Действительно, гены ParaHox-кластера Nereis virens демонстрируют раннюю, по сути эмбриональную, экспрессию в зачатке пищеварительной трубки и такая экспрессия наглядно колинеарна. Это первые данные, подтверждающие гипотезу Питера Холанда (Holland, 2001), о ключевой роли ParaHox-кластера в аксиальной регионализации пищеварительного тракта. Однако, это не единственная функция

Nvi-РагаНох-генов. Все они заняты в спецификации судеб отдельных клеток брюшного нервного ствола. Nvi-Gsh и Nvi-Xlox экспрессируются в эписферной (головной) нервной системе. Участие РагаНох-теноъ в нейральных дифференцировках показано для большинства исследованных Bilateria, поэтому, эта их функция может оказаться не менее древней. Кроме того, очень древними выглядят функции Nvi-Cad, связанные с процессами гаструляции и сегментации.

Механизмы, интегрирующие РагаНох-кластер в единую векторную систему, часто теряются по ходу эволюции. Следствием такой утраты является «разорванность» кластера, его «не полность», когда отдельные гены просто элиминируются из генома, или, утратив базовые функции, дивергируют до неузнаваемого состояния. Очевидно, что такие структурные перестройки сопутствуют функциональным. За исключением шс/-ортологов, которые практически не «теряются» и заняты в очень ранних морфогенезах, остальные ParaHox-тены не участвуют в разметке общего плана тела. Ранняя осевая экспрессия Nvi-РагаНох-тенов в пищеварительной трубке, показана нами впервые. Мы наблюдаем её у примитивной полихеты, вероятно близкой к общему предку Annelidae, а по мнению ряда авторов (Raíble, Arendt, 2004; Arendt, 2005; Raíble et al., 2005; de Rosa et al., 2005; Steinmetz et al., 2007), и к предку всех Bilateria. Возможно, функция осевой регионализации была утрачена РагаЯох-кластером еще на ранних этапах эволюции Bilateria, но примитивные Lophotrochozoa сохранили в своем онтогенезе стадию, когда эта функция еще востребована. Если это так, то механизм, координирующий раннюю экспрессию Нох- и РагаНох- генов - общий, он продиктован единством происхождения этих кластеров и был заложен в предковом ProtoHox-кластере. Сравнительный анализ экспрессионного паттерна РагаНох-генов позволяет лучше представить гипотетического общего предка билатеральных животных - Urbilateria. По всей видимости, этот предок использовал кластер РагаНох-тепов для осевой регионализации пищеварительного тракта. Кроме того, экспрессия, по крайней мере, двух генов из трех - xlox и cad, была важна для более поздних процессов спецификации, а в дальнейшем, для поддержания этой спецификации в клетках дефинитивной кишки. С очень высокой вероятностью, ген cad был интегрирован у Urbilateria в программу гаструляции. Разница в молекулярных механизмах сегментации у позвоночных, членистоногих и полихет -велика, но, во многих случаях, ген cad внедрен в программу субтерминального роста, следовательно, он мог быть причастен к аналогичному процессу у общего предка Bilateria. Ранняя экспрессия гомологов gsh в зачатке головного мозга отмечена абсолютно у всех исследованных билатеральных животных. Очевидно, что такая функция очень древняя и унаследована от общего предка. Возможно, xlox так же был причастен к паттернированию головного мозга Urbilateria, поскольку гомологи xlox экспрессируются в эмбриональном мозге у крысы (Percz-Willamil et al. 1999; Schwartz et al., 2000) и полихеты Nereis virens. Вопрос об анцестральной экспрессии РагаНох-т&ноъ в туловищной мезодерме (эндомезодерме) остается не ясным. Для Nvi-РагаНох-гсноь экспрессия в мезодерме не показана. Однако, у хордовых, некоторых аннелид (Tubifex, Capitella и, возможно, Platynereis) и моллюсков (Patella) мезодермальная экспрессия гомологов cad имеет место. Возможно, Nereis virens утратил эту анцестральную функцию гена cad относительно недавно. Вопрос о первичных и вторично-приобретенных функциях кластера РагаНох-тенов не решается простым сравнением исследованных паттернов. За редким исключением (экспрессия гомолога cad в головном мозге и глотке у Capitella) домены экспрессии этих генов эволюционно консервативны, то есть, отмечены в гомологичных структурах у представителей всех трех эволюционных ветвей Bilateria. Возможно, базовая функция РагаНохг-кластера была связана с регионлизацией пищеварительной трубки. Однако, немногим позже, или одновременно с этим, РагаНох-гены стали участниками других важных морфогенетических программ, отчасти связанных с аксиальной спецификацией (экспрессия cad и xlox в дефинитивной кишке), или не связанных с ней вовсе (ранняя эмбриональная экспрессия cad при гаструляции, экспрессия gsh в головном мозге). Этот сценарий вероятен, если мы придерживамся "классического" взгляда на происхождение РягаЯо.г-кластера, как паралога кластера Яох-генов. В этом случае, все гены РагаЯолг-кластера появились одновременно, унаследовав от предкового комплекса такой способ регуляции экспрессии, который сразу интегрировал их в единую систему (Brooke et al., 1998; Garcia-Fernandez, 2005(b); Kourakis. Martindale, 2000). Альтернативный сценарий предполагает последовательное, "Яох-независимое" возникновении одного или даже двух генов ParaHox-кпастера (Garcia-Fernandez, 2005; Ryan et al., 2007). В этом случае, "частные" функции отдельных генов могут оказаться древнее общей функции осевой регионализации. Последняя могла возникнуть, а вернее "проявиться" уже после того, как РагаНохг-кластер стал трехгенным. Однозначный выбор между этими сценариями пока невозможен. Чтобы «первичное» отсутствие последовательности не принималось за ее «вторичную» утрату, и наоборот, необходимо иметь четкое представление о порядке отхождения эволюционных ветвей примитивных таксонов от общего ствола филогенетического древа Ешп^агоа.

Наши данные недостаточны для широких эволюционных обобщений, поскольку их трудно сравнивать - примитивные представители других крупных таксонов пока не исследованы в отношении осевой экспрессии РагаНох-генов. Кроме того, серьёзные рассуждения о функции любого гена предполагают проведение функционального теста, который пока не сделан. Очевидная польза этой работы в том, что она направляет и уточняет пути, по которым можно двигаться дальше, при решении некоторых фундаментальных проблем эволюционной биологии развития.

Список литературы диссертационного исследования кандидат биологических наук Кулакова, Милана Анатольевна, 2008 год

1. Aboobaker A. A. Blaxter М. L. Hox gene evolution in nematodes: novelty conserved//Curr. Opin. Genes Dev. 2003b. V. 13. P. 593-598.

2. Aboobaker A. A. Blaxter M. L. IIox gene loss during dynamic evolution of the nematode cluster// Curr. Biol. 2003a. V. 13. P. 1-4.

3. Abzhano A. Kaufman Т. C. Homeotic genes the arthropod head: expression patterns of the labial, proboscipedia, Deformed genes in crustaceans insects // Proc. Natl. Acad. Sci. USA. 1999b. V. 96. P. 10224-10229.

4. Abzhanov A. Kaufman Т. C. Novel regulation of the homeotic gene Scr associated with a crustacean leg-to-maxilliped appendage transformation // Development. 1999a. V. 126. P. 1121-1128.

5. Abzhanov A., Kaufman T.C. Crustacean (malacostracan) Hox genes and the evolution of the arthropod trunk // Dev. 2000a. V. 127. P. 2239-2249.

6. Ackermann C, Dorresteijn A, Fischer A: Clonal domains in postlarval Platynereis dumerilii (Annelida: Polychaeta). J Morphol 2005, 266:258-280.

7. Akam M. Arthropods: Developmental diversity within a (super) phylum // Proc. Natl. Acad. Sci. USA. 2000. V. 97. P. 4438-4441.

8. Akam M. E., Averof M„ Gastelli-Gair J., Dawes R., Falciani F., Ferrier D. The evolving role of Hox genes in arthropods // Development Suppl. 1994. V. P. 209215.

9. Akam M. Hox genes and the evolution of diverse body plans // Philos. Trans. R. Soc. Lond. B. Biol. Sci. 1995. V. 349. P. 313-319.

10. Akam M. Hox genes, homeosis and the evolution of segment identity: no need for hopeless monsters // Int. J. Dev. Biol. 1998b. V. 42. P. 445-451.

11. Akam M. Hox genes: from master genes to micromanagers // Curr. Biol. 1998a. V. 8. P. R 676-R 687.

12. Alonso C. R., Maxton-Kuechenmeister J., Akam M. Evolution of Ftz protein in insects // Curr. Biol. 2001. V. 11. P. 1473-1478.

13. Anderson, D.T. (1966). The comparitive embryology of the Polychaeta., Acta Zool. 47,1-42.

14. Andreeva T.F., Cook C.E., Korchagina N.M., Akam M., Dondua A.K., Polychaete Nereis virens Hox-genes: RCR- based survey and Cluster Organization, Онтогенез 2001 т.32,№3, стр.225-233

15. Arenas-Mena C., Cameron A.R., Davidson E.H. Spatial expressionof Hox cluster genes in the ontogeny of a sea urchin // Dev. 2000. V. 127. P. 4631-4643

16. Arendt D. Spiralians in the limelight // Genome Biol. 2003. V. 5. P. 303.

17. Arendt D., Genes and homology in nervous system evolution: Comparing gene functions, expression patterns, and cell type molecular fingerprints, Theory in Biosciences 124 (2005) 185-197

18. Averof M. Akam M. Hox genes diversification of insect crustacean body plans //Nature. 1995. V. 376. P. 420-423.

19. Averof M., Patel N. H. Crustacean appendage evolution associated with changes in Hox gene expression //Nature. 1997. V. 388. P. 382-386.

20. Awgulewitsch A., Hox in hair growth and development; Naturwissenschaften (2003) 90:193-211

21. Awgulewitsch A., Jacobs D. Deformed autoregulatory element from Drosophila functions in a conserved manner in transgenic mice, Nature 358, 341 344 (23 July 1992)

22. Aziz Aboobaker and Mark Blaxter, Hox gene evolution in nematodes: novelty conserved Current Opinion in Genetics & Development 2003a, 13:593-598

23. Aziz Aboobakery and Mark Blaxter, Hox gene evolution in nematodes: novelty conserved, Current Opinion in Genetics & Development 2003b, 13:593-598

24. Banerjee-Basu S. and Baxevanis A. D. Molecular evolution of the homeodomain family of transcription factors, Nucleic Acids Research, 2001, Vol. 29, No. 15.

25. Barucca M., Biscotti M. A., Olmo E., Canapa A. All the Three ParaHox Genes are Present in Nuttallochiton mirandus (Mollusca:Polyplacophora): Evolutionary Considerations JOURNAL OF EXPERIMENTAL ZOOLOGY (MOL DEV EVOL) 306B (2006)

26. Bayascas J., R., Castillo E., Muñoz-Mármol A. M., Saló E. Planarian Hox genes: novel patterns of expression during regeneration // Development. 1997. V. 124. P. 141-148.

27. BeckF., Homeobox genes in gut development. 2002 Sep;51(3):450-4.

28. Beck, F., Erler, T., Russell, A. & James, R. (1995) Dev. Dyn. 204, 219-227.

29. Bel-Vialar, S., Itasaki, N. & Krumlauf, R. (2002) Development (Cambridge, U.K.) 129,5103-5115.

30. Bleidorn C., Vogt L., and Bartolomaeus T., New insights into polychaete phylogeny (Annelida) inferred from 18S rDNA sequences, Molecular Phylogenetics and Evolution 29 (2003) 279-288

31. Brooke N. M., Garcia-Fernández J., Holland P. W. H. The ParaHox gene cluster is an evolutionary sister of the Hox gene cluster // Nature. 1998. V. 392. P. 920922.

32. Brusca RC, Brusca GJ: Invertebrates. 2nd edition. Sunderland, Sinauer Associates; 2003.

33. Bürglin T. R., Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals, Nucleic Acids Research, 1997, Vol. 25, No. 21 4173-4180

34. Burke A. C., Norwick J. Hox genes axial specification in vertevrates // Amer. Zool. 2001. V. 4l.P. 687-697.

35. Burke A. C., Nelson C. E., Morgan B. A., Tabin C. Hox genes the evolution of vertebrate axial morphology//Development. 1995. V. 121. P. 333-346.

36. Canapa A., Biscotti M. A., Olmo E., Barucca M., Isolation of Hox and ParaHox genes in the bivalve Pecten maximus, Gene 348 (2005) 83-88

37. Carroll S. B. Evolution at Two Levels: On Genes Form // PLoS Biology. 2005. V.3.P. 1159-1166.

38. Carroll S. B., Grenier J. K., Weathcrbee S. D. From DNA to Diversity: Molecular genetics the evolution of animal design // Maiden, Massachusetts: Backwell Science. 2001

39. Carroll SB, Weatherbee SD, Langeland JA. Nature 1995: 375: 58-61

40. Cavodeassi F., Modolell J. and Gómez-Skarmeta J. L., The Iroquois family of genes: from body building to neural patterning, Development 128, 2847-2855 (2001)

41. Chawengsaksophak K., de Graaff W., Rossant J., Deschamps J., Beck F., Cdx2 is essential for axial elongation in mouse development, PNAS May 18, 2004 vol. 101 no. 20 7641-7645

42. Cook CE, Jimenez E, Akam M, Salo E. The Hox gene complement of acoel flatworms, a basal bilaterian clade. Evol Dev. 2004 May-Jun;6(3): 154-63

43. Copf T., Schroder R., Averof M., Ancestral role of caudal genes in axis elongation and segmentation, PNAS December 21, 2004 vol. 101 no. 51 17711-17715

44. Corbin J. G., Gaiano N., Machold R. P., Langston A. and Fishell G., The Gsh2 homeodomain gene controls multiple aspects of telencephalic development, Development 127, 5007-5020 (2000)

45. Corradoa M., Anielloa F., Fuccib L., Branno M. Ci-IPFl, the pancreatic homeodomain transcription factor, is expressed in neural cells of Ciona intestinalis larva; Mechanisms of Development 102 (2001)

46. Damen W. G. M., Tautz D. A hox class 3 orthologue from the spider Cupiennius satei is expressed in a Hox-gene-like fashion // Dev. Genes Evol. 1998a. V. 208. P. 586-590.

47. Damcn W. G. M., Hausdorf M., Seyfarth E. A., Tautz D. A conserved mode of head segmentation in arthropods revealed by the expression pattern of Hox genes in a spider // Proc. Natl. Acad. Sci. USA 1998b. V. 95. P. 10665-10670.

48. Dearden P. K., Akam M., Early embryo patterning in the grasshopper, Schistocerca gregaria: wingless, decapentaplegic and caudal expression, Development 128, 3435-3444 (2001)

49. Deschamps J., van Nes J. Developmental regulation of the Hox genes during axial morphogenesis in the mouse // Development. 2005. V. 132. P. 2931-2942

50. Deschet K., Bourrat F., Chourrout D., Joly J., Expression domains of the medaka (Oryzias latipes) Ol-Gsh 1 gene are reminiscent of those of clustered and orphan homeobox genes, Dev Genes Evol (1998) 208:235-244

51. Dondua, A.K., 1975. Effect of actinomycin D and sibiromycin on theembryonic and larval development of Nereis virens (Sars.). Ontogenez 6, 475^184.

52. Edgar, L. G., Carr, S., Wang, H. and Wood, W. B. (2001). Zygotic expression of the caudal homolog pal-1 is required for posterior patterning in Caenorhabditis elegans embryogenesis. Dev. Biol. 229, 71-88.

53. Fang R, Olds LC, Sibley E: Spatio-temporal patterns of intestinespecific transcription factor expression during postnatal mouse gut development. Gene Expr Patterns 2006, 6:426-432.

54. Ferrier D. E. K., Minguillon C., Evolution of IIox/ParaHox gene clusters // Int. J. Dev. Biol. 2003. V. 47. P. 605-611

55. Ferrier D.E.K., Dewar K., Cook A., Chang J. L., Hill-Force A. and Amemiya C., The chordate ParaHox cluster, Current Biology Vol 15 No 20, 2006, 820-822

56. Ferrier, D.E.K., Holland, P.W.H., 2001. Sipunculan ParaHox genes. Evol.Dev. 4, 263- 270.

57. Fibi M, Kesscl M, Gruss P., Murine Hox genes-a multigene family, Curr Top Microbiol Immunol. 1988;137:82-6.

58. Field, K.G., Olsen, G. J., Lane, D.J., Giovannoni, S.J., Ghiselin, M.T., Raff, E.C. 1988. Molecular phylogeny of the animal kingdom. Science 239: 748-753.

59. Freund J., Domon-Dell C., Kedinger M., and Duluc I., The Cdx-1 and Cdx-2 homeobox genes in the intestine, Biochem. Cell Biol. 76: 957-969 (1998)

60. Frobius A.C., Seavcr E.C., ParaHox gene expression in the polychaete annelid Capitella sp.I, Dev Genes Evol (2006) 216: 81-88

61. Galant R. Carroll S.B., Evolution of a transcriptional repression domain in an insect Hox protein, NATURE | VOL 415 | 21 FEBRUARY 2002, 910-913

62. Gamer, L. W„ Wright, C. V. (1993) Mech. Dev. 43, 71-81.

63. Garcia-Fcrnandez J., Hox, ParaHox, ProtoHox: facts and guesses, Heredity (2005)94,145-152

64. Gouar M. L., Lartillot N., Adoutte A., Vervoort M., The expression of a caudal homologue in a mollusc, Patella vulgata, Gene Expression Patterns 3 (2003) 35-37

65. Grcnier J. K., Carroll S. B. Functional evolution of the Ultrabitorax protein // Proc. Natl. Acad. Sci. USA. 2000. V. 97. P. 704-709.

66. Hall K.A., Hutchings P.A., Colgan D.J.: Further phylogenetic studies of the Polychaeta using I8S rDNA sequence data. Journal of the Marine Biological Association of the United Kingdom 2004, 84:949-960.

67. Hanes S. D., Brent R.; A genetic model for interaction of the homeodomain recognition helix with DNA. Science. 1991 Jan 25;251(4992):426-30

68. Hayward DC, Catmull J, Reece-Hoyes JS, Berghammer H, Dodd H, Hann SJ, Miller DJ, Ball EE: Gene structure and larval expression of cnox-2Am from the coral Acropora millepora. Development Genes and Evolution 2001,211:10-19.

69. Hinman V. F., O'Brien E. K., Richards G. S., and Degnan B. M., Expression of anterior Hox genes during larval development of the gastropod Haliotis asinina, EVOLUTION & DEVELOPMENT 5:5, 508-521 (2003)

70. Hobert O. and Ruvkun G., A common theme for LIM homeobox gene function across phylogeny? Biol. Bull. 195: 377-380. December, 1998.

71. Hoegg S., Meyer A. Hox clusters as models for vertebrate genome evolution // Trends Genetics. 2005. V. 21. P. 421-424.

72. Holland P.W.H., Takahashi T., The evolution of homeobox genes: Implications for the study of brain development, Review, Brain Research Bulletin 66 (2005) 484-490

73. Holland P. W. H., Beyond the Hox: how widespread is homeobox gene clustering ?, J. Anat. (2001) 199, pp: 13-23,

74. Holland P. W.H., More genes in vertebrates?;Journal of Structural and Functional Genomics 3: 75-84, 2003

75. Hooman K., Moghadam H. K., Ferguson M. M., Danzmann R. G. Organisation of Hox gene clusters in rainbow trout (Oncorhitnchus mukkis)-. a tetrapode model species // J. Mol. Evol. 2005. V. 30.

76. Houle M., Prinos P., Iulianella A., Bouchart N., Lohnes D., Retinoic Acid Regulation of Cdxl: an Indirect Mechanism for Retinoids and Vertebral Specification, MOLECULAR AND CELLULAR BIOLOGY, Sept. 2000, p. 65796586

77. Hsia C., McGinncs W. Evolution of transcription factor function // Curr. Opin. Genes Dev. 2003. V. 13. P. 199-206.

78. Hsieh-Li HM, Witte DP, Szucsik JC, Weinstein M: Gsh-2, a murine homeobox gene expressed in the developing brain. Mech Dev 1995, 50(2-3): 177-86.

79. Hudson C, Lemairc P, Induction of anterior neural fates in the ascidian Ciona intestinalis. Mechanisms of Development 2001, 100:189-203.

80. Hudson C., Lcmaire P., Induction of anterior neural fates in the ascidian Ciona intestinalis. Mechanisms of Development 100 (2001) 189-203

81. Hughes C. L., Kaufman T.C., Exploring the myriapod body plan: expression patterns of the ten Hox genes in a centipede, Development 129, 1225-1238 (2002a)

82. Hughes C.L., Kaufman T.C. Hox genes and the evolution of the arthropod body plan // Evolution and Development. 2002b. V. 4. N. 6. P. 459-499.

83. Hunter C. P., Harris J. M., Maloof J. N. and Kenyon C., Hox gene expression in a single Caenorhabditis elegans cell is regulated by a caudal homolog and intercellular signals that inhibit Wnt signaling, Development 126, 805-814 (1999)

84. Hwang S.L., Wu J., Chen C. A., Hui C. and Chen C., Novel pattern of AtXlox gene expression in starfish Archaster typicus embryos, Develop. Growth Differ. (2003) 45, 85-93

85. Ikuta T., Yoshida N., Satoh N., Saiga H. Ciona intestinalis Hox gene cluster: Its dispersed structure residual colinear expression in development // Proc. Natl. Acad. Sci. USA. 2004. V. 101. P, 15118-15123.

86. Irvin S. Q., Martindale M. Q. Expression pattern of anterior Hox genes in the polychaete Chaetopterus: Correlation with morphological boundaries // Dev. Biol. 2000. V. 217. P. 333-351.

87. Irvine S. Q., Chaga O., Martindale M. Q. Larval ontogenetic stages of Chaetopterus: developmental heterochrony in the evolution of chaetopterid polychaetes//Biol. Bull. 1999 V. 197. P. 319-331.

88. J. A. MacLean, Chen M. A., Wayne C. M., Bruce S. R., Rao M., Meistrich M. L., Macleod C., and Wilkinson M. F., Rhox: A New Homeobox Gene Cluster, Cell, Vol. 120, 369-382, February 11, 2005

89. Jagla, K., Bellard, M., Frasch, M.; A cluster of Drosophila homeobox genes involved in mesoderm differentiation programs. Bioessays 23, 125-133 (2001)

90. Jagla, K., Frasch M., Jagla T., Dretzen G., Bellard F. and Bellard M. Ladybird, a tandem of homeobox genes thatmaintain late wingless expression in terminal and dorsalepidermis of the Drosophila embryo. Development 124, 91-100 (1997)

91. Jimenez-Guri E., Paps J., Garcia-Femandez J., Salo E. I. J. Hox and ParaHox genes in Nemertodermatida, a basal bilaterian clade, Dev. Biol. 50: 675-679(2006)

92. Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994) Nature 371, 606-609

93. Kessel, M. and Gruss, P. (1991). Homeotic transformations of murine vertebrae and concomitant alteration of Hox codes induced by retinoic acid .Cell 67, 89-104.

94. Kim, Y., Nirenberg, M. Drosophila NK-homeobox genes. Proc. Natl Acad. Sci. USA 86, 7716-7720 (1989)

95. Kmita M., Duboule D. Organizing axes in time space; 25 years of collinear tinkering// Science. 2003. V. 301. P. 331-333.

96. Korchagina NM, Andreeva TF, Monteiro AS, Holland PWH, Ferrier DEK, Homeobox gene clusters in polychaete annelids, British Societis for Cell and Development Biology Joint Spring Meeting (BSDB);Warwick, 2005

97. Kourakis M. J., Martindale M. Q. Hox gene duplication deployment in the annelid leech Helobdella// Evol. Dev. 2001. V. 3. P. 145-153.

98. Kriks S., Lanuza G. M., Mizuguchi R., Nakafuku M., Goulding M., Gsh2 is required for the repression of Ngnl and specification of dorsal interneuron fate in the spinal cord, Development 132,2991-3002, 2005

99. Krumlauf R. Hox genes pattern formation in the branchial region of the vertebrate head // Trends Genet. 1993. V. 9. P. 106-112.

100. Kulakova M. A, Cook C. E. and Andreeva T. F., ParaHox gene expression in larval and postlarval development of the polychaete Nereis virens (Annelida, Lophotrochozoa), BMC Developmental Biology 2008, 8:61

101. Kulakova M. A., Kostyuchenko R. P., Andreeva T. F., Dondua A. K., The Abdominal-B-like gene expression during larval development of Nereis virens (polychaeta). Mechanisms of Development 115 (2002) 177-179

102. Larroux C., Fahey B., Degnan S. M., Adamski M., Rokhsar D. S. and Degnan B. M., The NK Homeobox Gene Cluster Predates the Origin of Hox Genes, Current Biology 17, 706-710, April 17,2007

103. Lec P. N., Callaerts P., de Couet H. G. & Martindale M. Q., Cephalopod Hox genes and the origin of morphological novelties, NATURE |VOL 424 | 28 AUGUST 2003

104. Li H, Zeitler PS, Valerius MT, Small K, Potter SS: Gsh-1, an orphan Hox gene, is required for normal pituitary development.,Embo Journal 1996, 15:714724.

105. Li H., Zeitler P. S., Valerius M.T., Small K. and Potter S. S., Gsh-1, an orphan Hox gene, is required for normal pituitary development, The EMBO Journal vol.15 no.4 pp.714-724, 1996

106. Luke G. N., Castro L. F. C., McLay K., Bird C., Coulson A., and Holland P. W. H. Dispersal of NK homeobox gene clusters in amphioxus and humans. Proc. Natl Acad. Sci. USA 100, 5292-5295 (2003)

107. Macdonald P.M., Struhl G.: A molecular gradient in early Drosophila embryos and its role in specifying the body pattern. Nature 1986, 324:537-545.

108. Maier E. A., Dusing M. R., and Wiginton D. A., Cdx Binding Determines the Timing of Enhancer Activation in Postnatal Duodenum, Vol. 280, No. 13, Issue of April l,pp. 13195-13202, 2005

109. Malicki J., Cianetti L. C., Peschle C., McGinnis W. A human HOX4B regulatory element provides head-specific expression in Drosophila embryos, Nature 358,345 347 (23 July 1992

110. Matsuo K., Yoshida H., Shimizu T., Differential expression of caudal and dorsal genes in the teloblast lineages of the oligochaete annelid Tubifex tubifex, Dev Genes Evol (2005) 215: 238-247

111. Matthews J. M., Visvader J. E., LIM-domain-binding protein 1: a multifunctional cofactor that interacts with diverse proteins; EMBO reports VOL 4 | NO 12 | 2003

112. Meyer, B. I., Grass, P. (1993) Development (Cambridge, U.K.) 117, 191203.

113. Morgan R. Hox genes: a continuation of embryonic patterning? // Trends Genetics. 2006. V. 22. P. 67-69.

114. Mulley J. F„ Chiu C., and Holland P. W. H., Breakup of a homeobox cluster after genome duplication in teleosts, PNAS July 5, 2006 vol. 103 no. 2710369-10372

115. Nardelli-Hacfliger D., Shanldand M. Lox2, a putative leech segment identity gene, is expressed in the same segmental domain in different stem cell lineages // Development. 1992. V. 116. P. 697-710.

116. Nogi T., Watanabe K. Position-specific and non-colinear expression of the planarian posterior (Abdominal-B-like) gene // Develop. Growth Differ. 2001. V. 43. P. 117-184.

117. Nordstrom U., Maier E., Jessell T. M., Edlund T., An Early Role for Wnt Signaling in Specifying Neural Patterns of Cdx and Hox Gene Expression and Motor Neuron Subtype Identity, August 2006 | Volume 4 | Issue 8 p. 1438 -1452

118. Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L., and Wright, C. V. (1996) Development 122, 983995

119. Orii H., Kato K., Umesono Y., Sakurai T., Agata K., Watanabe K. The planarian Hom/Hox Homeobox genes (Plox) expressed along the anteroposterior axis // Developmental biology. 1999. V. 210. P. 456-468.

120. Papageorgiou S., Hox Gene Expression, 2007, Landes Bioscience and Springer Science+Business Media.

121. Park BJ, Cho SJ, Tak ES, Lee BE, Park SC. The existence of all three ParaHox genes in the clitellate annelid, Perionyx excavatus. Dev Genes Evol. 2006 Sep;216(9):551-3.

122. Perez-Villamil B., Schwartz P.T. Vallejo M.; 1999, Endocrinology;, Vol. 140, No. 8

123. Peterson KJ: Isolation of Hox and Parahox genes in the hemichordate Ptychodera flava and the evolution of deuterostome Hox genes. Molecular Phylogenetics and Evolution 2004, 31:1208-1215.

124. Peterson M. D., Rogers B. T., Popadic A., Kaufman T. C. The embryonic expression pattern of labial, posterior homeotic complex genes teashirt homologue in the apterygote insect // Dev. Genes Evol. 1999. V. 209. P. 77-90.

125. Phelan, M. L., Rambaldi, I., and Featherstone, M. S. Cooperative Interactions between HOX and PBX Proteins Mediated by a Conserved Peptide Motif (1995) Mol. Cell. Biol. 15, 3989-3997.

126. Pollard, S. & Holland, P. W. H. Evidence for 14 homeobox gene clusters inhuman genome ancestry. Curr. Biol. 10,1059-1062 (2000).

127. Prince V. E., Moens C. B., Kimmel C. B., Ho R. K. Zebrafish hox genes: Expression in the hindbrain region of wild-type mutants for the segmentation gene, valentine //Development. 1998. V. 125. P. 393-406.

128. Raible F. and Arendt D., Metazoan Evolution: Some Animals are More Equal than Others Dispatch, Current Biology, 2004,Vol. 14, R106-R108, February 3.

129. Rauskolb C. and Wieschaus E., Coordinate regulation of downstream genes byextradenticle and the homeotic selector proteins., The EMBO Journal vol.13 no.l5pp.3561-3569, 1994

130. Roder, L., Vola, C. and Kerridge, S. (1992). The role of the teashirt gene in trunk segmental identity in Drosophila. Development 115, 1017-1033.

131. Rosanas-Urgell, G. Marfany, J. Garcia-Fernandez, Pdxl-related homeodomain transcription factors are distinctly expressed in mouse adult pancreatic islets, Molecular and Cellular Endocrinology 237 (2005) 59-66

132. S. J. Gaunt, D. Drage, R. C. Trubshaw, cdx4/lacZ and cdx2/lacZ protein gradients formed by decay during gastrulation in the mouse, Int. J. Dev. Biol. 49: 901-908 (2005)

133. Salser S. J. and Kenyon C., C. elegans Hox gene switches on, off, on and off again to regulate proliferation, differentiation and morphogenesis, Development 122, 1651-1661 (1996)

134. Shen Wei-F., Rozenfeld S., Lawrence H. J. and Largman C.; The Abd-B-like Hox Homeodomain Proteins Can Be Subdivided by the Ability to Form Complexes with Pbxla on a Novel DNA Target; Vol. 272, No. 13, Issue of March 28, pp. 8198-8206, 1997

135. Siebert S., Thomsen S., Reimer M.M., Bosch T.C.G., Control of* foot differentiation in Hydra: Phylogenetic footprintingbindicates interaction of head, bud and foot patterning systems, Mechanisms of Development 122 (2005) 9981007

136. Skromne I., Thorsen D., Hale M., Prince V. E., Ho R. K., Repression of the hindbrain developmental program by Cdx factors is required for the specification of the vertebrate spinal cord, Development 134, 2147-2158 (2007)

137. Slack J. M. W., Holland P. W. H., Graham C. F. The zootype the phylotypic stage // Nature. 1993. V. 361. P. 490-492.

138. Stauber M., Jackie H., Schmidt-Ott U., The anterior determinant bicoid of Drosophila is a derived Hox class 3 gene, Developmental Biology, Vol. 96, pp. 3786-3789, March 1999

139. Steinmetz P. R. H„ Zelada-Gonzales F., Burgtorf C., Wittbrodt J., and Arendt D., Polychaete trunk neuroectoderm converges and extends by mediolateral cell intercalation, PNAS February 20,2007 vol. 104 no. 8 2727-2732

140. Stern D. L.; The Hox gene Ultrabithorax modulates the shape and size of the third leg of Drosophila by influencing diverse mechanisms.;Developmental Biology 256 (2003) 355-366.

141. Telford M. J. Evidence for the derivation of the Drosophila fushi tarazu gene from a Hox gene orthologous to lophotrochozoans Lox5 11 Curr. Biol. 2000. V. 10. P. 349-352.

142. Telford M. J., Thomas R. H. Expression of homeobox genes shows chelicerate arthropods retain their deutocerebral segment // Pros. Natl. Acad. Sci. USA. 1998b. V. 95. P. 10671-10675.

143. Telford M. J., Thomas R. H. Of mite zen: expression studies in a chelicerate arthropod confirm zen is a divergent Hox gene // Dev. Genes Evol. 1998a. V. 208. P. 591-594.

144. Tessmar-Raible K., Arendt D. Emerging systems: between vertebrates arthropods, the Lophotrochozoa // Curr. Opin. Genet. Dev. 2003. V. 13. P. 331— 340.

145. Toresson H. and Campbell K., A role for Gshl in the developing striatum and olfactory bulb of Gsh2 mutant mice, Development 128, 4769-4780 (2001)

146. Toresson H., Potter S. S. and Campbell K., Genetic control of dorsalventral identity in the telencephalon: opposing roles for Рахб and Gsh2, Development 127, 4361-4371 (2000)

147. Urbach R., Technau G.M.,: Molecular markers for identified neuroblasts in the developing brain of Drosophila. Development 2003, 130:3621-3637.

148. Ushakov P. V. Polychaete worms 1. Fauna of SSSR. Nauka. Leningrad. 1972.

149. Wada H., Garcia-Fernandez J., Holland P. W. H. Colinearity segmental expression of amphioxus Hox genes // Dev. Biol. 1999. V. 213. P. 131-141.

150. Wcdeen C. J. and Shankland M., Mesoderm Is Required for the Formation of a Segmented Endodermal Cell Layer in the Leech Helobdella, DEVELOPMENTAL BIOLOGY 191, 202-214 (1997)

151. Weisblat D. A., Huang F. Z. An overview of glossiphoniid leech development // Can. J. Zool. 2001. V. 79. P. 218-232.

152. Wilson, E.B., 1892. The cell lineage of Nereis. J. Morphol. 6, 361-466.

153. Wisocka-Diller J., Aisemberg G, Macagno E.R. 1995, Developmental Biology, 171. 439-447, (1995)

154. Wolpert, L., Beddington, R., Brockes, J., Jessell, Т., Lawrence, P. and Meyerowitz E., Developmental biology comes of age: Principles of Development, 2nd (1998). Principles of Development., Oxford

155. Wray, G.A., Resolving the Hox Paradox. Science (2002) 292: 2256-2257.

156. Wu L. H. and Lengyel J. A., Role of caudal in hindgut specification and gastrulation suggests homology between Drosophila amnioproctodeal invagination and vertebrate blastopore, Development 125, 2433-2442 (1998)

157. Yasukochi Y., Ashakumary L. A., Wu. C., Yoshido A., Nohata J., Mita K., Sahara K. Organization of the Hox gene cluster of the silkworm, Bombyx mori: a split of the Hox cluster in a non-Drosophila insect // Dev. Genes Evol. 2004. V. 214. P. 606-614.

158. Yun K., Potter S. and Rubenstein J. L., Gsh2 and Рахб play complementary roles in dorsoventral patterning of the mammalian telencephalon, Development 128,193-205(2001)

159. Бакаленко Н.И., Новикова E. JI., Елисеева E. В. и Андреева Т. Ф. Нох гены в развитии и эволюции билатеральных животных // Вестник Санкт Петербургского государственного университета. 2004. серия 3. Стр. 103-108.

160. Гилберт С.Ф., Опиц Д.М. Рэф P.A. Новый синтез эволюционной биологии и биологии развития. Онтогенез. (1997)

161. ПунинМЛО. 1991, Санкт-Петербург, Наука.

162. Рэфф Р., Кофмен Т., Эмбрионы, гены, эволюция: Пер. с англ.-М.: Мир, 19861. Благодарности:

Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания. В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.