Линейные прокариотические репликоны с ковалентно замкнутыми теломерами: молекулярная генетика и механизм репликации ДНК бактериофага N15 тема диссертации и автореферата по ВАК РФ 03.00.06, доктор биологических наук Равин, Николай Викторович

  • Равин, Николай Викторович
  • доктор биологических наукдоктор биологических наук
  • 2004, МоскваМосква
  • Специальность ВАК РФ03.00.06
  • Количество страниц 343
Равин, Николай Викторович. Линейные прокариотические репликоны с ковалентно замкнутыми теломерами: молекулярная генетика и механизм репликации ДНК бактериофага N15: дис. доктор биологических наук: 03.00.06 - Вирусология. Москва. 2004. 343 с.

Оглавление диссертации доктор биологических наук Равин, Николай Викторович

ВВЕДЕНИЕ

ЦЕЛЬ И ЗАДАЧИ ИССЛЕДОВАНИЯ

ОБЗОР ЛИТЕРАТУРЫ 7 ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Глава 1. Организация генома бактериофага N15.

Глава 2. Линейные плазмидные векторы на основе репликона фага N15: 83 конструирование, свойства и применение для клонирования фрагментов ДНК, содержащих инвертированные повторы.

Глава 3. Механизм установления и поддержания лизогенного состояния.

Глава 4. Механизмы стабильного наследования линейного плазмидного 142 профага

Глава 5. Идентификация функциональных доменов Sop белков, 168 обеспечивающих сегрегационную стабильность профага N15.

Глава 6. Протеломераза обеспечивает образование ковалентно замкнутых 198 теломер в процессе репликации линейного плазмидного профага

Глава 7. Связывание протеломеразы N15 с теломерами: регуляция экспрессии 213 гена telN и защита шпилечных теломер.

Глава 8. Структурно-функциональный анализ протеломеразы.

Глава 9. Характеристика репликона фага N15: идентификация генов, 242 необходимых для репликации ДНК N15 и сайта инициации репликации.

Глава 10. Функциональная характеристика репликационного белка RepA.

Глава 11. Исследование механизма репликации линейной плазмиды методами 279 электронной микроскопии.

Глава 12. Механизм репликации ДНК фага N15 в ходе литического развития.

Рекомендованный список диссертаций по специальности «Вирусология», 03.00.06 шифр ВАК

Введение диссертации (часть автореферата) на тему «Линейные прокариотические репликоны с ковалентно замкнутыми теломерами: молекулярная генетика и механизм репликации ДНК бактериофага N15»

До недавнего времени общепринятым было представление о том, что эукариотические организмы имеют линейные хромосомы, а бактериальные геномы представляют собой кольцевые молекулы. Однако, в течение последних двадцати лет это правило перестало быть универсальным, поскольку линейные плазмиды и хромосомы были обнаружены в различных прокариотических организмах.

Проблема полной репликации концов линейной ДНК была сформулированна в начале 1970-х годов в работах Ватсона (Watson, 1972) и Оловникова (Olovnikov, 1973). Она связана с неспособностью ДНК-полимераз инициировать полимеризацию de novo, т.е. помимо матрицы полимеразе необходим также предсуществующий 3' - конец, с которого начинается полимеризация. Последующие исследования показали, что концы (теломеры) линейных молекул ДНК действительно реплицируются с помощью специальных механизмов. Существуют различные решения проблемы репликации теломер (см. Рис. 1): во-первых, использование специального механизма увеличения длины теломерных районов (теломераза эукариот, см. обзоры Collins, 1996; Biessmann et al., 1997), во-вторых, инициация синтеза ДНК с помощью белков, ковалентно присоединенных к 5' - концам (Salas, 1991), в-третьих, за счет использования ковалентно замкнутых теломер (Cavallier-Smith, 1974; Bateman, 1975). Репликоны со шпилечными теломерами были обнаружены у различных эукариотических организмов и вирусов, такую структуру ДНК имеют, в частности, поксвирусы (Geshelin and Berns, 1974), иридопоксвирусы, некоторые митоходриальные ДНК, вирусы Chlorella (Hinnebusch and Tilly, 1993).

Известны два структурно различных типа линейных бактериальных репликонов: имеющие ковалентно замкнутые «шпилечные» теломеры и содержащие белки, ковалентно присоединенные к 5' концам ДНК. Примерами репликонов второго типа являются линейные хромосомы и плазмиды бактерий рода Streptomyces (Qin and Cohen, 1998; Huang et al., 1998). Первым обнаруженным линейным репликоном со шпилечными теломерами у прокариот является умеренный бактериофаг N15, который в лизогенном состоянии не интегрируется в хромосому Е. coli (V.Ravin and Shulga, 1970), а представляет собой линейную плазмиду с ковалентно замкнутыми теломерами. (Сварчевский и Рыбчин, 1984). Позднее было установлено, что аналогичную структуру ДНК имеют линейные хромосомы и плазмиды спирохет рода Borrelia (Barbour and Garon, 1987; Fraser et al., 1997), одна из хромосом Agrobacterium tumefaciens (Allardet

Servent et al., 1993; Goodner et al., 1990), а также профаги умеренных бактериофагов PY54 (Hertwig et al., 2003) и фК02 (Casjens et al., 2004).

В то же время, молекулярные механизмы репликации и стабильного наследования линейных прокариотических репликонов весьма ограничены. Основное внимание в настоящей работе посвящено изучению этих проблем на примере умеренного бактериофага N15. Тот факт, что хозяином фага N15 является Е. coli классический объект, для работы с которым создано большинство известных методов молекулярной генетики и генетической инженерии прокариот, и чья генетика относительно хорошо изучена, позволяет использовать фаг N15, как удобную экспериментальную модель для изучения всех прокариотических «шпилечных» репликонов.

Увеличение длимы юломер

Л/" еяомер»»» инициация сите»« е помощь га белков мовалеитио »«мкну!ые теломеры репликация О обрсюваниа |еяомер

Рисунок 1. Механизмы репликации линейных молекул.

Для случая ковалентно замкнутых теломер приведена одна из возможных моделей репликации.

ЦЕЛЬ И ЗАДАЧИ ИССЛЕДОВАНИЯ

Основная цель работы состояла в изучении особенностей молекулярной генетики, в том числе механизма репликации ДНК N15, анализе того, как обычные механизмы репликации и стабильного наследования бактериальных репликонов адаптируются к лииейной конформации ДНК, исследованию механизмов эволюции линейных фагов-плазмид и происхождения линейной ДНК у прокариот.

При этом были поставлены следующие основные задачи:

1. Определение полной структуры генома бактериофага N15.

2. Исследование механизмов установления и поддержания лизогенного состояния.

3. Идентификация и анализ механизмов стабильного наследования плазмидного профага.

4. Идентификация и характеристика фермента, обеспечивающего образование ковалентно замкнутых теломер.

5. Идентификация и характеристика генов и сайтов, обеспечивающих репликацию ДНК N15.

6. Создание модели репликации ДНК линейной плазмиды N15.

ОБЗОР ЛИТЕРАТУРЫ

Основной целью настоящей работы является изучение особенностей молекулярной генетики и механизма репликации ДНК бактериофага N15. Поэтому в «Обзоре литературы» основное внимание будет уделено вопросам репликации ДНК у бактерий, в первую очередь репликации плазмид, механизмам сегрегационной стабильности бактериальных плагмид и хромосом, а также результатам исследований молекулярной генетики бактериофага N15, ранее полученным в работах других авторов.

1. Репликация кольцевых бактериальных плазмид.

Плазмиды являются автономно реплицирующимися экстрахромосомиыми элементами. Они были обнаружены в организмах, представляющих все три класса живых существ: Archaea, Bacteria, и Eukarya (Woese et al., 1990). Плазмиды могут содержать существенную долю общей генетической информации организма, которая достигает 25% у некоторых преставителей Archaea (Holmes et al., 1995; Zillig, et al., 1994). Плазмиды могут включать и переносить гены за счет рекомбинации или транспозиции, таким образом способствую генетическому обмену в бактериальных популяциях.

Характерной чертой плазмид является то, что их репликация является автономной и контролируемой. Известны три принципиальных механизма репликации кольцевых плазмид, а именно, тета-механизм, вытеснение цепи и механизм катящегося кольца (RC). История исследований репликации плазмид привела к идеи о том, что тета-репликация чаще встречается в грам-отрицательных бактериях, в то время как RC-репликоны более характерны для грам-положительных бактерий. Впоследствии эта точка зрения не подтвердилась, но, тем не менее, большая часть информации о механизмах тета-репликации получена в результате изучения репликонов грам-отрицательных бактерий, в то время как информация о RC-плазмидах основана на данных, полученных для грам-положительных микробов. Механизм вытеснения цепи характерен для плазмид IncQ семейства.

Как правило, плазмиды содержат так называемый «существенный район», необходимый для их репликации и контроля числа копий, а также гены, которые могут рассматриваться как «несущественные» (ля поддержания плазмиды), - кодирующие функции копъюгативного переноса, устойчивость к антибиотикам и тяжелым металлам, и др. Существенный район плазмид содержит три функциональных элемента: (1) сайт инициации репликации (ori), (2) ген(ы), кодирующие белок(и), участвующие в инициации репликации (обычно называемый Rep), хотя известны и плазмиды, их не имеющие, (3) плазмидные гены, контролирующие репликацию. В случае, если плазмида кодирует Rep белок, то ее ori сайт содержит специфические сайты его связывания.

1.1 Тета-механизм репликации.

Тета-механизм репликации предполагает пероначальное расплетение цепей ДНК, синтез РНК-праймера (pRNA) и инициацию синтеза ДНК путем его расширения (Kornbcrg and Baker, 1992). Синтез ДНК является непрерывным по одной цепи (ведущей) и прерывающимся по отстающей цепи, хотя синтез обеих цепей происходит координировано (см. обзоры Kelman and 0'DonnelI,1995 и Zavitz and Marians 1991). Репликация может инициироваться с одного или нескольких оп-сайтов и быть одно-или двунаправленной. Интермсдиаты, образующиеся в процессе репликации, имеют вид греческой буквы 0, что и дало название этому механизму репликации. Практически все плазмиды, использующие тета-механизм репликации, кодируют собственные Rep белки. Некоторые репликоны могут зависить от бактериальной ДНК-полимеразы I (DNA Poll), необходимой на ранних стадиях инициации синтеза ведущей цепи.

1.1.1. Сайты инициации репликации.

Большинство плазмид, реплицирующихся по тета-механизму, кодирут собственные Rep белки и, соответственно, содержат сайты его связывания в пределах оп-района. Другими характерными чертами оп-сайтов являются (1) наличие АТ-богатого района, в котором происходит первоначальное расплетение нитей и сборка репликационного комплекса, и (2) один или несколько сайтов связываняи бактериального инициаторного белка DnaA (dnaA-сайты) (Bramhill and Kornberg 1988, Kornberg, and Baker 1992). Множественные сайты Dam метилирования присутствуют в сайте инициации репликации хромосомы Е. coli, oriC, а также многих плазмид, например PI (Brendler et a!., 1991ab) и pSClOl (Bramhill and Kornberg. 1988). Сайты инициации репликации могут также содержать сайты связывания бактериальных структурных регуляторных белков IHF (integration host factor) и/или FIS (factor for

Плаз мида Структура оп-сайта PPSIO -i-^m-^-HL

Р1

GtC А*Т гврАРО

Последовательность сайта связывания Rep-белка

GGGmAMQ33GACAGATTCA pSCIOI а*Т о+с

И пFF1PR

ATGTG(T/C)GCTGGAGGGA(A/D(A/G) с> герАРО

А*Т гврАРО

T/C)T(T/C)CCAGATCGTCTTAAATGT

RK2/RP4 . НИ W-*-!-*-!*-!-^ TGACA{G/C)(A/T)TGAGGGG(G/A){G/C)

А+Т G*C enhancer

R6K C=Z>J-ц I-*•!■*"■ A(A/G)(A/C)CATGAG(G/A)GCTTACGT(T/G)

ORIY) A+T

R1

1 2 O-sit*

-//H

A+T "

Py Pu(T/G) TTAAATG feporl

ColE2-type „pAP^AncAP раз

TGAGACCAGATAA-GCCT-TATCAGATAACAGCGCC

C0IE1

RNAU pO О RNAI P ori pa4 • ■

Рисунок 2 . Сайты инициации репликации некоторых плазмид, реплицирующихся по тета-механизму.

Прямоугольники со стрелками, - сайты связывания Rep белка (итероны), светлые стрелки над картами, - инвертированные повторы, имеющие гомологию с итеронами; черные треугольники, - повторы в АТ-богатых районах; светлые прямоугольники под картой, - промоторы; черные прямоугольники, - DnaA сайты; светлые прямоугольники, - IHF сайты; черные кружки, - сайты Dam- метилирования; pas - сайт сборки праймосомы. inversion stimulation). Эти факторы обеспечивают пространственную близость различных компонентов ori-сайта или нескольких оп-сайтов одной плазмиды (напр. R6K). Эти сайты являются существенными компонентами сайта инициации репликации, поскольку они необходимы для правильной сборки репликационного комплекса (Dellis and Filutowicz 1991, Dellis et al., 1992, Stenzel el al., 1991). Сайты связывания структурных белков также присутствуют в oriC сайте Е. co!i (Woelker and Messer 1993). i) Структура oriC сайта и инициация репликации Е. coli

Размер минимального фрагмента, обеспечивающего автономную репликацию хромосомы, составляет 258 нуклеотидов. Этот район содержит сайты связывания инициаторного белка DnaA (DrmA-сайты). АТ-богатую область, содержащую три последовательности длиной в 13 нуклеотидов, включающие сайт Dam - метилирования GATC (Рис. 3). OriC содержит сайты связывания белков IMF и F1S. Оба белка, по-видимому, помогают инициатору DnaA раскручивать ДНК, oriC

А)

13 bp repeats (AT богатый район)

DnaA- сайты

В) С "^ЧЗ-твгв первоначальный комплекс Шсверхелнра птовэнмая

DnaB

Рисунок -Ч . Структура oriC сайта (А) И последовательность событий, приводящих к инициации репликации (В).

Сборка инициаторного комплекса начинается с взаимодействия белка DnaA с DnaA-сайтами, что приводит к образованию компактной эллиптической структуры, содержащей ~20 мономеров DnaA, вокруг которой «обернута» ДНК oriC. На следующем этапе происходит частичное расплетение АТ-богатых 13-нуклеотидных повторов, что приводит к образованию «открытого комплекса». При 37°С и выше DnaA может обеспечивать расплетение ДНК самостоятельно, при более низких температурах требуется участие белков HU или IHF. На следующем этапе в состав открытого комплекса включается ДНК-хеликаза DnaB. Этот белок, взаимодействует с однонитевым расплетенным участком и входит в состав препраймирующего комплекса 1 в виде гексамера, образовавших комплекс с шестью белками DnaC, каждый из которых связывает молекулу АТР. Освобождение DnaC из комплекса происходит в результате гидролиза АТР, следствием чего является активация DnaB. В результате образуется препраймирующий комплекс 2.

На следующем этапе (праймирующий комплекс) DnaB взаимодействует с DnaG-праймазой, которая играет ключевую роль в правильной сборке репликационного комплекса на оп'С. DnaB и DnaG обеспечивают сопряжение функционирования двух рспликативных вилок, движущихся в противоположные стороны. Предполагается, что во время координированной сборки двух репликативных вилок в одной из них синтезируется праймер, который становится затравкой при синтезе ведущей цепи другой рспликативной вилкой, движущейся в противоположном направлении.

При образовании рсплисомы в каждой репликативной вилке происходит АТР-зависимое формирование димерного комплекса холофермента ДНК-полимеразы III, связанного с З'-концами праймеров. Вслед за этим происходит координированная элонгация праймеров, сопровождаемая двунаправленным синтезом ведущих и отстающих цепей ДНК (см. ниже).

И) Плазмидные оп-сайты, содержащие итероны.

Во многих случаях сайты инициации репликации содержат итероны, - прямые повторы последовательности, являющейся сайтом связывания плазмидного Rep белка. Итероны не только необходимы для инициации репликации, но и являются ключевыми элементами контроля частоты инициации (см. обзор del Solar et al., 1998). Итероны присутствуют в ori-сайтах многих плазмид, например: PI (Abeles, et al., 1995), F (Murotsu et al., 1991, Tolun, and Helinski. 1981), pSClOl (Churchward et al., 1983), R6K (Germino, and Bastia 1983ab, Novick, 1987, 1989), Rtsl (Kamio, and Terawaki. 1983), pColIV-КЗО (Pdrcz-Casal, et al., 1989), RK2/RP4 (Pansegrau et al., 1995, Stalker et al., 1981), pCUl (Kozlowski et al., 1987), pSa (Tait et al., 1983), pPSlO (Ferndndez-Tresguerres et al., 1995, Giraldo et al., 1992, Nieto et al., 1992). Отметим, однако, что итероны не являются специфической чертой тета-репликонов, но обнаруживаются также в ori-сайтах плазмид, реплицирующихся по механизму вытеснения цепи или катящегося кольца (Lee et al., 1989, Lin, and Meyerl986, Scholz et al., 1989). Итероны были обнаружены также вне ori-сайтов плазмид PI, F, RK2, R6K, Rtsl, и pCollV-КЗО; эти итероны не требуются для инициации репликации, но играют важную роль в регуляции частоты ее инициации.

Итероны могут располагаться один за другим или находится на определенном расстоянии друг от друга. Обычно это расстояние кратно 11 нуклеотидам (т.е. длине поворота двойной спирали ДНК), что обеспечивает расположение Rep белков вдоль одной линии.

Hi) ori- сайт плазмиды R1.

Инициация репликации плазмиды R1 зависит от кодируемого ею Rep белка. Минимальный ori- сайт (oriR) длиной 188 нт (Masai et al., 1983) включает: DnaA-сайт длиной 9 нт, последовательность длиной около 100 нт, с которой связываются RepA, а также АТ-богатый район. Отметим, что dnaA сайт не является абсолютно необходимым для репликации R1 (Ortega-Jimenez et al., 1992). iii) ori• сайт плазмиды ColEl.

Плазмида ColEl является типичным представителем небольших многокопийных плазмид, реплицирующихся по тета-механизму. В отличие от Rl, ColEl не имеет плазмидного инициатора, но использует бактериальную DNA Poll для инициации репликации. Сайт инициации репликации включает район, обеспечивающий синтез RNA1I, праймера ведущей цепи (Tomizawa et al., 1975, Tomizawa, 1975), последовательности, необходимые для образования комплекса между ДНК и РНК И (Itoh, and Tomizawa 1980, Masukata, and Tomizawa 1990), последовательности, обеспечивающие процессинг этого комплекса РНК-зой Н, образующей 3'-конец, необходимый ля инициациисинтеза лиирующей цепи (Hillenbrand, and Staudenbauer 1982, Itoh, and Tomizawa. 1980), сайт сборки праймосомы pas (ssiA) обеспечивающий связывание DnaB хеликазы и DnaG праймазы ля инициации синтеза отстающей цепи (BOldicke et al., 1981, Masukata.and Tomizawa. 1990, Nomura, and Ray 1980), последовательность терминатора синтеза отстающей цепи, terH (DasGupta et al., 1987, Mindcn and Marians. 1985). Электронно-микроскопический анализ репликативных интермсиатов ColEl показал, что репликация является однонаправленной (DasGupta et al., 1987, Minden and Marians, 1985).

1.1.2. Репликациоппый аппарат E. coli.

Практически все плазмиды используют для своей репликации все или большую часть репликационного аппарата хозяйской клетки. Поэтому первоначально будет рассмотрен аппарат репликации ДНК Е. coli. (см. обзор Benkovitch et al., 2001)

Ключевым компонентом репликационного аппарата Е. coli является холофсрмент ДНК-полимеразы III, состав которого указан в таблице. 1. Холофермент состоит из 10 субъединиц. Минимальный фермент (as0) включает, соответственно, полимеразную единицу, 3'- 5' экзонуклеазу. и вспомогательный пептид. Второй компонент, т - белок, являющийся продуктом гена dnaX, связывает asG субъеиницы с образованием димерной структуры (as0)2T2 . С-концевой домен т- белка обеспечивает связывание альфа-белка и DnaB - хеликазы. Третьим компонентом является у - комплекс, обеспечивающий сборку и димеризацию холофермента ДНК-полимеразы. Комбинация этих трех компонентов приводит к образованию полимеразы, имеющей структуру (as0)2T2 угбб'хч*. обладающего низкой процессивностью в отсутствие Р - субъединицы. Добавление двух р - субъединиц приводит к образованию холофермента ДНК-полимеразы 111, имеющего молекулярную массу около 900кД. Белок «скользящего зажима», Р, представляет собой димер, свободно перемещающийся вдоль ДНК в обеих направлениях. Рентгеноструктурный анализ этого белка показал, что «скользящий зажим» действительно представляет собой кольцо, центральное отверстие которого имеет диаметр 35А, что остаточно для того, чтобы через него проходила двунитевая ДНК.

Наряду с ДНК - полимеразой III, в репликации принимают участие ряд других белков. DnaG праймаза обеспечивает синтез РНК-праймеров, необходимых для репликации отстающей цепи. Этот фермент узнает послеовательности 5'-CTG-3' в однонитевой ДНК и синтезирует праймеры длиной 8-12 нуклеотидов. DnaB является основной хеликазой, обеспечивающая расплетание нитей ДНК. Рентгеноструктурный анализ показал, что гексамеры этого белка образуют кольцевые структуры, движение которых вдоль ДНК, вероятно, и приводит к расплетению нитей. Белок DnaC, обеспечивает взаимодействие хсликазы и праймазы с ДНК, находящейся в комплексе с SSB-белком. SSB-белок образует тетрамерные структуры, связывающиеся с однонитевой ДНК, %- субъединицей холофермента ДНК-полимеразы III, а также DnaG. SSB необьодим для координированного синтеза ведущей и отстающей цепей. Помимо DnaB, DnaG и SSB, для сборки праймосомы необходимы продукты генов dnaC, dnaT (protein i),priA (protein rC),priB (protein n) и priC (protein n'). Последовательная сборка этих семи белков обеспечивает формирование праймосомы, необходимой для синтеза фрагментов Оказаки. Последующее удаление РНК-праймеров осуществляется ДНК-полимеразой I и РНКзой Н, оставшиеся однонитсвые разрывы «зашиваются» ДНК-лигазой.

Во время репликации ДНК ее дочерние синтезирующиеся цепи расходятся из точки репликации, образуя Y-подобную структуру, называемую репликативной вилкой. Модель репликативного комплекса Е. coli представлена на Рис 4. Координированная репликация ведущей и отстающей цепей обеспечивается за счет димерности ДНК-полимеразных комплексов. Один комплекс осуществляет непрерывный синтез ведущей цени ДНК, а второй - синтез фрагментов Оказаки отстающей цепи. В соответствии с этой моделью, ДНК-хеликаза перемещается в репликативной вилке впереди ДНК-полимеразы и расплетает цепи родительской ДНК, причем SSB-белок связывается с образующимися одноцепочечными участками, облегчая процесс расплетения.

Таблица 1. Состав холофермента ДНК- полимеразы III Е. coli.

Субъе Масса Функция Контакты в Примечания диница (кД) субстуктурах а 130 ДНК-полимераза U-E-0 Pol HI (аОе),

8 27.5 3', 5' экзонуклеаза минимальный

0 8.6 активизация экзонуклеазы фермент

X 7.1 Сборка и димеризацию холофермента ДНК-полимеразы,. а-е-0 0еа-у-|-аеО У-У

У 47.5 А'ГФ-зависимое связывание "скользящего зажима" /"\ у-Комплекс. ДНК

5 38.7 вспомогательный белок, \ / зависимая связывается с Р \ / X-5 АТРаза,

5' 36.9 вспомогательный белок, стимулирует АТФ-зную активность у обеспечивает связывание затравки с г 16.6 вспомогательный белок, связывание SSB матрицей, стимулирует

V 15.2 вспомогательный белок ДНК- полимеразу. р 40.6 образование "скользящего зажима" «скользящий зажим» направление движения Ог.а В

Реп лик ационн ая вилка

DnaB *еликэзэ

Праймазэ направление движения реплмкационной вилки направление синтеза ведущей цепи направление синтеза отстающей цепи

SSB

Рисунок 4 . Структура репликационного комплекса Е. coli.

1.1.3. Инициация и элонгация репликации, зависящая от тазмидных Rep белков.

Инициация репликации требует сборки реплика пион но го комплекса в составе холофермента ДНК-лолимеразы Ш. DnaB хеликазы и DnaG праймазы в сайте инициации репликации. Большинство плазмид, реплицирующихся по тета-механизму, требуют кодируемого плазмидой Rep белка и бактериального DnaA для инициации репликации. Плазмидный ori сайт обычно включает не только сайты связывании этих белков, но также и AT- богатый район, содержащий прямые повторы, аналогичные 13 -нуклеотидным элементам в oriC. Этот район обеспечивает локальное расплавление ДНК. Связывание Rep белка с соответствующими последовательностями в ori- сайте приводит к образованию первоначального комплекса, аналогичного образуемому под действием DnaA в oriC. Комплекс Rep-ДНК, в сочетании с DnaA, обеспечивает перенос DtiaB-DnaC комплекса в ori и расплетание АТ-богатого участка. Структурная организация инициаторного комплекса может происходить более эффективно в присутствии бактериальных факторов HU, IHF и F1S. Процесс сборки инициаторного комплекса был исследован для нескольких плазмид. a) Плазмида pSClOl.

RepA, инициаторный белок плазмиды pSClOl, присутствует в клетке в виде мономеров или димеров, соотношение которых определяет эффективность репликации (Ingmer et al., 1995). И мономеры и димеры обладают функциональной активностью, но играют различные роли: в то время как мономеры связываютяс с итеронами в оп-сайте, инициируя репликацию, димеры связываются с соседним сайтом, представляющим собой инвертированный повтор, тем самым репрессируя транскрипцию гена герА (Manen etal., 1992). Помимо RepA, инициация репликации pSClOl требует DnaA и 1HF (Hasunuma, and Sekiguchi 1977, Gamas etal., 1986, Stenzel, et al., 1987). Связывание IHF вызывает изгиб ДНК (Stenzel, et al., 1987), облегчающий взаимодействие между отдельными молекулами DnaA , связанными с DnaA-сайтами (Stenzel, et al., 1991). Связывание RepA с ог/-районом стабилизирует эти контакты (Stenzel, et al., 1991). b) Плазм ида PI.

Репликация фага-плазмиды PI зависит, как ш vivo, так и in vitro, от инициаторного белка RepA (Abeles et al., 1984, Wickner S. and Chattoraj 1987) и бактериального белка DnaA (Hansen, and Yarmolinskyl986, Wickner S. and Chattoraj 1987). Образование инициаторного комплекса происходит при участии мономерных форм RepA (Wickner et al., 1991), связывание которых с ДНК стимулируется шаперонами теплового шока. Эти белки способствуют диссоциации димеров RepA на мономеры, которые связываются с 5 итеронами в о/7-сайте (DasGupta et al., 1993, Wickner et al., 1991). Однако, имеются данные о том, что шапероны необходимы ял активации мономеров RepA (Chattoraj et al., 1996, Dibbens et al., 1997, Pak and Wickner 1997). Один RepA не обеспечивает локальное расплавление ДНК, которое вызывается или стимулируется DnaA, который также стимулирует ДНК-связывающую активность RepA (Mukhopadhyay et al., 1996). Ori- сайт PI содержит 5 сайтов DnaA, хотя одного сайта достаточно для инициации репликации (Abeles et al., 1990, Brendler et al, 199lab), локальное расплавление ДНК наиболее эффективно, если присутствуют все сайты. Ориентация DnaA-сэйтов предполагает, что DnaA-зависимое связывание DnaB преимущественно происходит на одной цепи ДНК, что может являться причиной однонаправленности репликации ДНК PI (Mukhopadhyay et al., 1993). Эффективная репликация PI требует также метилирования пяти GATC сайтов, присутствующих в ori-районе. Эти GATC сайты представляют собой гептамерный повтор, отделенный от сайта связывания RepA GC-богатым спейсером (Abeles and Austin 1987, 1988, Brendler eta!.,, 1995). c) Плазмида RK2.

Кодируемый плазмидой инициаторный белок TrfA (Konieczny et al., 1997) связывается с пятью 17-нуклеотидными итеронами. Это взаимодействие вызывает локальное расплавление ДНК в районе АТ-богатого участка. Связывание DnaA с четырьмя сайтами, присутствующими в этом районе, также требуется для инициации репликации. DnaA и TrfA необходимы для связывания DnaB с ori-сайтом. d) Плазмида R1.

Репликация плазмиды R1 in vivo и in vitro зависит от инициаторного белка, RepA (Diaz et al., 1981, Kollck et al., 1987, Masai et al., 1987, Uhlin and NordstrSm 1978). В отличие от описанных выше случаев, oriR не содержит итеронов. RepA, вероятно в форме димера, связывается с двумя палиндромными последовательностями (Giraldo, and Diaz. 1992). После образования первичного комплекса repA-oriR, дополнительные молекулы RepA связываются с участком между этими палинромами, что приводит к расплавлению АТ-богатого участка (Masai and Arai 1988.). Репликация ДНК R1 in vitro требует участия DnaA (Masai and Arai. 1987, Ortega-Jimdnez et al., 1992), однако DnaA не является необходимым in vivo (Bernander et al., 1991, Tang et al., 1989). Репликация in vivo в отсутствие DnaA является низкоэффективной, однако, мутанты с повышенным уровнем экспрессии герА реплицируются более эффективно (Bernander et al., 1991). Эти результаты свидетельствуют о важной роли RepA в активации ori- сайта и позволяют предположить, что RepA обеспечивает локальное расплавление ДНК и связывание DnaB-DnaC-комплекса.

1.1.4 Репликация фага-плазмиды Р4.

Репликационный белок альфа фага-плазмиды Р4 обеспечивает двунаправленную тета-репликацию его ДНК, инициируемую на сайте oril (Krevolin et al., 1985). Другной сайт, err, располдоженный на расстоянии примерно 4500 нт от oril, необходим in cis для репликации ДНК Р4 (Flensburg and Calendar, 1987; Tocchetti et al., 1999). Репликация зависит как от фаговых, так и от бактериальных генов. Для элонгации необходимы бактериальные белки SSB и ДНК-полимераза Ш, в то время как инициаторные белки DnaA, а также хеликаза DnaB, белок DnaC, праймаза DnaG, а также вспомогательная хеликаза Rep Е. coli, не требуются (Lindqvist and Six, 1971; Barrett et al., 1972; Bowden et al., 1975; Krevolin and Calendar, 1985; Diaz Orejas el al., 1994). Все эти функции обеспечиваются продуктом фагового гена a (Flensburg and Calendar, 1987; Ziegelin el al., 1993). Альфа-белок, длиной 111 аминокислот, содержит несколько функциональных доменов: (1) N-концевой домен обладает праймазной активностью. Этот район содержит консервативный мотив EGYATA, характерный для многих праймаз конъюгативных плазмид (Strack el al., 1992; Ziegelin el al., 1993). Будучи изолированным, этот домен сохраняет праймазную активность и может комплементировать мутацию в праймазном домене альфа-белка (Ziegelin el al., 1995). (2) Середина и С-концевой район альфа-белка обладают хеликазной активностью и содержат мотив, характерный для связывания нуклеотидов типа A (Strack et «/.,1992; Ziegelin el al., 1995, 1997b). (3) С- концевой фрагмент альфа- белка обладает ДНК-связывающей активностью (Ziegelin et al., 1995). Белок связывается с декамерными последовательностями, присутствующими в oril и err сайтах.

Сайт инициации репликации oril состоит из двух частей: собственно oril и err сайта. Оба этих сайта содержат несколько прямых и инвертированных повторов декамерной последовательности (GGTGAACAGA/T), итеронов типа I, с которыми связывается альфа-белок (Krevolin et «/.,1985; Flensburg and Calendar, 1987; Ziegelin et al., 1993; Tocchetti et al., 1998). Более того, оба сайта содержат АТ-богатые участки. С помощью комплсментационного теста было установлено, что минимальный сайт oril включает район длиной 123 нт, содержащий шесть итеронов 1 типа (Tocchetti et al., 1999).

Эти итероны также присутствуют в err, альфа белок связывается с ними, но инициация репликации с этого сайта не наблюдалась ни in vivo, ни in vitro (Krevolin et al., 1985; Diaz Orejas et al., 1994). Crr включает два АТ-богатых повтора длиной 123 нуклеотида, каждый из которых содержит пять итеронов типа 1. Отсутствие одного из повторов снижает эффективность репликации тв 10 раз (Flensburg and Calendar, 1987; Tocchetti et al., 1999). В геноме P4 oril и crr находятся на расстоянии 4500 нт друг от друга, но это расстояние может быть сокращено до 100 нт без нарушения репликации (Flensburg and Calendar, 1987). Однако, относительная ориентация этих элементов существенна (Christian, 1990).

Во многих случаях было показано, что Rep белки связываются с несколькими сайтами, что вызывает образование петель на ДНК или межмолекулярные взаимодействия за счет белок-белковых взаимодействий (del Solar, 1998). Формирование подобных комплексов (handcuffing; McEachern et al., 1989) может ингибировать репликацию и контролировать число копий плазмиды. Взаимодействие альфа-белков, связанных с oril и err, наблюдалось in vitro (Ziegelin et al., 1993; Ziegelin and Lanka, 1995). Однако, в отличие от описанной выше ситуации, err играет позитивную роль в инициации репликации.

Эксперименты, имеющие целью локализовать cis - и trans- действующие факторы, существенные для репликации Р4, привели к идентификации второго репликона в геноме Р4 (Tocchetti etal., 1998). Второй репликон, orill, также зависит от альфа-белка, но состоит из двух компонентов - ori2 и err сайтов. Сайт ori2 расположен внутри гена, кодирующего альфа-белок, примерно на границе праймазного и хеликазного доменов (Ziegelin et al., 1993; Tocchetti et al., 1999). Это позволяет предположить, что многофункциональный альфа-белок является результатом слияния двух генов, кодирующих праймазу и хеликазу, разделенный сайтом инициации репликации. Множественные сайты инициации репликации были описаны в различных прокариотических репликонах, например, плазхмиде R6K и фаге Т7 (Crosa, 1980; lnuzuka et al., 1980; Tamanoi et al., 1980). Обычно, основной оп'-сайт обеспечивает более чем 90% случаев инициации репликации, в то время как вспомогательный ori не функционирует. Это справедливо также и для Р4, в котором вторичный оп-сайт становится активным только в отсутствие oril. Как праймазная, так и хеликазная активности альфа-белка требуются для репликации с orill. ori2 не содержит итеронов типа 1 и не связывает альфа-белок. Более того, в ог/2 отсутствуют сайты связывания DnaA. Это предполагает, что репликация, инициируемая с oril и orill, может происходить по различным механизмам.

1.2 Репликация по механизму вытеснения цепи (Strand Displacement Replication).

Наиболее хорошо изученным примером плазмид, реплицирующейся по механизму вытеснения цепи, являются плазмиды семейства IncQ, прототипом которого является RSF1010. Репликация ее ДНК требует трех кодируемых плазмидой белков (Scherzinger et al., 1991, Sakai and Komano 1996).

1.2.1 Сайт инициации репликации.

Сайт инициации репликации RSF1010 был определен как минимальный район, обеспечивающий двунаправленную репликацию репликацию плазмиды в случае, если репликационные белки (RepA, RepB, и RepC) экспрессируются in trans (Scherzinger et al., 1991). Этот район содержит точку инициации репликации, в соответствие с результатами электронно-микроскопического анализа репликативных интермедиатов, как in vivo, так и in vitro (de Graaff et al., 1978, Scherzinger et al., 1991). Минимальный оп-район содержит три итерона длиной 20 нуклеотидов, район длиной 174 нт, содержащий G/C-райои длиной 28нт и АТ-богатый участок длиной 31 нт. Помимо этих элементов, ori содержит два небольших палиндрома, содержащих сайты ssiA и ssiB. Итероны являются сайтами связывания RepC ( Haring and Scherzinger 1989, Haring et al\., 1985). Ssi - сайты специфически узнаются праймазой RepB, инициирующей непрерывную репликацию с этих сайтов (Higashi et al., 1994, Honda etal., 1989, 1991).

1.2.2. Rep- белки.

Как было отмечено выше, репликация RSF1010 обеспечивается совместным действием трех кодируемых плазмидой белков, RepA, RepB, RepC, обладающими, соответственно, активностями ДНК-хеликазы, праймазы и связывания с ori-сайтом (Haring and Scherzinger 1989, Sakai and Komano 1996). RepC, - димер, состоящий из двух 31кД субъединиц, специфически взаимодействует с итеронами в ori-сайте (Haring and Scherzinger 1989, Haring et al., 1985) и, вероятно, с RepA (Honda et al., 1991, Scherzinger et al., 1991, Tanaka et al., 1994). RepA является гексамером (субъединицы ЗОкД) и обладает активностями оц-ДНК-зависимой АТФазы и ДНК-хеликазы. Белок RepB обладает праймазной активностью.

RepC

RepB 4

G+C A+T

Herons

SSiA -<— ssiff w

RepC

RepA 3

Рисунок 5. Механизм репликации плазмиды RSF1010. a) Структура сайта инициации репликации. b) Модель инициации репликации RSF1010.

1.2.3 Механизм репликации.

Репликация плазмиды RSF1010 не зависит от бактериальных белков DnaA, DnaB, DnaC, и DnaG, функции которых выполняются плазмидгыми RepA, RepB, и RepC белками (Frey and Bagdasarian 1989, Haring and Scherzingerl989). Репликация инициируется на сверхспирализованной матрице (Diaz, and Staudenbauer 1982, Scherzinger et al., 1991). ДНК-полимераза Ш и SSB необходимы для репликации. Общая схема репликации, предложенная в работе (Scherzinger et al., 1991), приведена на Рис. 5. Первым этапом является связывание RepC с итеронами с сайте инициации репликации.

RepA хеликаза связывается с L- цепью (цепь ДНК, содержащая 10 из 11 генов RDF1010), перемещается в направлении 5*-3\ локально расплавляет ДНК и активирует ssi-сайты (Scholz et al., 1989). В альтернативной модели, связывание RepC с итернами активирует ssi-сайты. На следующем этапе праймаза RepB связывается с ssi, что приводит к сборке репликационного комплекса и старту репликации (Miao et al., 1993). Репликация на каждом из ssi сайтов инициируется независимо и происходит непрерывно, вследствие того, что RepA вытесняет нереплицированную материнскую нить. Хеликазная активность RepA необходима в ходе элонгации и этот белок не может замещаться бактериальной хеликазой DnaB. Конечными продуктами репликации являются одноцепочечное вытесненное кольцо и двунитевая кольцевая молекула. Сайты ssi затем используются для синтеза комплиментарной нити, в результате чего одноцепочечная кольцевая молекула преобразуется в двунитевую форму, что завершает репликацию.

1.2 Репликация по механизму катящегося кольца.

Репликация по механизму катящегося кольца является однонаправленной и по своей природе ассимметричной, поскольку синтез ведущей и отстающей цепей происходят независимо (см. обзоры del Solar et al., 1993, Espinosa et al., 1995, Gruss and Ehrlich 1989., Khan, 1996, 1997, Novick, 1989). Характерной чертой этого механизма репликации является то, что новая реплицированная ведущая цепь остается ковалентно связанной с той же родительской цепью.

Существующая модель репликации по механизму катящегося кольца включает несколько этапов (Рис. 6). Репликация инициируется кодируемым плазмидой Rep-белком, который вносит однонитевой разрыв в (+) нить, в районе, называемом double-stranded origin (dso). Образующийся З'-ОН конец используется как праймер для инициации синтеза ведущей цепи, который протекает при участии бактериальных белков (как минимум, ДНК-полимеразы Ш, SSB и хеликазы). Элонгация начиная с 3-ОН конца, сопровождающаяся вытеснением родительской (+) цепи, продолжается до тех пор, пока реплисома не достигнет dso-сайта. В этот момент Rep белок выполняет реакцию разрыва и соединения цепей, в результате чего освобождается однонитевая кольцевая молекула и двунитевая дочерняя молекула ДНК. В отличие от механизма вытеснения цепи, репликация по механизму катящегося кольца приводит к тому, что только одна цепь ДНК присутствует в составе однонитевого интермедиата (Gruss and Ehrlich 1989, te Riele et al., 1986). На завершающей стадии родительская однонитевая молекула преобразуется в двухцепочечную форму бактериальными белками, инициирующими репликацию в районе, называемом single-strand origin (550), физически отличном от dso. п О к. >ч о> <1 о

Pol 111

Helicose.SSB

Rep

Pi

Poll sso

Pol III P a < z сс sso

Рисунок 6. Модель репликации по механизму катящегося кольца. Новая синтезированная цепь показана пунктирной линией.

2. Механизмы сегрегационной стабильности бактериальных плазмид.

Правильное распределение реплицированных хромосом между дочерними клетками перед делением (partitioning) является жизненно важным процессом для бактериальной клетки. Первая модель этого процесса была предложена Жакобом (Jacob et al. 1963) как часть «гипотезы репликона». Эта модель предполагала, что хромосомы присоединяются к определенным точкам клеточной оболочки таким образом, что рост клетки «растаскивает» реплицированные хромосомы. Однако, открытие класса мутантов Escherichia coli, репликация которых протекает нормально, а сегрегация хромомосом нарушена, предполагает существование активного механизма сегрегации хромосом (Hiraga, 1992).

В то время как для высококопийных плазмид даже случайное распределение между дочерними клетками практически исключает образование бесплазмидных клеток (если число копий плазмиды равно п, то скорость ее потери на генерацию составит 1 / 2"), стабильное наследование низкокопийных плазмид требует особых механизмов. Известны два таких принципиальных механизма: активное распределение реплицированных молекул между дочерними клетками при делении (сегрегационная стабильность, = partitioning) и пост-сегрегационный киллинг дочерних клеток, не содержащих плазмиду. Последний механизм (Gerdes et al., 1997) основан на коэкспрессии двух генов, содержащихся на плазмиде, - стабильного токсина и нестабильного антитоксина. Не получившая плазмиду дочерняя клетка в этом случае будет инактивирована токсином. Этот механизм менее выгоден для популяции, чем сегрегационная стабильность, и, как правило, является вспомогательным. Так, плазмиды PI и F, наследование которых обеспечивается за счет механизма сегрегационной стабильности, используют пост-сегрегационный киллинг как "дополнительный контроль", исключающий образование бесплазмидных клеток в случае если основной механизм по каким то причинам не сработал. В этой части обзора литературы будут рассмотрены общие принципы функционирования механизма сегрегационной стабильности низкокопийных плазмид.

2.1 Бактериофаги PI и Р7.

Наиболее хорошо изученным примером системы сегрегационной стабильности является par системы бактериофагов Р1 и Р7. Эти фаги являются родственными, содержат протяженные участки гомологии (см. Yun and Yanpnek, 1977 ), а в лизогенном состоянии не интегрируются в хромосому Е. coli, а представляют собой кольцевые низкокопийные плазмиды. Все компоненеты системы сегрегационной стабильности локализованы в одном локусе, par (Austin and Abeles, 1983a,b; Ludtke et al., 1989). Этот локус включает авторегулируемый оперон, состоящий из двух генов, рагА и parB, а также слу-действующий сайт parS, следующий за геном рагВ. Структура par локуса показана на Рис.7.

С/з-активный сайт, parS, является сайтом связывания ParB. ParS и сайты связывания ParB/SopB белков в других плазмидах расматриваются как «центромеро-подобные», поскольку они являются сайтами, связываясь с которыми белки аппарата сегрегационной стабильности осуществляют транспорт плазмид, т.е. их функция аналогична функции центромер в митозе эукариот. РагВ и возможно РагА в этом случае являются «мостиками», связывающими плазмидную ДНК и клеточный транспортный аппарат.

Бактериофаг Р1

Плазмида RK2

AUC U.п

ШЛ -ЕЯ-—НЕГ" i—Tof-М—й

WUB Ш !фТО

Плазмида R761 оС=Н „ IG-LKHZE

IH О b kfrA vpfUJ J

1'J t]

12

Рисунок 7. Сравнение локусов сегрегационной стабильности плазмид F, RK2, R751 и бактериофага Р1.

Гомологи par А выделены светло-серым, гомологи рагВ - темно серым. Для Р1 и F структура сайтов связывания ParB/SopB показана более подробна: черные стрелки указывают повторы, а прямоугольники - сайты связывания IHF. Сайты связывания КогВ в RK2 и R751 показаны как серые кружки.

ParS включает два типа последовательностей, узнаваемых ParB (Davis et al., 1990), расположенных по обеим сторонам сайта связывания IHF. Основная последовательность, обеспечивающая связывание РагВ, - это гептамер (atttcac), казываемый Бокс А. Имеются четыре копии бокса А, два из которых образуют инвертированный повтор в правой половипе parS, - минимальную последовательность, необходимую для связывания ParB (Martin et al., 1991). Второй послеовательностью, участвующей в связывании РагВ, является гептамер (tcgcca), называемый Боксом В (Davis et al., 1990). Связывание IHF с parS вызывает изгиб ДНК, центр которого находится в сайте связывания IHF. Этот изгиб способствует специфическому свзыванию РагВ с parS (Davis and Austin, 1988; Funnell, 1988b, 1991; Funnell and Gagnier, 1993).Эксперименты по задержке в геле показали, что комплекс, образующийся у parS, включает IFH и димер ParB (Bouet et al., 2000).

Белок РагА обладает АТФ-зной активностью и выполняет две функции: во-первых, он репрессирует промотор par оперона и, во-вторых, является компонентом собственно механизма сегрегационной стабильности (Davis et al., 1992 Friedman and Austin, 1988, Davis et al., 1996). РагА образуют димеры, связываясь с ATP или ADP. Описана точечная мутация в РагА, не влияющую на репрессию промотора par оперона, но нарушающую стабильность высококопийной плазмиды, содержащей parS (Youngren and Austin, 1997). Анализ свойств этого мутанта позволил выдвинуть гипотезу о образовании после репликации ориентированных пар плазмид, которые разделяются и траипортируются к противоположным концам делящейся клетки. Если контакт между плазмидами осуществляется в parS сайтах, а функция РагА состоит в разделении пар, то описанная мутация, нарушающая эту функцию, фактически приведет к снижению эффективного числа копий плазмиды вдвое.

Второй важной функцией РагА является регуляция экспрессии par оперона, что обеспечивает контролируемую продукцию Par белков. Повышенный уровень их экспресии нарушает работу механизма снгрегационной стабильности (Funnell, 1988а Hayes et al., 1994). РагА репрессирует транскрипцию, связываясь с районом, прекрывающим промотором оперона (Abeles et al., 1985), а именно, участком длиной около 140 нт, центром которого является АТ-богатый палиндром длиной 42 нт (Davis et al., 1992). Аналогичным образом соответствующий промотор репрессирует РагА белок фага Р7. РагА белки содержат ДНК-связывающий helix-turn-helix мотив в N-концевом участке (аминокислоты 43-62 в PI и 44-63 в Р7), замена этого мотива в ParA Р1 на эквивалентный мотив из ParA Р7 приводит к смене специфичности репрессии промотора (Hayes et al., 1994 ).

2.2 Плазмида F.

F- фактор является низкокопийной конъюгативной плахмидой, кодирующей собственный механизм сегрегеционной стабильности, или sop- систему. Sop локус включает два гена, sopA и sopB, а также с/5-действующий сайт, sopC.

Как и ParA, SopA принимает участие как в регуляции экспрессии оперона, так и в работе собственно механизма сегрегационной стабильности. SopA связывается с четырьмя последовательностями CTTTGC, перекрывающими промотор, и, тем самым, репрессирует его (Mori et al., 1989 ). Уровень репрессии возрастает в присутствие SopB, и дополнительно возрастает в присутствие sopC (Yates et al., 1999).

Структура центромерного сайта sopC существенно отличается от структуры parS. SopB связывается с двенадцатью прямыми повторами последовательности длиной 43 нт, составляющими sopC (Hayakawa et al; Mori et al., 1986, 1989; Lane et al., 1987; Watanabe et al., 1989). Однако, одна единица обеспечивает уровень стабильности плазмиды, эквивалентный обеспечиваемому целым sopC. Эта 43-нт единица включает инвертированный повтор длиной 7+7 нуклеотидов, разделенных двумя нуклеотидами и зеркальный повтор 9+9 нуклеотидов, разделенный одним нуклеотидом. Связывание SopB не требует участия IHF (Ogura et al., 1990), что согласуется с отсутствием соответствующего сайта в sopC.

Длина (т.п.н.) 1

P"J Рая i ж ж ж ж репрессия транскрипции связывание с центромерой

I I

F Рав репрессия транскрипции связывание с центромерой 1

R1 \ Ж Ж * * Ж * Ж 1 > рагМ parR

Pmr

I w репрессия связывание с центромерой

Рисунок 8. Организация sop оперонов плазмид PI, F и R1. Заштрихованый прямоугольник - транскрипт; Черные прямоугольники, элементарные единицы центромерных сайтов.

2.3 Плазмида R1.

Par локус плазмиды R1 является аналогом, но не гомологом par/sop лоуксов F и Р1. В этом случае центромерный рагС сайт расположен не после оперона, состоящего из геноъ рагМ и parR, а перед ним (Dam and Gerdes, 1994, Gerdes and Molin 1986) .parC сайт также содержит и промотор оперона, перекрывающийся двумя итеронами, с которыми связывается ParR. (Jensen R.B. et al., 1998; Breuner et al., 1996; Jensen et al., 1994). Связывание ParR с итеронами необходимо как для репрессии, так и собственно для работы механизма сегрегационной стабильности. РагМ обладает АТФазной активностью, которая необходима для работы par-системы (Jensen and Gerdes, 1997). В отличие от SopA/ParA, РагМ не принимает участие в регуляции активности par промотора. Центромсрный сайт рагС включает 10 итеронов длиной 11 нт, фланкирующих промоторный участок; все десять сайтов необходимы для работы механизма сегрегационной стабильности R1. Было установлено, что образование сегрегационного комплекса у рагС приводит к образованию пар плазмид, контактирующих в районе этих сайтов.

2.4 Внутриклеточная локализация плазмид.

Использование флуоресцентных зондов для изучения внутриклеточной локализации плазмид в последние годы существенно облегчило анализ механизмов сегрегационной стабильности плазмид и хромосом. Было установлено, что перемещение новой реплицированной ДНК является не пассивным процессом, связанным с увеличением клеточной стенки, а активным и достаточно быстрым (относительно периода клеточного цикла) процессом (Sharpe and Errington, 1999, Jensen and Shapiro, 1999).

Внутриклеточная локализация плазмид F и PI в живых клетках была исследована с помощью флуоресцентного белка GFP. Для этого в геном плазмид был интегрирован lac- оператор, с которым связывался гибридный белок GFP-lacI, экспрессируемый в той же клетке (Gordon et al., 1997, Jensen and Gerdes, 1999). Аналогичные паттерны внутриклеточной локализации плазмид были выявлены в экспериментах с использованием fluorescent in situ hybridisation (FISH) (Niki and Hiraga, 1997). Пример визуализации плазмиды F с помощью FISH приведен на Рис. 9.

Правильная внутриклеточная локализация плазмиды F зависит от функционирования sop - системы (Niki and Hiraga, 1997). В клетках, содержащих одну F или Р1 плазмиду, флуоресцентный сигнал локализуется в районе центра клетки, в то время как в клетках, содержащих две плазмиды (результат репликации), они расположены в положениях V* и V* по длине клетки. Таким образом, можно предположить, что плазмиды реплицируются в центре клетки, а затем транспортируются в положения положениях % и V* , т.е. в центры будущих дочерних клеток, где они и находятся до завершения клеточного деления. Отсутствие флуоресцентных фокусов в других положениях свидетельствует о том, что этот перенос протекает достаточно быстро по сравнению с длительностью клеточного цикла, что предполагает активный транспорт плазмид.

Также была исследована внутриклеточная локализация Sop В и РагВ (Erdmann el al 1999, Kim and Wang, 1998). Гибридный белок SopB-GFP локализуется в положениях Щ и Ул, что позволяет предположить, что именно он обуславливает аналогичную внутриклеточную локализацию sopC- содержащей плазмиды. Аналогичным образом было установлено, что РагВ локализуется в положениях % и образование точечного фокуса за виси ло от присутствия parS, в то время как его правильное положение зависело также и от Pa г A (Erdmann et а! 1999).

Caulobacter crescentis

Рисунок 9 . Внутриклеточная локализация плазмиды F и хромосомной Д! !К. I и II - состояния до и после инициации репликации. В случае бактериальных хромосом использовано два различных флуоресцентных зонда, гибридизующихся с районом ori-сайта (О) и районом терминации репликации (Т). Рисунок взят из работы (Moller-Jensen et at., 2000) и модифицирован для воспроизведения в черно-белом виде.

2.4 Модель функционирования механизма сегрегационной стабильности.

Полученные в последние годы результаты (Niki and Hiraga, 1997, 1999; Jensen et al., 1998; Jensen and Gerdes 1997) свидетельствуют в пользу следующей модели функционирования механизма сегрегационной стабильности (Рис. 10, Moller-Jensen et al., 2000), принципиально аналогичной митозу у эукариот. Репликация плазмид, локализованных в районе центра клетки сопровождается формированием сегрегационных комплексов; реплицированные молекулы плазмид образуют пары за счет взаимодействия сегрегационных комплексов, связанных с их центромерами. После завершения репликации происходит разделение пар (в случае плазмиды F эту функцию, вероятно, выполняет SopA) и активный транспорт плазмид под действием неидентифицированных в настоящее время клеточных факторов. Образование пар плазмидами R1 in vitro зависит от белков ParR и ParM (Jensen et al., 1998). Следовательно, сборка сегрегационнго комплекса является необходимым предварительным условием для последующей работы гипотетического митотического аппарата. Колокализация плазмид и белков, связывающихся с центромерами (РагВ, SopB и ParM of R1) предполагает, что эти белки связывают транспортированные плазмиды со специфическими клеточными структурами, сохраняя их в определенной позиции до завершения клеточного деления.

Сегрегация хромосом является более сложным процессом. Флуоресцентная детекция хромосомной ДНК показала, что реплицированные ori- сайты быстро разделяются за счет движения к противоположным полюсам клетки. Это согласуется с тем, что хромосомные аналоги sop/par семейства специфически связываются с последовательностями, расположенными вблизи ori-сайтов. Будучи клонированными в плазмидах, хромосомные и плазмидные sop/par системы работают одинаково эффективно. Поэтому вероятно, что плазмидные и хромосомные sop/par системы, могут функционировать сходным образом, т.е. может происходить образование спаренных oriC- районов, которые затем разделяются и транспортируются к противоположным полюсам.

Moller-Jensen и соавторы (2000) предложили следующую модель сегрегации бактериальных хромосом. В только что образовавшейся клетке oriC перемещается к центру клетки, где происходит сборка реплисомы. После инициации репликации центромероподобные районы около or/'-сайта, совместно с sop/par « митотическим» аппаратом. а) плазмида бактериальная (слегка сегрегационный комплекс кепписома репликация сегрегация ппазшщ О кпеючное деление

I И I jсегрегация oriC конденсация демосом платочное деление

Ш1Ш ртчц® »" ftAtTnfUiifjijy

Рисунок. Ю. Модель сегрегации плазмид и хромосом прокариот (Moller-Jensen et al.,

2000).

Позднее, одновременно с репликацией, oriC активно транспортируется к полюсам клетки, к которым затем прикрепляются. Последовательная конденсация синтезированной ДНК обеспечивает двунаправленный перенос хромосомы но направлению к полюсам клетки. Эта модель является некоторым упрощением реальной ситуации, поскольку она не принимает во внимание наличие нескольких репликационных вилок в быстро растущей бактериальной культуре. Более того, последствия отсутствия par/sop гомологов в некоторых бактериальных геномах (например, Е. coli) требуют дальнейшего изучения.

Origin

3. Особенности генетики бактериофага N15.

Бактериофаг N15 был выделен и описан В.К. Равиным в 1964 г (Голуб и Равин, 1967). Фаг N15 имеет линейную двунитевую ДНК молекулярной массой 30 МД, частота лизогенизации около 50%, урожай фага около 100, латентный период 45 мин (Равин, 1971). Бактериофаги N15 и лямбда имеют схожую структуру вириона, около 50% ДНК N15 гибридизуется с ДНК фага лямбда (Ravin and Shulga, 1970). На основании этого N15 был отнесен к семейству лямбдоидных фагов.

Лизогенные по фагу N15 бактерии также устойчивы к фагам Т1 и phi80 (лизогенная конверсия), (Голуб и Равин, 1967). Ген cor, ответственный за конверсию, впоследствии был локализован на физической карте фаговой ДНК (Малинин и др., 1993; Vostrov et al., 1996).

Как было показано В.К. Равиным и сотрудниками в 1967-70 гг, уникальной особенностью N15 является то, что в лизогенном состоянии он не интегрируется в хромосому, а представляет собой автономно реплицирующуюся плазмиду. Этот вывод был основан на трех фактах, суммированных в работе (Ravin and Shulga, 1970).

1. Были получены температурно чувствительные мутанты фага N15, которые можно разделить на два класса: "ранние" и "поздние" (Равин и Шульга, 1968). У "ранних" мутантов при непермиссивной температуре блокирована репликация ДНК. Было установлено, что в этих условиях лизогенные бактерии теряют профаг (Равин, 1968).

2. Результаты бактериальных кроссов показывают отсутствие профага в хромосоме лизогенных клеток (Равин, 1972).

3. Бактериальная и фаговая ДНК могут быть разделены при центрифугировании препарата ДНК из лизогенной по фагу N15 культуры в сахарозном градиенте (Ravin and Shulga, 1970).

Следующий важный шаг в изучении генетики фага N15 был сделан проф. В.Н. Рыбчиным и сотрудниками, которые показали, что профаг N15 представляет собой линейную плазмиду с ковалентно замкнутыми концами (теломерами). Вывод о линейности профага N15 был сделан на основе физического картирования ДНК фага и профага, которое показало, что (1) обе молекулы ДНК линейны и имеют длину 46.3 тпн и (2) рестрикциопная карта профага является результатом циклической пермутации карты фага (Сварчевский и Рыбчин, 1984b).

Концы профага N15 (теломеры), назвываемые telL и telR, представляют собой шпилечные структуры, т.е. две нити ДНК ковалентно связаны однонитевыми участками. Шпилечная структура теломер профага N15 была установлена (Сварчевский и Рыбчин, 1984b) в результате двух экспериментов: (1) концевые, но не внутренние рестрикционные фрагменты могут быстро ренатурировать после тепловой денатурации и быстрого охлаждения, (2) обработка плазминой ДНК нуклеазой S1, разрезающей однонитевую ДНК, перед рестрикцией, нарушает способность концевых фрагментов к быстрой ренатурации. Кроме того, при электрофорезе в денатурирующих условиях видимые длины концевых рестрикционных фрагментов удваиваются (Малинин и др., 1992а).

В работах (Малинин и др., 1992а, 1992b) были определены нуклеотидные последовательности концевых районов профага и соответствующего неразрезанного сайта в фаговой ДНК, telRL, предсавляющего собой палиндром длиной 56 н. Схема образования плазмидной ДНК из фаговой, впервые предложенная в работе (Малинин и др., 1992а), показана на Рис.11. После проникновения фаговой ДНК в клетку она замыкается в кольцо по когезивным концам, однонитевые разрывы зашиваются ДНК-лигазой. Затем гипотетический фаговый фермент, впоследствие названный протеломеразой (прокариотическая теломераза), вносит ступенчатый разрыв в фаговой ДНК в области telRL. Отжиг концевых однонитевых участков, имеющих внутреннюю комплементарность и последующее соединение фосфодиэфирных связей приводит к образованию ковалентно замкнутых теломер.

Некоторые свойства плазмиды N15 были охарактеризованы в работе (Сварчевский и Рыбчин, 1984а). Так, было установлено, что плазмида N15 является низкокопийной и стабильно наследуемой, - частота ее спонтанной потери не превышает 10"4 на генерацию. N15 совместим с плазмидами, представляющими различные группы несовместимости: PI, pBR322, F- фактором. Было установлено, что плазмида N15 поддерживается в штаммах Е. coli, содержащих мутации в генах герА и polA. В работе (Tilly, 1991) было показано, что ни литическое развитие N15, ни поддержание плазмиды, не зависят от мутаций в генах теплового шока dnaJ, dnaK, и grpE.

Было показано, что профаг N15 индуцируется под действием ультрафиолета в лизогенном штамме Е. coli С (N15) (Равин, 1972), но не в лизогенных штаммах-производных Е. coli К12 (штаммы К802 и М7010, Сварчевский и Рыбчин, 1984а). cosL -С. циркуляризация telRL cosR I фаговая ДНК тс*ос]цзизитаотсаттм>сосдсотАТАМоо»я*ттотзтастом>--AIAOTCTTCTCTiaACS3GIART»TeCSCSC]gMTlVXTSiaWCAC»CGACTMtelRL telL о разрезание telRL сайта протеломеразой и образование ковалентно замкнутых тел о мер -—ДНК линейного профага telL

GCGTATAATGGACTATTGTGTGCTGATA— О telR

CGCATATTACCTGATAACACACGACTAT--------^ ^ ^

---TATCAGCACACAATTGCCCATTATACGC

ATAGTCGTGTGTTAACGGGTAATATGCQ ✓

Рисунок 11 . Преобразование фаговой ДНК в линейную плазмиду после инфекции. cosL, cosR, - однонитевые когезивные концы, cosRL, cos сайт после замыкания и лигирования; telRL, сайт действия протеломеразы; telL and telR, левая и правая шпилечные теломеры профага, образуемые при помощи протеломеразы.

Сварчевский и Рыбчин предположили, что репрессор литических функций N15 может быть устойчив к ReeA-зависимому расщеплению в штамме Е. coli К12. Отметим, что низкий уровень спонтанной индукции N15 наблюдается и в гесА" штаммах, что свидетельствует о существовании гесА-независимого пути индукции, описанного для фага лямбда (Rozanov et al., 1998).

Районы генома N15, существенные для поддержания плазмидного состояния были идентифицированы посредством конструирования миниплазмид (Сварчевский, 1986; Востров и др. 1992). Примерно 70% ДНК в центральной части генома линейного плазмидного профага может быть делетировано без нарушения функций репликации и поддержания плазмиды. Минимальный полазмидный репликон, расположенный в пределах фрагмента длиной 5.2 тпн (координаты 4.1-9.3 тпн по карте плазмиды) обеспечивал репликацию кольцевой миниплазмиды (Сварчевский, 1986).

Санькова и др (1992) локализовали районы в геноме N15, существенные для поддержания плазмидного состояния, а также для литического развития, в результате инсерционного мутагенеза при помощи транспозонов "mini-kan" и Тп9. Полученные мутанты были исследованы па способность образовывать негативные колонии (бляшки), стабильность плазмидного состояния, способность вызывать у бактерии-хозяина лизогенную конверсию (Рис. 12). В районе 1-10 тпн по карте плазмиды была получена всего одна вставка (Cml, 4.1 тпн), которая не нарушала ни поддержание плазмиды, ни литическое развитие. Отсутствие вставок в районе 4.1-10.0 тпн согласуется с предположением о его важности для репликации. Инсерции в ген Q, а также в район, содержащий "поздние" гены, нарушала литическое развитие фага, но не влияло на поддержание его в виде линейной плазмиды. Вставки в районы с координатами (11-16 тпн) и (41.2-41.4 тпн) не влияли ни на поддержание плазмиды, ни литическое развитие. Вставка во второй из этих районов (Km 19) нарушала лизогенную конверсию, что согласуется с локализацией в этом участке гена cor, ответственного за эту функцию (Малинин и др. 1993). Одна из вставок (Km 14), в точку с координатами 44.01 тпн, нарушала стабильное наследование профага, позднее было установлено, что этот район содержит гены sopA и sopB, обеспечивающие сегрегационную стабильность профага (partition, Ravin and Lane, 1999).

О 10 20 30 40 тпн

111 ■ ■ сВ сю Q

Минимальная кольцевая плазмида

Район, который может быть делегирован в линейной гглазмиде

Рисунок 12. Расположени инсерционных мутаций на генетической карте плазмиды N15. Буквами "р" и "d" отмечены инсерции, не нарушающие и нарушающие образование бляшек, соответственно. сА и сВ (надписи внутри прямоугольников), -положение локусов, в которых были картированы clear plaque мутации (в некоторых работах используются названия immA и immB).

Для идентификации генов, необходимых для контроля лизогении, первоначально были идентифицированы мутанты, образующие светлые бляшки (т.е. неспособные к лизогении). Эти мутанты (clear plaque) были картированы в трех различных локусах, immA,immB и immC (Сварчевский, 1986).

Локус irnmB, охарактеризованный в работе (Lobocka et al., 1996), структурно и функционально аналогичен CI локусу фага лямбда и обеспечивает устойчивость N15-лизогенов к суперинфекции (иммунность). lmrtxB содержит три гена (Рис.13). Ген 38 (сВ) кодирует репресссор, гомологичный CI репрессору фага лямбда. Clear plaque мутации, картированные в irnmB, находятся именно в пределах гена сВ, что подтверждает роль СВ как основного репрессора. Ген 39 (его), имеет гомологию с его генами фагов Р22 и НК022, и расположен в аналогичном положении относительно с/. Третий ген, 40 (Q) кодирует белок, сходный с фактором антитерминации транскрипции лямбдоидного фага phi82.

Температурночувствительная мутация (сЗ) по гену сВ при пермиссивной температуре приводит к увеличению числа копий профага в 10 раз, а при повышении температуры может происходить индукция фага. Таким образом, продукт гена сВ с одной стороны, является репрессором при репликации профага, а с другой, -репрессором литического развития (Lobocka et al., 1996).

Ген сВ фланкирован набором сходных, но не идентичных сайтов, содержащих промотор и перекрывающую его операторную последовательность. В работе (Lobocka et al., 1996) были идентифицированы операторные сайты и показано, что СВ связывается с ними in vitro, но позиции промоторов известны исключительно на основании анализа пуклеотидной последовательности и требуют экспериментального подтверждения. Два оператора, расположенные левее сВ, перекрывают предполагаемые промоторы гена герА, что позволяет предположить, что связывание СВ с этими операторами репрессирует транскрипцию герА. Это предположение дополнительно подтверждается данными, о том что Ы15-миниплазмиды, не содержащие ген сВ, имеют значительно более высокое число копий, чем плазмиды с интактным сВ (Равин и Равин, 1994). Три оператора, расположенные правее сВ, перекрывают предполагаемые промоторы самого гена сВ и промоторы «позднего» оперона, включающего гены его и Q. Предполагается (Lobocka et al., 1996), что связывание СВ с этими операторами регулирует уровень экспрессии самого гена сВ, а также генов его и Q.

Рисунок 13 , Структурная организация района immB.

Показаны гены (серые прямоугольники), Предполагаемые промоторы (Р), терминаторы (Т), операторы (О) и сайты связываия рибосом (черные кружки). Гены, показанные выше (ниже) базовой линии, транскрибируются слева направо (справа налево).

Помимо СВ, еще как минимум два фактора могут участвовать в регуляции экспрессии герА (Lobocka в! al., 1996), хотя эти гипотезы не были проверены экспериментально. Во-первых, лидерная последовательность герА содержит Rho-независимый терминатор, что позволяет сделать предположение о том, что терминация-антитерминация может принимать участие в регуляции экспрессии герА.

Помимо этого, лидерный участок содержит ориентированный в противоположную сторону промотор Р1ПС за которым на расстоянии около 80нт следует терминатор (Рис. 13), С этого промотора может инициироваться синтез антнемысловой РНК, модулирующей экспрессию герА. Регуляция экспрессии генов, обеспечивающих репликацию, при помощи антисмысловых РНК. достаточно распространена и, в частности, описана в случае логического репликона фага PI (Heinrich et al., 1995).

4. Векторы для клонирования крупных фрагментов ДНК.

Одной из целей настоящей работы являлось использование фага N15 как основы для создания линейных клонирующих векторов, обладающих большой емкостью. Поэтому в этой части Обзора литературы будут рассмотрены существующие в настоящее время системы для клонирования крупных фрагментов ДНК (более 20 тпн) и проблемы, возникающие при клонировании фрагментов ДНК, содержащих инвертированные повторы, которые достаточно часто встречаются в геномной ДНК эукариот.

Изучение структуры и экспрессии генов про- и эукариот включает в качестве обязательного промежуточного этапа клонирование этих генов. Для этого необходимо получение библиотек геномной ДНК. Идеальный вектор для клонирования геномной ДНК должен обладать как можно большей емкостью, чтобы отдельный ген был представлен в одном или в мининимальном числе клонированных фрагментов ДНК. Для этих целей не используются стандартные кольцевые многокопийпые векторы типа pUC19, поскольку их емкость ограничена величиной 10-20 тпн. В настоящее время наиболее часто применяются для создания библиотек геномной ДНК вектора двух типов - вектора замещения на основе фага лямбда и космидные вектора.

Для клонирования фрагментов ДНК с использованием векторов замещения применяется следующая стратегия. При расщеплении векторной ДНК соответствующей рестриктазой образуется три фрагмента: левое и правое плечи и центральный фрагмент. Плечи вектора содержат гены, которых достаточно для литического развития фага. Центральный фрагмент не содержит необходимых для этого генов, но он нужен для того, чтобы вектор имел длину, допускающую его упаковку в фаговую частицу. После разрезания вектора плечи отжигают, при этом они соединяются по cos - концам. Затем плечи отделяют от центрального фрагмента при помощи электрофореза или центрифугирования в градиенте сахарозы. Полученный препарат плечей вектора лигируют с предварительно фракционированной по размеру клонируемой ДНК в условиях, обеспечивающих преимущественно межмолекулярное лигирование. Полученные контактамерные рекомбинантные молекулы in vitro разрезаются терминазой фага лямбда по cos - сайтам и упаковываются в фаговые частицы, которыми затем заражают бактерии штамма - хозяина. Негативные колонии

РОССИЙСКАЯ

41 ГОСУДАРСТВЕННАЯ

БИБЛИОТЕКА фаговые бляшки), образовавшиеся в результате лизиса зараженных бактерий, будут содержать рекомбинантные молекулы ДНК.

Емкость векторов замещения определяется размером центрального фрагмента и допустимыми вариациями в длине упаковываемой в фаговую частицу ДНК и составляет максимум 22 тпн. Как частный случай векторов замещения можно рассматривать вектора включения, в которых центральный фрагмент отсутствует. Эти вектора способны клонировать фрагменты ДНК размером от 0 до максимум 10 тпн и, как правило, используются для создания библиотек к-ДНК.

Важнейшим достоинством векторов замещения является высокая эффективность введения рекомбинантных молекул ДНК в клетки. Это достигается за счет того, что вместо обычной трансформации используется процесс упаковки in vitro. Эффективность упаковки in vitro достигает 109 бляшек на 1 мкг ДНК фага лямбда, что на несколько порядков выше чем эффективность трансфекции. Используя вектора замещения можно получить более чем 106 рекомбинантов на 1 мкг донорной ДНК.

Удобной модификацией векторов замещения являются фазмидные вектора, сочетающие в себе свойства плазмид и фагов. (Donaghue and Sharp, 1978; Yankovski et al., 1985). Помимо последовательностей левого и правого плечей вектора замещения фазмида содержит плазмидную последовательность, в результате чего вектор может поддерживаться как плазмида или как фаг. Один из фазмидных векторов описан в работе (Yankovski et al., 1989). Вектор pMYF131 представляет собой кольцевую плазмиду размером 33.3 тпн. Помимо всех генов и сайтов фага лямбда, необходимых для литического развития, он включает последовательность плазмиды pUC19. Вектор, не имеющий вставки, поддерживается как плазмида. При клонировании фрагмент ДНК лигируют с вектором, обработанным соответствующей рестриктазой, проводят реакцию упаковки in vitro и заражают клетки бактерии-хозяина. Размер вектора не допускает упаковку нерекомбинантной формы или олигомерных форм, клонируемые фрагменты должны иметь длину от 4.4 до 19.6 тпн. Вектор имеет температурночувствительный репрессор, что позволяет поддерживать рекомбинантные клоны в виде плазмид или фагов. Описанный фазмидный вектор был использован для создания геномных библиотек (Yankovski et al., 1985, 1989).

Поскольку емкость векторов замещения и фазмид невелика, в настоящее время для клонирования геномной ДНК используются космидные вектора, емкость которых составляет до 46 тпн. Клонирование в космидных векторах основано на том, что в головку фага лямбда может быть упакована любая ДНК подходящего размера, ограниченная двумя cos - сайтами с небольшими прилегающими участками.

Космидные вектора (Collins et al. 1978) представляют собой модифицированные плазмиды Е. coli, включающие cos - последовательность фага лямбда. Поскольку космидные вектора имеют плазмидный мини-репликон и ген устойчивости к антибиотику, они могут быть введены в Е .coli посредством обычной трансформации и поддерживаться как плазмиды. Почти все космиды основаны на мини-репликоне ColEl. Этот же репликоп имеют обычные клонирующие вектора - pBR322, pUC и др.

Для клонирования в космидном векторе его линеаризуют соответствующей рестриктазой и лигируют с фрагментами ДНК размером 35-45 тпн в условиях, обеспечивающих преимущественно межмолекулярное лигирование, что приводит к образованию длинных коикатамерных молекул ДНК. Полученные контактамеры являются субстратом в реакции упаковки in vitro. Cos- сайты разрезаются терминазой фага лямбда и ДНК между двумя cos - сайтами упаковывается в фаговые частицы, которыми заражают клетки бактерии - хозяина. После инфекции линейные рекомбинантные молекулы замыкаются в кольцо по когезивным концам. Полученная кольцевая молекула представляет собой космидный вектор с клонированной вставкой и в дальнейшем реплицируется как обычная плазмида. Бактерии, содержащие рекомбинантные плазмиды, могут быть отобраны на среде с соответствующим антибиотиком.

Емкость космидных векторов определяется, во-первых, размером ДНК, которая может быть упакована в фаговую частицу (38 - 52 тпн.) и, во-вторых, размером самого вектора (обычно около 6 тпн.). Таким образом, в космидном векторе могут быть клонированы фрагменты ДНК размером от 32 до 46 тпн. Благодаря использованию для введения рекомбинантных молекул в клетки процесса упаковки in vitro, эффективность клонирования хотя и несколько ниже, чем для векторов замещения, но все же составляет до 106 клонов на 1 мкг клонируемой ДНК. По сравнению с векторами замещения недостаток космид состоит в том, что рекомбинантные космиды представляют собой низкокопийные плазмиды, что делает скрининг методом гибридизации ДНК для них менее эффективным.

Чтобы преодолеть недостатки космидных векторов был создан ряд различных систем для клонирования крупных фрагментов ДНК в E.coli. Это системы для клонирования на основе бактериофага Р1 и системы на основе F-фактора E.coli.

4.1.1 Клонирующие векторы, созданные на основе F-фактора Е. coli.

Природный F-фактор E.coli представляет собой кольцевую молекулу ДНК размером 94,5 kb, которая может либо реплицироваться автономно, либо встраиваться в хромосому бактерии. F-фактор является однокопийной плазмидой, стабильно наследующейся при делении клеток. Стабильность плазмиды обеспечивается за счет правильного распределения плазмид между дочерними клетками при делении.

В области генома F-плазмиды с координатами 40-50kb располагаются гены и сайты, ответственные за репликацию и распределение молекул плазмидной ДНК между дочерними клетками. Эта область, вычлененная из ДНК F-плазмиды, сохраняет репликативные свойства и свойство несовместимости исходной плазмиды, поэтому ее назвали мини-Р-плазмидой. В ней имеется два ori-сайта. В норме с ori I инициируется двунаправленная репликация, но если его делетировать, то с ori II -сайта обеспечивается однонаправленная репликация. Рядом с этими сайтами располагаются ген герЕ, продукт которого необходим для репликации, а также локусы incB и incC, контролирующие репликацию. Распределение плазмиды между клетками контролируется областью sop.

Рисунок 14. Карта вектора pBeloBACl 1.

Стабильность F-фактора и его способность реплицировать фрагменты ДНК размером до 1500kb послужили стимулом для создания векторов на основе его репликона (ВАС- векторы).

Один из таких векторов описан в работе (Kim et al., 1996). Вектор pBeloBACl 1 получен па основе мини-Р-плазмиды и представляет собой кольцевую молекулу ДНК размером 7.5 тпн (рис.14). Помимо генов F-фактора, вектор имеет ген устойчивости к хлорамфениколу Cm , позволяющий отбирать трансформанты, и полилинкер с клонирующими сайтами. ВАС-векторы способны стабильно поддерживать вставки размером до 300kb (Shizuya et а., 1992). В работе (Kim et al., 1996) авторы использовали этот вектор для получения полной библиотеки геномной ДНК человека.

4.1.2 Клонирующие векторы, созданные на основе бактериофага Р1.

Бактериофаг Р1 - умеренный бакетериофаг E.coli, в отличие от большинства других бактериофагов в лизогенном состоянии он не встраивается в бактериальную хромосому, а представляет собой автономно реплицирующуюся кольцевую плазмиду (Sternberg and Hoess, 1983). Плазмида PI низкокопийная, стабильно наследуемая.

Поскольку, в отличии от F-фактора, Р1 является умеренным фагом, то имеется возможность создать систему для упаковки in vitro, аналогичную системе для космидных векторов, но с большей емкостью, т.к. размер ДНК фага Р1 составляет около 110 тпн (у фага лямбда - 48 тпн). Создание и характеристика такой системы для клонирования на основе фага Р1 описано в работе (Sternberg, 1990). У фага Р1 процесс упаковки ДНК в фаговую частицу начинается с того, что фермент паказа узнает и разрезает сайт рас в фаговой ДНК. ДНК с одной стороны от разрыва начинает упаковываться в пустую фаговую головку. Как только головка будет заполнена, паказа вносит второй разрыв, отделяющий ДНК в головке от остальной. Этот разрыв не является сайт-специфическим. Затем к заполненным головкам присоединяются хвостики, завершая процесс сборки фаговой частицы.

В описываемой автором упаковочной реакции in vitro на первой стадии рас-сайт векторной ДНК разрезается экстрактом, содержащим паказу. На второй стадии к полученной ДНК добавляют экстракт с головками и хвостиками фаговых частиц и процесс упаковки завершается. Полученными фагами заражают бактерии штамма E.coli, экспрессирующего Сге-рекомбиназу фага Р1, трансформанты отбирают на агаре с канамицином. Сге-рекомбиназа вызывает сайт-специфическую рекомбинацию между двумя loxP - сайтами, приводя к образованию кольцевой плазмидной молекулы.

Максимальная емкость вектора составляет около lOOkb, причем она обусловлена емкостью головки фага Р1.

Использованная автором система упаковки Р1 в одном важном отношении существенно отличается от систем для упаковки фага лямбда. Если у фага лямбда в головку может упаковаться только одна непрерывная молекула ДНК, обязательно ограниченная cos - сайтами, то в головку фага PI могут упаковываться фрагменты ДНК размера много меньше, чем максимальная емкость фаговой частицы. Вследствие этого возникает проблема, связанная с упаковкой в одну частицу молекул ДНК, образованых из нескольких небольших вставок и молекул вектора. Это может привести к образованию значительного количества химерных конструкций. Эта же проблема возникла при разработке аналогичной упаковочной системы еще большей емкости на основе фага Т4 (Rao et al., 1992).

Альтернативной системой для клонирования на основе бактериофага PI являются РАС-векторы, представляющие собой мини-Р1 плазмиды (loannou et al., 1994). Как и в случае плазмиды F, изолированный фрагмент ДНК фага Р1 содержит все функции, необходимые для репликации и стабильного наследования. Пример такого вектора показан на Рис. 15. Вектор pZC175 содержит репликационный ген герА, область par, обеспечивающую стабильное наследование плазмиды (гены рагА, рагВ и центромерный сайт parS), а также ген устойчивости к ампициллину (Ыа). Подобные векторы позволяют клонировать фрагменты ДНК размером до 500 тпн.

Рисунок 15. Карта РАС-вектора pZC 175.

4.1.3 Проблемы, возникающие при клонировании фрагментов ДНК, содержащих инвертированные повторы.

В геноме прокариот и, особенно, эукариотических организмов, достаточно часто встречаются участки ДНК с особенностями вторичной структуры. Так, в геноме человека в среднем один раз на 40 тпн встречается участок ДНК, потенциально способный формировать "крестообразную" структуру. Предполагается, что подобные аномальные районы ДНК могут иметь функциональное значение [Schroth and Но, 1995].

Клонирование последовательностей ДНК, содержащих прямые и особенно инвертированные повторы, представляет собой определенную проблему. Если для успешного клонирования прямых повторов достаточно подавить рекомбинацию, что может быть достигнуто использованием дефектных по рекомбинации штаммов, то ситуация с инвертированными повторами намного сложнее. Если два инвертированных повтора разделены какой-либо последовательностью или не являются полностью идентичными, то говорят о неидеальном палиндроме, при отсутствии такой последовательности и идентичности повторов палиндром является идеальным. Практически идеальные палиндромы длиной более 30 нуклеотидов не удается клонировать. Так, частота делеций при увеличении длины идеального палиндрома от 22 до 90 нуклеотидов возрастает в тысячи раз [Das Gupta et al., 1987; Weston-Hafer and Berg, 1991].

В дальнейшем будет идти речь только о неидеальных палиндромах (Рис. 16). Палиндром in vitro, а возможно и in vivo, может образовывать так называемую крестообразную структуру, состоящую из петли (область центральной асимметрии) и стебля. Уже в ранних работах было установлено, что стабильность палиндрома в Escherichia coli зависит от трех факторов: 1) природы палиндрома - его длины, величины участка центральной асимметрии, последовательности нуклеотидов; 2) генотипа штамма Е. coli и 3) типа репликона, в котором локализован палиндром [Sinden, 1994; Leach et al., 1987].

В общем, по мере увеличения длины ствола и уменьшения длины петли стабильность палиндрома падает [Chalker et al., 1993; Sinden et al., 1991]. Поскольку даже крупные палиндромы (4200 + 4200 нуклеотидов) сохраняются в нереплицирующейся ДНК и теряются только при репликации, считается, что формирование in vivo крестообразной структуры является главной причиной нестабильности палиндромов (Sinden, 1994; Shurvinton et al., 1987). Эти структуры затем разрушаются SbcCD нуклеазой (Connelly et al., 1998; Cromie et al., 2000).

Образование палиндромом крестообразной структуры в двунитевой ДНК является, в принципе, энергетически невыгодным процессом из-за наличия неспаренных нуклеотидов в концевых шпильках и основании палиндрома. Однако такой переход может оказаться энергетически выгодным в условиях сверхспирализации, поскольку образование палиндрома уменьшает число сверхвитков и, тем самым, понижает свободную энергию молекулы.

Известный специалист по структуре ДНК Ричард Шинден в обзоре (Sinden, 1994) делает заключение, что "кресты могут образовываться в сверхспирализованной, но не в линейной или релаксированной ДНК".

Рисунок 16 . Схема формирования крестообразной структуры палиндромом. Одинаковые последовательности показаны жирными стрелками.

Предпринято много попыток подобрать мутантные штаммы Е. coli, в которых палиндромы были бы стабильными, однако это дает лишь частичный результат, поскольку такие мутации влияют на размножение векторов на основе фага лямбда, обычно используемых для клонирования относительно крупных фрагментов эукариотической ДНК [Chalker et al., 1987; Gibson et al., 1992; Doherty et палиндром al., 1993]

В исследованиях, о которых шла речь, палиндромы клонировались в векторах на основе репликона плазмид типа pUC или фага лямбда. В обоих случаях вектор или имеет всегда кольцевую форму, или проходит стадию кольцевой ДНК в процессе репликации. Между тем установлено, что суперскрученность резко увеличивает вероятность формирования крестообразной формы [Courey and Wang 1988].

Другой причиной делетирования палиндромных последовательностей (SbcCD независимый путь) является образование крестообразной структуры находящимся в однонитевом состоянии палиндромом в ходе репликации отстающей цепи (Pinder et al., 1998; Leach, 1994, Bzymek and Lovett, 2001).

Таким образом, можно сделать заключение, что последовательности, включающие инвертированные повторы, могут быть нестабильны при их клонировании в обычных кольцевых векторах. Эта нестабильность связана с образованием палиндромами крестообразной структуры в условиях сверхспирализации. В то же время в геномной ДНК про- и особенно эукариот последовательности, включающие инвертированные повторы, встречаются достаточно часто. Поэтому представляется целесообразным создание линейных клонирующих векторов, не имеющих сверхспирализованных форм. Такие векторы могут быть иметь преимущества по сравнению с обычными кольцевыми векторами при клонировании палиндромов и крупных фрагментов геномной ДНК, которые могут их содержать.

Похожие диссертационные работы по специальности «Вирусология», 03.00.06 шифр ВАК

Заключение диссертации по теме «Вирусология», Равин, Николай Викторович

выводы.

1. Определена полная структу ра генома бактериофага N15 (46375 нт). Геном включает блок генов, кодирующих структурные белки вириоиа, которые высоко гомологичны соответствующим генам лямбдоидных фагов, и несколько блоков генов, присутствие которых связано с тем, что профаг N15 является линейной плазмидой с ковалентно замкнутыми теломерами. Это ген протеломеразы (фермент, образующий ковалентно замкнутые теломеры), оперон, включающий гены антирепрессора, репликационный оперон, sop-oncpoH, обеспечивающий стабильное наследование плазмидного профага. Контрольный модуль в составе гена основного репрессора сВ, генов его и Q, гомологичных соответствующим генам лямбдоидных фагов, регулирует экспрессию репликационного оперопа и позднего оперопа, включающего гены лизиса и гены структу рных белков вириона.

2. Идентифицированы гены антирепрессора N15 и показано, что их экспрессия контролируется короткой регуляторной РНК, образующейся в результате процессинга лидерной части транскрипта. Показано, что выбор между литическим и лизогенным путем развития зависит от соотношения рспрсссор-антирснрессор на ранней стадии инфекции.

3. Стабильное наследование плазмидного профага N15 обеспечивается за счет правильного распределения реплицированных молекул между дочерними клетками при делении. Установлено, что эта функция обеспечивается генами яо/^-оперона (геи 28= sopA и ген 27=sopB) и четырьмя центромерными сайтами, расположенными в различных районах генома N15. Показано, что Sop белки N15 и F-фактора функционально частично взаимозамспимы. Идентифицированы функциональные домены Sop белков N15 и плазмиды F.

4. Функционирование механизма стабильного наследования линейных репликонов требует, в отличие от кольцевых плазмид, наличия множественных центромерных сайтов, расположенных в различных районах генома.

5. Продукт фагового гена 29 является ферментом, образующим ковалентно замкнутые теломеры в ходе репликации линейного плазмидного профага (протеломеразой). Показано, что протеломераза завершает репликацию линейного плазмидного профага, разрезая дунлицированные теломеры; отсутствие протеломеразы приводит к накоплению кольцевых димерных молекул.

6. Протеломераза и сайт ее действия представляют собой независимую функциональную единицу, способную, при клонировании ее в кольцевых плзмидах, преобразовывать их в линейные плазмиды с ковалентно замкнутыми теломерами.

7. Минимальный репликон N15 включает один ген, герА, в пределах которого находится точка инициации репликации. Установлено, что обеспечиваемая RepA репликация ДНК N15 является двунаправленной.

8. Экспериментально доказана модель репликации ДНК линейного плазмидпого профага N15. Согласно этой модели двунаправленная репликация инициируется с о/7-сайта, расположенного несимметрично относительно центра молекулы, в пределах гена rep А. После дупликации левого тсломерного сайта протеломераза разрезает его, образуя шпилечные концы. Таким образом формируется Y-подобная структура. После репликации правой теломеры и последующего процсссипга образуются две линейные молекулы. Это первая экспериментально доказанная модель репликации линейной ДНК с ковалентно замкнутыми теломерами для прокариот.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ.

1. Равин Н.В., Равин В.К. (1994) Сверхконийная плазмида на основе мини-репликона умеренного бактериофага. Молекулярная Генетика, Микробиология и Вирусология, 1, 37-39.

2. Равин П.В., Страхова Т.С., Равин В.К. (1996) Создание и анализ библиотеки геномной ДНК человека в линейном сверхкопийном векторе. Тезисы материалов конференции «Геном человека-96», с. 15, Москва, 1996.

3. Равин Н.В., Равин В.К. (1998) Клонирование крупных нсидсальиых палиндромов в кольцевом и линейном векторах. Генетика, 34(1), 38-44.

4. Равин 11.В., Дорошенко О.И., Равин В.К. (1998) COS-райои умеренного бактериофага N15. Молекулярнт Генетика, Микробиология и Вирусология, 2, 17-20.

5. Равин Н.В., Дорошенко О.И., Страхова Т.С., Равин В.К. (1998) Анализ последовательностей ДНК генома человека, подавляющих репликацию кольцевых векторов. Тезисы материалов конференции «Геном человека-98», с.28-29. Москва, 1998.

6. S. Casjcns, R.Hendrix, N.Ravin, M.Ford, V.Ravin. (1998) General description and sequence of temperate bacteriophage N15. Abstracts of The 6th international workshop on P2, P4 and related bacteriophages, p.20-21, Berlin, Germany, 1998.

7. Ravin, N, Lane, D. (1998) Partitioning of the linear plasmid N15: functional intcrchangeability with the sop partitioning functions of the F plasmid. Abstracts of The 6th international workshop on P2, P4 and related bacteriophages, p.20-21, Berlin, Germany, 1998.

8. Ravin N.V., Ravin V.K. (1999) Use of a linear multicopy vector based on the mini-replicon of temperate coliphage N15 for cloning DNA with abnormal secondary structures. Nucleic Acids Research, 27, eI3

9. Ravin N., Svarchevsky,A., Deho G. (1999) The antiimunity system of phage-plasmid N15: identification of the antirepressor gene and its control by a small processed RNA. Molecular Microbiology, 34, 980-994

10. Ravin N., Lane D. (1999) Partition of the linear plasmid, N15: functional interactions with the sop locus of the F plasmid. Journal of Bacteriology, 181, 6898-6906

11. Ravin, V., Ravin, N., Casjens. S., Ford, M., Hatfull, G., Hendrix,R. (2000). Gcnomic scqucnce and analysis of the atypical bacteriophage N15. Journal of Molecular Biology, 299,53-73

12. Ravin, N.V., Strakhova, T.S., Kuprianov, V.V. (2001) The protelomerase of the phage-plasmid N15 is responsible for its maintenance in linear form. Journal of Molecular Biology, 312, 899-906

13. N.V. Ravin, V.V.Kuprianov, T.S.Strakhova. (2001) Replication mechanisms of linear DNA with covalcntly closcd ends: the phage N15 model. Abstracts of the 7th International workshop on P2, P4 and related bacteriophages, p. 26-27, Sigtuna, Sweden.

14. N.V. Ravin, D. Lane. (2001) Functional domain in bacterial plasmid partition proteins. Abstracts of The International Symposium "Molecular mechanisms of genetic processes and biotechnology", p. 122-123, Moscow.

15. H.B. Равин, T.C. Страхова, В.В. Куприянов. (2001) Теломсраза фага N15 обеспечивает его репликацию в виде линейной плазмидной молекулы с ковалентно замкнутыми концами. Тезисы Международного Симпозиума «Молекулярные механизмы генетических процессов и биотехнология», с. 135-136, Москва, 2001

16. N.V.Ravin, V.V.Kuprianov (2002) Replication mechanisms of linear DNA with covalcntly closed ends: the N15 virus model. Abstracts of the Xllth International Congress of Virology, Paris, France.

17. J-Y. Bouct, V. Libantc, M. Bouvicr, N. Ravin, D. Lane. (2003) On bacterial mitosis: the mechanism of F plasmid partition. Abstracts of EMBO workshop on Rcplicon Theory. Villefranche-sur-mer, France.

18. Дорохов Б.Д., Страхова T.C., Равин H.B. (2003) Протеломераза фага N15 защищает линейную ДНК с ковалентно замкнутыми концами от деградации в клетках Escherichia coli. Тезисы Второго Международного конгресса «Биотехнология: состояние и перспективы развития», с. 20. Москва.

19. Ravin, N.V. (2003) Mechanisms of replication and telomere resolution of the linear plasmid prophage N15. FEMS Microbiology Letters, 221 (1), 1-6.

20. Ravin, N.V., Rech, J., & Lane, D. (2003). Mapping of functional domains in F plasmid partition proteins reveals a bipartite SopB-recognition domain in SopA. Journal of Molecular Biology, 329, 875-889.

21. Dorokhov, B.D., Lane, D., Ravin, N.V. (2003) Partition operon expression in the linear plasmid prophage N15 is controlled by both Sop proteins and protelomerase. Molecular Microbiology, 50, 713-721.

22. Ravin, N.V., Kuprianov, V.V., Gilcrease, E.B., Casjcns, S.R. (2003) Bidirectional replication from an interna! ori site of the linear N15 plasmid prophage. Nucleic Acids Research, 31, 6552-6560.

23. Равин H.B., Дорохов Б.Д., Lane D. (2004) Структурная организация и контроль экспрессии sop оперона линейного плазмидного профага N15. Молекулярная Биология, 2, 297-302.

24. Дорохов Б.Д., Страхова Т.С., Равин Н.В. (2004) Регуляция экспрессии гена протеломеразы бактериофага N15. Молекулярная Генетика, Микробиология и Вирусология, 2, 28-32.

ЗАКЛЮЧЕНИЕ

Различные модели репликации линейной ДНК с ковалентно замкнутыми теломерами, предложенные на протяжении последних 30 лет (Bateman, 1975, Casjens, 1999), суммированы на Рис. 86. О

Vo^hohитевои раз застройка конца одной итевой разрыв и

1 перестройка теломеры о репликация по механизму /-V вытеснения цепи О завершение репликации

5) несколько циклов репликации

Рисунок 86. Возможные модели репликации ДНК с ковалснтно-замкнутыми теломерами.

Согласно первому механизму двунаправленная репликация, инициированная с ori-сайта, расположенного в центральной части молекулы, приводит к образованию кольцевого димера. Вторая стратегия предполагает разрезание теломер и образование кольцевого мономера, который реплицируется как кольцевой репликон. В обоих случаях дочерние линейные молекулы образуются в результате разрезания дуплицированных теломер специальным ферментом. Третья стратегия предполагает внесение однонитевых разрывов в одной (показано на рисунке) или обеих теломерах, за которым следует застройка однонитевых участков ДНК-полимеразой, перестройка теломер, и репликация по механизму вытеснения цепи (strand-displacement). Заключительным этапом является разрезание дуплицированных теломер с образованием дочерних линейных молекул. Представленные стратегии репликации не являются взаимоисключающими, например, стратегия 1 может быть использована для репликации основной части ДНК, а стратегия типа 3, - для репликации теломер (Casjens, 1999).

Описанные выше модели различаются несколькими принципиальными позициями: (1) положение ori-сайта: внутри молекулы или в районе теломер, (2) направленность репликации и ее механизм: одно- или двунаправленная, 0- механизм или другой, (3) свойства фермента, образующего теломеры и структура интермедиата, который он процсссируст: кольцевой мономер, кольцевой димер или линейная молекула.

Полученные в настоящей работе результаты позволяют сделать однозначный вывод о том, что принципиапьпо репликация ДНК профага N15 следует первой из описанных моделей. Во-первых, точка начала репликации N15 находится в пределах гена герА, т.е. во внутренней части молекулы. Во-вторых, репликация является двунаправленной, а установленные свойства свойства репликациоиного белка RepA согласуются с 0 - механизмом репликации. В-третьих, идентифицирован фермент, образующий ковалеитно-замкиутые теломеры в ходе репликации профага N15 (протеломераза) и показано, что отсутствие протеломеразы приводит к накоплению интермедиатов, имеющих структуру кольцевых димеров. Наконец, прямой анализ структуры реплицирующихся молекул методом электронной микроскопии подтвердил сделанный вывод.

Более подробная модель репликации ДНК N15 представлена на Рис 87. Единственным существенным отличием от схемы, представленной выше, является то, что процессииг одной из теломер (вероятно, левой) протеломеразой предшествует полной репликации молекулы и образованию кольцевого димера (путь А). Эта модель может быть расширена и для объяснения механизма репликации ДНК N15 в ходе литического развития (путь В).

Возможно, что па определенной стадии литического развития полная репликация молекулы завершается до разрезания теломер, в результате чего образуется полный кольцевой димер, альтернативный процессииг теломер в котором может (за счет модификации протеломеразы и/или сайта разрезания) приводить к образованию двух кольцевых мономеров вместо двух линейных плазмид (Рис.87 В). Альтернативным вариантом является обратная относительно процесса образования теломер реакция, т.е. непосредственное образование кольцевой мономериой молекулы из линейной (Рис. 87 В1). Первый вариант представляется более вероятным, поскольку проведенный в этой работе анализ структур ДНК, образующихся в ходе репликации ДНК N15 в процессе литического развития, показал, что образованию кольцевого мономера предшествует появление кольцевых димерных молекул. Репликация образовавшегося кольцевого мономера может следовать сигма-механизму с последующим образованием линейных конкатамеров, которые могут затем разрезаться по cos сайтам и упаковываться в фаговые частицы. линеиная плазмида поздняя репликация а - типа, аналогично случаю фага лямбда telRL фаговая ДНК

Рисунок 87. Модель репликации ДНК N15.

A) - репликация линейной плазмиды

B) - возможный механизм репликации ДНК N15 в ходе литического развития.

Репликация других прокариотических ДНК, имеющих ковалентно-замкнутые теломеры, вероятно, следует модели, подтвержденной в настоящей работе для профага N15.

Гомологи протеломеразы N15 имеются в геномах всех описанных прокариотических репликонов такого типа: это ген ВВВ03 в Borrelia burgdorferi, AgrC4584 в Agrobacterium tumefaciens, гены протеломераз линейных фагов-плазмид фК02 и PY54. Образование шпилечных теломер продуктами генов ВВВ03, а также протеломераз фК02 и PY54, было продемонстрировано in vitro (Kobryn and Chaconas, 2002; 1 luang et al, 2004; Hertwig et al., 2003), а в случае TelK (фК02) также и in vivo.

Репликация линейных плазмид и хромосом В. burgdorferi инициируется с ori-сайтов, расположенных в центре молекул и является двунаправленной (Picardeau et al, 1999). Было показано (Chaconas et а!., 2001), что сиитетическая последовательность, имеющая структуру дуплицированной теломеры, разрезается in vivo и обеспечивает преобразование кольцевой молекулы в линейную. Предполагается (Chaconas et al., 2001), что репликация линейных плазмид Borrelia включает стадию образования кольцевого димера, разрезаемого продуктом гена ВВВОЗ.

Репликация фагов-плазмид фК02 и pY54, вероятно, также инициируется с внутреннего оп-сайта. расположенного в пределах их гомологов гена repA N15. В пользу этого свидетельствует как высокая гомология repA генов, так и сохранение структуры ori сайтов (глава 9).

В то же время описанная выше модель репликации прокариотических ДНК с ковалентно замкнутыми теломерами отличается от модели, используемой эукариотическими организмами с аналогичной структурой ДНК (поксвирусы, иридопоксвирусы, вирусы Chlorella, и др.). В частности, предполагается, что репликация поксвирусов инициируется в районе теломер, следует механизму вытеснения цепи, в результате чего образуются линейные конкатамеры, процессируемые неизвестным в настоящее время ферментом с образованием линейных мономеров (De Masi et al., 2001). Помимо этого, геномы поксвирусов не содержат явных гомологов протеломераз.

Эти данные свидетельствуют в пользу независимого эволюционного происхождения прокариотических и эукариотических репликонов с ковалентно замкнутыми теломерами, а не выдвинутой ранее (Hinncbusch and Barbour, 1991; Hinnebusch and Tilly, 1993) гипотезы о переносе генов протеломераз от эукариот (иридопоксвирусы) к прокариотам (Borrelia) или наоборот.

БЛАГОДАРНОСТИ

Автор выражает глубокую благодарность за разнообразную помощь в выполнении работы своим коллегам: Jean-Yves Bouet, Sherwood Casjens, Giovanni Dcho, David Lane Erich Lanka, Б.Д. Дорохову, Л.А. Замчук, Б.Б. Кузнецову, В.В. Куприянову, А.В. Марданову, Т.С. Страховой, и веем другим, кто помогал в работе

В.К. Равину, В.II. Рыбчину, А.II. Сварчевскому, К.Г. Скрябину, М.А. Эльдарову, Н.К. Янковскому, - за плодотворные научные дискуссии,

Д.В. Мухе, Gregory Phillips, Wai-Mun Huang, Walter Messer - за предоставленные препараты ДНК, бактериальные штаммы и плазмиды.

Список литературы диссертационного исследования доктор биологических наук Равин, Николай Викторович, 2004 год

1. Востров А.А., Малинин А.Ю., Рыбчин В.Н., Сварчевский А.Н. (1992) Конструирование линейных плазмидных векторов для клонирования в клетках Esherichici coli. Генетика, 28, 186-188

2. Голу б Е.И. Равин В.К. (1967) Новая система фаговой конверсии. Доклады АН СССР, 174, 465-467

3. Дорохов Б.Д., Страхова Т.С., Равин Н.В. (2004) Регуляция экспрессии гена протеломеразы бактериофага N15. Мол. Генет. Микробиол. Вирусол. 2, 28-32.

4. Матинин А.Ю., Востров А.А., Рыбчин В.Н., СварчевскнйА.Н. (1992а) Структура концов линейной плазмиды N15. Мол. Генет. Микроб. Вирусол., 5-6, 19-22

5. Матинин А.Ю., Васильев А.Л., Холодий Г.А., ВостровА.А., Рыбчин В.Н., Сварчевский А.Н. (1992b) Структура области в геноме бактериофага N15, необходимая для образования шпилек на концах линейного плазмидного профага Мол.Генет.Микроб. Вирусол., 5-6, 22-25

6. Матинин А.Ю., Востров А.А., Васильев А.Л., Рыбчин А.Н. (1993) Характеристика гена лизогенной конверсии фага N15 и идентификация его продукта. Генетика, 29, 257-265

7. МухаД.В., Сидоренко А.П., Марченко Г.Н (1995) Клонирование протяженной патнндромной последовательности рибосомной ДНК Tetrahymena pyriformis., Мол. Биология, 29(4), 826-831

8. Равин В.К., ШульгаМ.Г. (1968) Температурночувствительпые мутанты бактериофага N15. Генетика, 4, 91-95

9. Равин В.К. (1968) Функционирование генов умеренного бактериофага в лизогенных клетках., Генетика, 5, 119-124

10. Равин В.К. (1971) Лизогения. Издательство «Наука», Москва, 1971.

11. Равин В.К. (1972) Отсутствие профага в хромосоме Echerichia coli К-12. Генетика, 8, 189-191

12. Равин Н.В., Равин В.К. (1994) Сверхкопийная плазмида на основе минн-репликона умеренного бактериофага. Мол Генет Микробиол Вирусол, 1: 37-39.

13. Равин Н.В., Равин В.К. (1998) Клонирование крупных неидеатьных патиндромов в кольцевом и линейном векторах. Генетика, (1998), .34, 1, 38-44.

14. Равин Н.В., Дорошенко О.И., Равин В.К. (1998) COS-район умеренного бактериофага N15. Мол Генет Мнкробнол и Вирусол, 2, 17-20.

15. Равин Н.В., Дорохов Б.Д., Lane D. (2004) Структу рная организация и контроль экспрессии sop оперона линейного плазмидного профага N15. Мол. Биология, 2, 297302.

16. СаньковаТ.П., Сварчевский А.Н., Рыбчин В.Н. (1992) Получение, характеристика и картирование инсерционных мутанций фазмиды N15. Генетика, 28, 66-76

17. Сварчевский А.Н. (1986) ФазмидаМ5: особенности генетики и структуры ДНК. Диссертация на соискание ученой степени кандидата биологических наук. 1986, Ленинград

18. Сварчевский А.Н., Рыбчин В.Н. (1984а) Характеристика плазмидных свойств бактериофага N15. Мол.Генет.Микроб.Вирусол., 10, 34-39

19. Сварчевский А.Н., Рыбчин В.Н. (1984b) Физическое картирование ДНК фазмиды N15. Мол.Генет.Микробиол.Вирусол., 10, 16-22

20. Abeles, A. L., and S. J. Austin. 1987. PI plasmid replication requires methylated DNA. EMBO J. 10:3185-3189.

21. Abeles, A. L., and S. J. Austin. 1988. 14 plasmid replication requires Escherichia coli Dam-methylated DNA. Gene 74:185-186.

22. Abeles A.L., S.A. Friedman and S.J. Austin (1985) Partition of unit-copy miniplasmids to daughter cells. III. The DNA sequence and functional organization of the PI partition region. J. Mol. Biol. 185, 261-272

23. Abeles, A. L., L. D. Reaves, and S. J. Austin. 1990. A single DnaA box is sufficient forinitiation from the PI plasmid origin. J. Bacterid. 172:4386-4391.

24. Abeles, A. L., L. D. Reaves, B. Youngre-Grimes, and S. J. Austin. 1995. Control of PI plasmid replication by iterons. Mol. Microbiol. 18:903-912.

25. Abeles, A. L„ К. M. Snyder, and D. K. Chattoraj. 1984. PI plasmid replication: replicon structure. J. Mol. Biol. 173:307-324.

26. Alano, P., Deho, G., Sironi, G., and Zangrossi. S. (1986) Regulation of the plasmid state of the genetic element P4. Mol Gen Genet 203: 445-450.

27. Allardet-Servent, A., S. Michaux-Charachon, E. Jumas-Bilak, L. Karavan, and M. Ramuz. (1993) Presence of one linear and one circular chromosome in thq Agrobacterium tumefaciens C58 genome. J. Bacteriol. 175, 7869-7874.

28. S.F. Allschul, VV. Gish, W. Miller, E.VV. Myers and D.J. Lipman, Basic local alignment search tool. J. Л/о/. Biol. 215 (1990). pp. 403-410

29. S.F. Allschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller and D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25 (1997), pp. 3389-3402

30. Aravind, L., Leipe, D.D., Koonin, E.V.(1998) Toprim a conserved catalytic domain in type IA and II topoisomerases, DnaG-type primases, OLD family nucleases and RecR proteins. Nucleic Acids Res., 26, 4205-4213

31. Argos, P. (1988) A sequence motif in many polymerases. Nucleic Acids Res. 16: 99099916.

32. Argos, P., Landy, A., Abremski, K., Egan, J.В., Haggard-Ljungquist, E., Hoess, R.H., eta! (1986) The integrase family of site-specific recombinases: regional similarities and global diversity. UMBO J 5: 433-440

33. Austin S and A. Abeles, (1983) Partition of unit-copy miniplasmids to daughter cells. I. PI and F miniplasmids contain discrete, interchangeable sequences sufficient to promote equipartition. J. Mol. Biol. 169, 353-372.

34. Austin S. and A. Abeles (1983) Partition of unit-copy miniplasmids to daughter cells. II. The partition region of miniplasmid PI encodes an essential protein and a centromere-like site at which it acts. J. Mol. Biol. 169, 373-387.

35. Austin, S. and A. Wierzbecki. (1983). Two mini-F-encoded proteins are essential for equipartition. Plasmid 10: 73-81

36. Ausubel, F.M. R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl. (1989). Current Protocols in Molecular Biology. New York:Greene Publishing Associates and Wiley-Interscience

37. J. Baker, R. Limberger, S.J. Schneider and A. Campbell, Recombination and modular exchange in the genesis of new lambdoid phages. New Biol. 3 (1991), pp. 297-308.

38. Bao, K., Cohen, S. N. (2003). Recruitment of terminal protein to the ends of Streptomyces linear plasmids and chromosomes by a novel telomere-binding protein essential for linear DNA replication. Genes Dev. 17:774-85.

39. Baranska S., Gabig M., Wegrzyn A., Komopa G., Herman-Antosiewicz, Hernandez P., Schvartzman J. В., Helinski D.R., and Wegrzvn G. (2001) Regulation of the switch from early to late bacteriophage lambda DNA replication. Microbiology, 147, 535-547.

40. Barbour, A.G., and Garon, C.F. (1987) Linear plasmids of the Borrelia burgdorferi have covalently closed ends. Science, 237, 409-411.

41. Barrett, К. J., Gibbs, W., and Calendar, R. (1972). A transcribing activity induced by satellite phage P4. Proc.Natl. Acad. Sci. USA 69, 2986-2990.

42. Bartel, P.L., Chien, C-T, Sternglanz, R., Fields, S. (1993) Using the two-hybrid system to detect protein-protein interactions. In Hartley, D.A. (ed.), Cellular interactions in develoment: a practical approach. Oxford University Press, pp. 153-179

43. Bateman, A. (1975) Simplification of palindromic telomere theory'. Nature, 253, 379.

44. Benkovic S.J, A.M. Valentine, and F. Salinas (2001) Replisome-mediated DNA replication. Annu. Rev. Biochem. 70:181-208

45. O. Bergh, K.Y. Borsheim, G. Bratbak and M. Heldal, High abundance of viruses found in aquatic environments. Nature 340 (1989), pp. 467-468.

46. Bemander, R. S. DasGupta. and K. Nordstrom. 1991. The Escherichia coli cell cycle and the plasmid R1 replication cy cle in the absence of DnaA protein. Cell 64:1145-1153.

47. Bertani, L., E„ and Six, E. W. (1988) The P2-like phages and their parasite P4. in The Bacteriophages Vol. 2 (R. Calendar, Ed.), Plenum Press, New York City, pp73-143.

48. M. Better and D. Freifelder (1983). Studies on the replication of Escherichia coli phage IambdaDNA. Virology 126, 168-182

49. Biek, D.P. and J. Shi. (1994). A single 43-bp sopC repeat of plasmid mini-F is sufficient to allow assembly of a functional nucleoprotein partition complex. Proc. Natl. Acad. Sci. USA 91: 8027-8031

50. Biek, D.P. and Strings. J. (1995) Partition functions of mini-F affect plasmid DNA topology in Escherichia coli. J Mol Biol, 246, 388-400.

51. Biere, A.L., Citron. M. and Schuster, H. (1992) Transcriptional control via translational repression by c4 antisense RNA of bacteriophages PI and P7. Genes Dev 6: 2409-2416.

52. Biessmann II, Walter M.F., and Mason J.M. (1997) Drosophila telomere elongation. (1997) Ciba Found. Symp. 211, 53-67.

53. K. Bienkowska-Szewcsyk and A. Taylor, Murein trans-glycosylase from phage lambda lvsate: purification and properties. Biochim. Biophys. Acta 615 (1980), pp. 489-496.

54. A.L. Biere, M. Citron and H. Schuster, Transcriptional control via translational repression by c4 antisense RNA of bacteriophages PI and P7. Genes Dev. 6 (1992), pp. 2409-2416.

55. U. Blasi and R. Young, Two beginnings for a single purpose: the dual-start holins in the regulation of phage lysis. Mol. Microbiol. 21 (1996), pp. 675-682.

56. F.R. Blattner, G. Plunkett, III. C.A. Bloch, N.T. Pema, V. Burland. M. Riley, J. CoIIado-Vidcs, J.D. Glasner, C.K. Rode, G.F. Mayhew, J. Gregor, N.W. Davis, H.A. Kirkpatrick,

57. M.A. Goeden, D.J. Rose, В. Mau and Y. Shao, The complete genome sequence of Escherichia coli K-2. Science 277 (1997), pp. 1453-1474

58. Boldicke, T. W.„ E. Lanka, and W. L. Staudenbauer. 1981. Rifampicin-resistant initiation of DNA synthesis on the isolated strands of ColEl plasmid DNA. Nucleic Acids Res. 20:5215-5231.

59. Boorstein, W.R., and Craig, E.A. (1989) Primer extension analysis of RNA. Methods Enzymol 180: 347-369.

60. M. Borodovsky, K.E. Rudd and E.V. Koonin. Intrinsic and extrinsic approaches for detecting genes in a bacterial genome. Nucl. Acids Res. 22 (1994), pp. 4756-4767.

61. Bowden, D.W., Twersky, R. S., and Calendar, R. (1975). Escherichia coli deoxyribonucleic acid synthesis mutants: Their effect upon bacteriophage P2 and satellite bacteriophage P4 deoxyribonucleic acid synthesis. J. Bacteriol. 124, 167-175.

62. Bouet, J.Y. and Funnell, B.E. (1999) PI ParA interacts with the PI partition complex at parS and an ATP-ADP switch controls ParA activities. Embo J, 18, 1415-1424

63. Bouet J.Y. J. A. Surtees and B.E. Funnell (2000) Stoichiometiy of PI plasmid partition complexes. J. Biol. Chem. 275, 8213-8219.

64. Bramhill, D., and A. Kornberg. 1988. A model for initiation at origins of DNA replication. Cell 54:915-918.

65. Britnnvall, M. Mattsson, J.G., SvSrd, S.G., and Kirsebom, L.A. (1998) RNase P RNA structure and cleavage rellect the primary structure of tRNA genes. JMol Biol 283: 771783.

66. Brendler, 'Г., A. Abeles. and S. J. Austin. 1991. Critical sequences in the core of the PI plasmid replication origin. J. Bacteriol. 173:3935-3942.

67. Brendler, Т., A. Abeles, and S. J. Austin. 1995. A protein that binds to the PI origin core and the oriC 13mer region in a methylation-specific fashion is the product of the host seqA gene. EMBO J. 14:4083-4089.

68. Brendler, T. G., A. L. Abeles, L. D. Reaves, and S. J. Austin. 1991. Unique sequence requirements for the PI plasmid replication origin. Res. Microbiol. 142:209-216.

69. Breuner A, Jensen RB, Dam M, Pedersen S, Gerdes K. (1996). The centromere-like parC locus of plasmid Rl. Mol. Microbiol. 20 581-592

70. Briani, F., Deh6, G., Forti, F., and Ghisotti, D. (2001) The plasmid status of satellite bacteriophage P4. Plasmid. 45: 1-17.

71. Briani, F., Zangrossi, S., Ghisotti, D. and Deho, G. (1996) A Rho-dependent transcription termination site regulated by bacteriophage P4 RNA immunity factor. Virology 223: 57-67.

72. В/) тек, М, and Lovett, S.T. (2001) Evidence for Two Mechanisms of Palindrome-Stimulated Deletion in Escherichia coli: Single-Strand Annealing and Replication Slipped Mispairing. Genetics 158: 527-540.

73. Z.H. Cai, Y. Hwang, D. Cue, C. Catalano and M. Feiss, Mutations in Nul, the gene encoding the small subunit of bacteriophage lambda terminase, suppress the postcleavage DNA packaging defect ofcosB mutations./. Bacterial. 179 (1997), pp. 2479-2485.

74. Calendar, R., Lindqvist, B.H., Sironi, G. and Clark, A.J. (1970). Characterization of rep-mutants and their interaction with P4 phage. Virology. 40: 72-83.

75. Campbell, A., and Botstein, D. (1983) Evolution of the lambdoid phages. In: Uvnbda II. Hendrix, W.R., Roberts J.W., Stahl, F.W., and Weisberg, R.A. (eds.). Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, pp. 365-380.

76. Casadaban, M.J. and S.N. Cohen. (1980). Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138: 179-207

77. Casjens, S (1999) Evolution of the linear DNA replicons of the Borrelia spirochetes. Curr Opin Microbiol.,2(5). 529-534

78. Casjens, S.R., Gilcrease, E.B., Huang, W.M., Bunny, K.L., Pedulia, M.L., Ford, M.E., Hourtz, J.M., Hatfull, G.F., and Hendrix, R.W. (2003) The pK02 linear plasmid prophage of Klebsiella oxytoca. J. Bacterial. 186: 1818-1832.

79. S. Casjens, G. Hatfull and R. Hendrix, Evolution of dsDNA tailed-bacteriophage genomes. Sem. Virol. 3 (1992), pp. 383-397.

80. C.E. Catalano, D. Cue and M. Feiss, Virus DNA packaging: the strategy used by phage lambda. Mol. Microbiol. 16(1995), pp. 1075-1086.

81. Cavalier-Smith, T. (1974) Palindromic base sequences and replication of eukaryotic chromosomes ends. Nature 250: 467-470.

82. Chaconas, G., Stewart, P.E., Tilly, K, Bono, J.L., and Rosa, P. (2001) Telomere resolution in the Lyme disease spirochete. EMBOJ, 20, 3229-3327.

83. Chalker A.F., Leach DR., Lloyd R.G. (1988) Escherichia coli sbcC mutants permit stable propagation of DNA replicons containing a long palindrome. Gene. 71, 201-205.

84. Chalker A.F., Okelv E.A., Davison A., Leach DR. (1993) The effect of central asymmetry on the propagation of palindrome DNA in bacteriophage lambda are consistent with cruciform extrusion in vivo. Genetics. 133, 143-148.

85. R. Chan and D. Botstein, Genetics of bacteriophage P22.1. Isolation of prophage deletions which aITect immunity to superinfection. Virology 49 (1972), pp. 257-276.

86. Chang, A.C. and Cohen, S.N. (1978) Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol, 134, 1141-1156.

87. Chattoraj, D. K., R. Ghirlando, K. Park, J. A. Dibbens, and M. S. Lewis. 1996. Dissociation kinetics of RepA dimers: implications for mechanisms of activation of DNA binding by chaperones. Genes Cells 1:189-199.

88. Christian, R. B. (1990). "Studies on P4 Bacteriophage Replication." Univ. ofCalifomia, Berkeley. Ph.D. thesis.

89. Churchward, G., P. Under, and L. Caro. 1983. The nucleotide sequence of replication and maintenance functions encoded by plasmid pSClOl. Nucleic Acids Res. 11:5645-5659.

90. Citron, M., and Schuster, H. (1990) The c4 repressors of bacteriophages PI and P7 are antisense RNAs. Cell 62: 591-598.

91. M. Citron and H. Schuster, The c4 repressor of bacteriophage PI is a processed 77 base antisense RNA. Л'ucl. Acids Res. 20 (1992), pp. 3085-3090.

92. Clackson, T. and Winter, G. (1989) 'Sticky feet'-directed mutagenesis and its application to swapping antibody domains. Nucleic Acids Res, 17, 10163-10170.

93. Cohen. D.R. and Curran, 'Г. (1990) Analysis of dimerization and DNA binding functions in Fos and Jun by domain-swapping: involvement of residues outside the leucine zipper/basic region. Oncogene, 5, 929-939

94. Cohen, G., and Sternberg, N.L. (1989). Genetic analysis ofthe lytic replicon of bacteriophage PI. I. Isolation and partial characterizatrion. J. Mol. Biol., 206: 99-109

95. Collins,J., Hohn.B. (1978) Cosmids: A type of plasmid gene cloning vector that is packageable in vitro in bacteriophage lambda heads. Proc.Natl.Acad.Sci.USA 75, 4242.

96. Collins К (1996) Structure and function ofteomerase. Curr. Opin. Cell. Biol, 8, 374-380

97. Connelly, J.C., Kirkham.L.A., Leach,D.R. (1998) The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. Proc.Natl.Acad.Sci. USA, 95: 7969-7964

98. Connelly, J. C., de Leau, E.S., Okelv, E.A., Leach, D.R. (1997) Overexpression, purification, and characterization of the SbcCD protein from Escherichia coli. J Biol Chem. 27:19819-26

99. Connelly, J. C. Leach, D.R. (1996) The sbcC and sbcD genes of Escherichia coli encode a nuclease involved in palindrome inviabilitv and genetic recombination. Genes Cells. 1(3): 285-91

100. Courev A.J., Wang J.C. (1988) Influence of DNA sequence and supercoiling on the process of cruciform formation. J. Mol. Biol. 202, 35-43.

101. Cox, M. M„ Goodman, M. F., Kreuzer, K. N„ Sherratt, D. J., Sandler, S. J., and Marians, K. J. (2000) The importance of repairing stalled replication forks. Nature. 404:3741.

102. С romie GA, Millar CB, Schmidt KH, Leach DR (2000) Palindromes as substrates for multiple pathways of recombination in Escherichia coli. Genetics. 154: 513-22.

103. Crosa, J. H. (1980). Three origins of replication are active in vivo in the R plasmid RSF1040. J. Biol. Chem. 255, 11075-11077.

104. D. Cue and M. Feiss, A site required for termination of packaging of the phage lambda chromosome. Proc. Natl Acad. Sci. USA 90 (1993), pp. 9290-9294.

105. D. Cue and M. Feiss, Termination of packaging of the bacteriophage lambda chromosome: cosQ is required for nicking the bottom strand of cosN. J. Mol. Biol. 280 (1998), pp. 11-29.

106. Dam M. and K. Gerdes, (1994), Partitioning of plasmid Rl. Ten direct repeats flanking the parA promoter constitute a centromere-like partition site parC, that expresses incompatibility. J. Mol. Biol. 236. 1289-1298

107. DasGupta, S., H. Masukata, and J. I. Tomizawa 1987. Multiple mechanisms for initiation of CoIEl DNA replication: DNA synthesis in the presence and absence of ribonuclease H. Cell 51:1113-1122.

108. Das Gupta U., Weston-Hafer K., Berg D.E. (1987) Local DNA sequence control of deletions formation in Escherichia coli plasmid pBR322 . Genetics. 115, 41-49.

109. DasGupta, S., G. Mukhopadhyay, P. P. Papp, M. S. Lewis, and D. K. Chattoraj. 1993. Activation of DNA binding by the monomeric form of the PI replication initiator RepA by heat shock proteins DnaJ and DnaK. J. Mol. Biol. 232:23-34.

110. Davis M.A., K.A. Martin and S.J. Austin (1990) Specificity switch of the PI plasmid centromere-like site. EMBO J. 9, 991-998

111. Davis M. A. and S.J. Austin (1998) Recognition of the PI plasmid centromere analog involves binding of the I'arB protein and is modified by a specific host factor. EMBO J. 7 , 1881-1888.

112. Davis M.A., K.A. Martin and S.J. Austin (1992), Biochemical activities of the ParA partition protein of the PI plasmid. Mol. Microbiol. 6, 1141-1147

113. G. Deh6, S. Zangrossi, P. Sabbattini, G. Sironi and D. Ghisotti, Bacteriophage P4 immunity' controlled by small RNAs via transcription termination. Mol. Microbiol. 6 (1992), pp. 3415-3425.

114. E.P. Delver and A.A. Belogurov, Organization of the leading region of IncN plasmid pKMlOl (R46): a regulation controlled by CUP sequence elements. J. Mol. Biol. 271 (1997), pp. 13-30.

115. Dellis, S., and M. Filutowicz. 1991. Integration host factor of Escherichia coli reverses the inhibition of R6K plasmid replication by pi initiator protein. J. Bacteriol. 173:1279-1286.

116. DeMasi, J., Du, S., Lennon, D., and Traktman, P. (2001). Vaccinia virus telomeres: interaction with the viral II, 16 and K4 proteins./. Virol. 75, 10090-10105.

117. Deneke J, Ziegelin G, Lurz R, Lanka E. (2000) The protelomerase of temperate Escherichia coli phage N15 has cleaving-joining activity. Proc Natl Acad Sci U SA 97(14), 7721-7726.

118. Deneke, J., Ziegelin, G., Lurz, R., & Lanka, E. (2002) Phage N15 telomere resolution. Target requirements for recognition and processing by the protelomerase. J Biol Chem. 277: 10410-9.

119. Denhardt, D. Т., Dressier, D.H., and Hathaway, A. (1967). The abortive replication of phiXJ74 DNA in a recombination-deficient mutant of Escherichia coli. Proc. Natl. Acad. Sci. USA 57: 813-817.

120. Diaz, R., K. Nordstrom, and W. L. Staudenbauer. 1981. Plasmid R1 DNA replication dependent on protein synthesis in cell-free extracts of E. coli. Nature 289:326328.

121. Diaz, R„ and W. L. Staudenbauer. 1982. Origin and direction of mini-Rl plasmid DNA replication in cell extracts of Escherichia coli. J. Bacteriol. 150:1077-1084.

122. Diaz Orejas, R„ Ziegelin, G., Lurz, R„ and Lanka, (1994). Phage P4 DNA replication in vitro. Nucleic Acids Res. 22, 2065-2070.

123. Dibbens, J. A., K. Muraiso, and D. K. Chattoraj. 1997. Chaperone-mediated reduction of RepA dimerization is associated with RepA conformational change. Mol. Microbiol. 26:185-195.

124. Din N., Engberg. (1979) Extrachromosomal ribosomal RNA genes in Tetrahymena. Structure and evolution. J. Mol. Biol., 134, 555-574

125. Dmitrova, M., Younes-Cauet, G., Oertel-Buchheit, P., Porte, D., Schnarr, M. and Granger-Schnarr, M. (1998) A new L.exA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol Gen Genet, 257, 205-212.

126. Dodd, I.B. and J.B. Egan. (1990). Improved detection of helix-turn-helix DNA-binding motifs in protein sequences. Nucleic Acids Res. 18: 5019-5026

127. Doherty J.P., Lindeman R., Trent R.J., Graham M.W., Woodcock D.M. (1993) Escherichia coli strain SURE and SRB fail to preserve a palindrome cloned in lambda phage: improved alternate host strains. Gene, 124, 29-35

128. Dombroski, A.J., Walter, W.A. and Gross, C.A. (1993) Amino-terminal amino acids modulate sigma-factor DNA-binding activity. Genes Dev, 7, 2446-2455

129. Donaghue.D.J., Sharp,P.A. (1978) Costruction of a hybrid phageplasmide recombinant DNA vectors. J.Bacteriol. 136, 1192-1196

130. Dorokhov, B.D., Lane, D., Ravin, N.V. (2003) Partition operon expression in the linear plasmid prophage N15 is controlled by both Sop proteins and protelomerase. Mol. Microbiol., 50, 713-721.

131. S.E. Douglas, DNA Strider. A Macintosh program for handling protein and nucleic acid sequences. Methods Mol. Biol. 25 (1994), pp. 181-194.

132. Dunn, S.D. (1986) Effects of the modification of transfer buffer composition and the renaturation of proteins in gels on the recognition of proteins on Western blots by monoclonal antibodies. Anal. Biochem. 157: 144-153

133. Erdmann N, PetroffT, Funnell BE. (1999) Intracellular localization of PI ParB protein depends on ParA and ParS. Proc. Natl. Acad. Sci. U. S. A. 96 (1999), 14905-14910.

134. Eamshaw, S. Casjens and S. Harrison, Assembly of the head of bacteriophage P22: X-ray diffraction from heads, proheads and related structures./. Mol. Biol. 104 (1976), pp. 387-410.

135. Ebersbach, G. and Gerdes. K. (2001) The double par locus of virulence factor pB171: DNA segregation is correlated with oscillation of ParA. Proc Natl Acad Sci USA, 98, 15078-15083

136. Echols, H. (1990) Nucleoprotein structures initiating DNA replication, transcription, and site-specific recombination. J. Biol. Chem. 265, 14697-14700

137. Echols and G. Guameros, Control of integration and excision. In: R. Iiendrix, J. Roberts, F. Stahl and R. Wcisberg, Editors, lximbda 11, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1983), pp. 75-92.

138. Edgar, R., Chattoraj, D.K. and Yarmolinsky, M. (2001) Pairing of PI plasmid partition sites by ParB. Mol Microbiol, 42, 1363-1370.

139. Engberg J., Anderson P., Leick V. (1976) Free ribosomal DNA from Tetrahvmena pyriformis GL are giant palindromes. J. Mol. Biol., 104, 455-470.

140. Engberg J. (1993) Strong sequence conserv ation of a 38 bp region of extrachromosomal rDNA palindrome in different Tetrahvmena species. Nucleic Acids Res., 11,4939-4946.

141. Espinosa, M., G. del Solar, F. Rojo, and J. C. Alonso. 1995. Plasmid rolling circle replication and its control. FEMS Microbiol. Lett. 130:111-120.

142. Falson P. (1992) Improved phenol-based method for the isolation of DNA fragments from low-melting temperature agarose gels. BioFeedBack, 13, 120-123.

143. Filip, C.C., Allen, J.S., Gustafson, R.A., Allen, R.G., Walker, J.R. (1974). Bacterial cell division regulation: characterization of the dnaH locus of Escherichia coli. J. Bacterid. 119: 443-9.

144. Flensburg, J., and Calendar, R. (1987). Bacteriophage P4 DNA replication. Nucleotide sequence of the P4 replicationgene and the cis replication region. J. Mol. Biol. 195, 439-445.

145. M.E. Ford, G.J. Sarkis, A.E. Belanger, R.W. Hendrix and G.F. Hatfull, Genome structure of mycobacteriophage D29: implications for phage evolution. J. Mol. Biol. 279 (1998), pp. 143-164.

146. F. Forti, P. Sabbattini, G. Sironi, S. Zangrossi, G. Deho and D. Ghisotti, Immunity determinant of phage-plasmid P4 is a short processed RNA. J. Mol. Biol. 249 (1995), pp. 869-878.

147. F. Forti, S. Polo, K. Lane, E. Six, G. Sironi, G. Deho and D. Ghisotti, Translation of two nested genes in bacteriophage P4 controls immunity specific transcription termination. J. Bacterial. 181 (1999), pp. 5225-5233.

148. Frey, J., and M. Bagdasarian. 1989. The molecular biology of IncQ plasmids, p. 7994. In C.M. Thomas (ed.), Promiscuous plasmids of Gram-negative bacteria. Academic Press, Ltd., London, United Kingdom.

149. Friedman S.A and S.J. Austin (1988) The PI plasmid-partition system synthesizes two essential proteins from an autoregulated operon. Plasmid 19, 103-112

150. Friedman, D., and Gottesman, M. (1983) Lytic mode of lambda development. In: lxxmbda II. Hendrix, W.R., Roberts J.W., Stahl, F.W., and Weisberg, R.A. (eds.). Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, pp. 21-51.

151. Fuller, R.S., Funnell, B.E., and Kornberg, A. (1984) The dnaA protein complex with the E. coli chromosomal replication origin (oriC) and other DNA sites. Cell, 38, 889-900.

152. Funnell B.E. (1988a) Mini-Pi plasmid partitioning: excess ParB protein destabilizes plasmids containing the centromere parS. J. Bacteriol. 170, 954-960

153. Funnell В E (1988b) Participation of Escherichia coli integration host factor in the PI plasmid partition system. Proc. Natl. Acad. Sci. USA 85, 6657-6661

154. Funnell B.E, (1991) The PI plasmid partition complex at parS: the influence of Escherichia coli integration host factor and of substrate topology'. J. Biol. Chem. 266 (1991), 14328-14337.

155. Funnell B.E. and L. Gagnier (1994) P1 plasmid partition: binding of PI ParB protein and Escherichia coli integration host factor to alter parS sites. Biochemie 76, 924-932.

156. M.E. Furth and S. Wickner (1983) Lambda DNA replication. In: R.W. Hendrix, J.W. Roberts, F.W. Stahl and R.A. Weisberg, Editors, Iximbda II, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1983). pp. 145-173

157. Gamas, P., A. C. Burger, G. Churchward, L. Caro, D. Galas, and M. Chandler. 1986. Replication of pSClOl: effects of mutations in the E. coli DNA binding protein IHF. Mol. Gen. Genet. 204:85-89.

158. Gerdes К. and S. Molin. Partitioning of plasmid Rl. (1986) Structural and functional analysis of the parA locus. J. Mol. Biol. 190,. 269-279

159. Germino. J., and D. Bastia. 1983. The replication initiator protein of plasmid R6K tagged with beta-galactosidase shows sequence-specific DNA-binding. Cell 32:131-140.

160. Germino, J., and D. Bastia. 1983. Interaction of the plasmid R6K-encoded replication initiator protein with its binding sites on DNA. Cell 34:125-134.

161. Geshelin, P, and Bems, K.I. (1974) Characterization and localization of the naturally occurring cross-links in vaccinia virus DNA. J Mol Biol 88: 785-796.

162. Ghisotti, D., Chiaramonte, R., Forti, F„ Zangrossi, S., Sironi, G., and Deh6, G. (1992) Genetic analysis of the immunity region of phage-plasmid P4. Mol Microbiol 6: 3405-3413.

163. Gibson F.R., Leach DR., Lloyd R.G. (1992) Identification of sbcD mutants as cosuppressors of recBC allow propagation of DNA palindromes in Escherichia coli K12 J. Bacteriol. 174, 1222-1228

164. Geisselsoder, J., Youderian, P., Deho, G,. Chidambaram, M., Goldstein, R., and Ljungquist, E. (1981) Mutants of satellite virus P4 that cannot derepress their bacteriophage P2 helper. J Mol Biol 148: 1-19.

165. Giraldo, R., and R. Diaz. 1992. Differential binding of wild-type and mutant RepA protein to oriR sequence suggest a model for the initiation of plasmid Rl replication. J. Mol. Biol. 28: 787-802.

166. Godfrin-Estevenon, A.M. Pasta, F. and Lane, D. (2002) The parAB gene products of Pseudomonas putida exhibit partition activity in both P. putida and Escherichia coli. Mol Microbiol, 43, 39-49.

167. С., Lappas, С., Markelz, В., Flanagan, С., Crowell, С., Gurson, J., Lomo, С., Sear, С., Strub, G., Cielo, C., and Slater, S. (2001) Genome sequence of the plant pathogen and biotechnology' agent Agrobacterium tumefaciens C58. Science. 294: 2323-2328.

168. Goosen N., van de Putte P. (1995). The regulation of transcription initiation by integration host factor. Mol Microbiol. 16, 1-7.

169. Gopaul, D.N., and Duyne, G.D. (1999). Stmcture and mechanism in site-specific recombination. Curr. Opin. Struct. Biol. 9, 14-20.

170. Gordon, G.S., D. Sitnikov, C.D. Webb, A. Teleman, A. Straight. R. Losick, A.W. Murray and A. Wright (1997). Chromosome and low copy plasmid segregation in E.coli: visual evidence for distinct mechanisms. Cell 90: 1113-1121

171. Grainge, 1., and Jayaram, M. (1999). The integrase family of recombinase: organization and function of the active site. Mol. Microbiol. 33,449-456

172. Grant, S.G., J. Jessee, F.R. Bloom and D. Hanahan. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc Natl Acad Sci USA 87: 4645-4649

173. Grigoriev P.S., Lobocka M.B. (2001). Determinants ofsegregational stability of the linear plasmid-prophage N15 of Escherichia coli. Mol Microbiol. 42, 355-368.

174. Gruss, A. D„ and S. D. Ehrlich. 1989. The family of highly interrelated single-stranded deoxyribonucleic acid plasmids. Microbiol. Rev. 53:231-241.

175. Guzman, L-M., Belin, D., Carson, M.J. and Beckwith, J. (1995) Tight regulation, modulation, and high-level expression by vectors containing arabinose Рцдо promoter./ Bacteriol 177,4121-4130.

176. Hanai. R., R. Liu, P. Benedetti, P.R. Caron, A.S. Lynch, A.S. and J.C. Wang. (1996). Molecular dissection of a protein SopB essential for Escherichia coli F plasmid partition. J. Biol. Chem. 271: 17469-17475

177. Hansen. E. В., and M. B. Yarmolinsky. 1986. Host participation in plasmid maintenance: dependence upon dnaA of replicons derived from PI and F. Proc. Natl. Acad. Sci. USA 83:4423-4427.

178. Haring, V. and E. Scherzinger. 1989. Replication proteins of the IncQ plasmids, p. 95-124. In С. M. Thomas (ed.), Promiscuous plasmids of Gram-negative bacteria. Academic Press, Ltd. London, United Kingdom.

179. Haring, V., P. Scholz, E. Scherzinger, J. Frev, K. Derbyshire, G. Hatfull, N. S. Willetts, and M. Bagdasarian. 1985. Protein RepC is involved in copy number control of the broad host range plasmid RSFIOIO. Proc. Natl. Acad. Sci. USA 82:6090-6094.

180. Hasunuma, К., and M. Sekiguchi. 1977. Replication of plasmid pSClOl in Escherichia coli K12: requirement for dnaA function. Mol. Gen. Genet. 154:225-230.

181. Hayakawa Y., T. Murotsu and K. Matsubara (1985) Mini-F protein that binds to a unique region for partition of mini-F plasmid DNA. J. Bacteriol. 163 (1985), 349-354.

182. Hayes F., L. Radnedge, M.A. Davis and S.J. Austin (1994) The homologous operons for PI and P7 plasmid partition are autoregulated from dissimilar operator sites. Mol. Microbiol. 11, 249-260

183. Hayes, F., Davis, M.A. and Austin, S.J. (1993) Fine-structure analysis of the P7 plasmid partition site. J Bacteriol, 175, 3443-3451.

184. Heisig, A., Riedel, H.D. Dobrinski, В., Lurz, R., and Schuster, H. (1989) Organization of the immunity region imml of bacteriophage PI and synthesis of the PI anti repressor. J Mol Biol 209: 525-538.

185. Hertwig, S„ Klein, I., bur/., R., Lanka, E., and Appel, B. (2003). PY54, a linear plasmid prophage of Yersinia enterocolitica with covalentlv closed ends. Mol. Microbiol 48,989-1003

186. Hertwig, S., I. Klein, V. Schmidt. S. Beck, J. A. Hammerl, and B. Appel (2003b). Sequence analysis of the genome of the temperate Yersinia enterocolitica phage PY54. J. Mol. Biol. 331:605-622.

187. R.W. Hendrix and R.L. Duda, Bacteriophage lambdal'aPa: not the mother of all lambda phages. Science 258 (1992), pp. 1145-1148.

188. R.W. Hendrix, M.C. Smith, R.N. Burns, M.E. Ford and G.F. Hatfull, Evolutionary-relationships among diverse bacteriophages and prophages: all the world's a phage. Proc. Natl Acad. Sci. USA 96 (1999), pp. 2192-2197.

189. Hertwig, S., Klein, I., Lur/., R., Lanka. E., and Appel, B. (2003). PY54, a linear plasmid prophage of Yersinia enterocolitica with covalentlv closed ends. Mol. Microbiol., 48,989-1003

190. Higashi, A., H. Sakai, Y. Honda, T. Tanaka, D. M. Miao, T. Nakamura, Y. Taguchi, T. Komano, and M. Bagdasarian. 1994. Functional features of oriV of the broad host range plasmid RSF1010 in Pseudomonas aeruginosa. Plasmid 31:196-200.

191. Hillenbrand, G., and W. L. Staudenbauer. 1982. Discriminatory function of ribonuclease H in the selective initiation of plasmid DNA replication. Nucleic Acids Res. 10:834-853.

192. Hinnebusch and A.G. Barbour, Linear plasmids of Borrelia burgdorferi have a telomeric structure and sequence similar to those of a eukaryotic virus. J. Bacteriol. 173 (1991), pp. 7233-7239.

193. Hinnebusch, J., and Tilly, K. (1993). Linear plasmids and chromosomes in bacteria. Mol Microbiol. 10:917-922.

194. Hiraga S., (1992) Chromosome and plasmid partition in Escherichia coli. Annu. Rev. Biochem. 61, 283-306

195. Hiraga S., Niki, H., Ogura, Т., Ichinose, C., Mori, H., Ezaki, В., and JalTe, A. (1989) Chromosome partitioning in Escherichia coli: novel mutants producing anucleate cells .J Bacteriol 171: 1496-1505.

196. Hirano, M., Mori, H., Onogi, 'Г., Yamazoe, M., Niki, H., Ogura, T. and Hiraga S. (1998) Autoregulation of the partition genes of the mini-F plasmid and the intracellular localization of their products in Escherichia coli. Mol Gen Genet, 257, 392-403

197. Holmes, M. L., F. Pfeifer, and M. L. Dyall-Smith. 1995. Analysis of the halobacterial plasmid pHK2 minimal replicon. Gene 153:117-121.

198. Honda Y., H. Sakai, T. Komano, and M. Bagdasarian. 1989. RepB' is required in trans for the two single-strand DNA initiation signals in oriV of plasmid RSF1010. Gene 80:155-159.

199. Horton, R.M., Cai, Z.L., Ho, S.N. and Pease, L.R. (1990) Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques, 8, 528535.

200. Huang C.H., Lin YS, Yang YL, Huang SVV, Chen CW (1998) The telomeres of Streptomvces chromosomes contain conserved palindromic sequences with potential to form complex secondary structures. Mol. Microbiol. 28, 905-916.

201. Huang WM, Lisa Joss L, Hsieh T-T and Casjens S (2004) Protelomerase Uses a Topoisomerase IB/Y-Recombinase Type Mechanism to Generate DNA Hairpin Ends J. Mol. Biol. 337, 77-92

202. Ingmer, H., E. L. Fong, and S. N. Cohen. 1995. Monomer-dimer equilibrium of the pSClOl RepA protein. J. Mol. Biol. 250:309-314.

203. Ioannou.P.A., Ammeniva,C.T., Games,J., Kroisel.P.M., Shi/.uya,H., Chen,C., Batzer,M.A„ de Jong,P. J. (1994) A new bacteriophage PI-derived vector for the propagation of large human DNA fragments. Nature Genet. 6, 84

204. Iriate, M., I. Lambermont, C. Kerbourch, and G.R. Comelis.(1998). Yersinia enierocolitica plasmid pYVe227, complete sequence. Direct submission to Genbank, accession AF102990.

205. Jacob, S. Brenner and F. Cuzin , (1963), On the regulation of DNA replication in bacteria. Cold Spring Harbor Symp. Quant. Biol. 28 329-348.

206. Jacob, F. (1981). Le Jen des Possibles, Librairie Arthe'me Fayard, Paris.

207. Jensen R.B. and K. Gerdes (1997) Partitioning of plasmid R1 .The I'arM protein exhibits ATPase activity and interacts with the centromere-like ParR-ParC complex. J. Mol. Biol. 269, 505-513

208. Jensen R.B. and K. Gerdes, (1999) Mcchanism of DNA segregation in prokaryotes: ParM partitioning protein of plasmid R1 co-localizes with its replicon during the cell cy cle. EMBOJ. 18, 4076-4084

209. Jensen R.B. and L. Shapiro, (1999) Chromosome segregation during the prokaryotic cell division cycle. Curr. Opin. Cell Biol. 11, 726-731

210. Jensen RB, Lurz R, Gerdes К (1998) Mechanism of DNA segregation in prokaryotes: replicon pairing by ParC of plasmid Rl. Proc. Natl. Acad. Sci. U. S. A. 95. 8550-8555 .

211. Jensen RB, Dam M, Gerdes K. (1994) Partitioning of plasmid RI. The parA operon is autoregulated by ParR and its transcription is highly stimulated by a downstream activating element. J. Mol. Biol. 236 1299-1309.

212. R.J. Juhala M.E. Ford, R.L. Duda A. Youlton, G.F. Hatfull and R.W. Hendrix, Genomic sequences of bacteriophages HK97 and HK022: pervasive genetic mosaicism in the lambdoid bacteriophages. J. Mol. Biol. 299 (2000), pp. 27-51.

213. Katsura, Determination of bacteriophage lambda tail length by a protein ruler. Nature 327 (1987), pp. 73-75.

214. Katsura and R.W. Hendrix, Length determination in bacteriophage lambda tails. Cell 39(1984), pp. 691-698

215. Kamio, Y., and Y. Terawaki. 1983. Nucleotide sequence of an incompatibility region of mini-Rtsl that contains five direct repeats. J. Bacteriol. 155:1185-1191.

216. Kelman, Z., and M. O'Donnell. 1995. DNA polymerase HI holoen/.yme: structure and function of a chromosomal replicating machine. Annu. Rev. Biochem. 64:171-200.

217. Kedzierska, A. Wawrzynow and A. Taylor. The Rzl gene product of bacteriophage lambda is a lipoprotein localized in the outer membrane of Escherichia coli. Gene 168 (1996), pp. 1-8

218. Z. Kelman and M. O'Donnell, DNA polymerase III holoenzyme: structure and function of a chromosomal replicating machine. Annu. Rev. Biochem. 64 (1995), pp. 171200.

219. Khan, S. A. 1996. Mechanism of replication and copy number control of plasmids in Gram-positive bacteria. Genet. Eng. 18:183-201.

220. Khan. S. A. 1997. Rolling-circle replication of bacterial plasmids. Microbiol. Mol. Biol. Rev. 61:442-455.

221. Kim S.K. and J.C. Wang, (1998) Localization of F plasmid SopB protein to positions near the poles of Escherichia coli cells. Proc. Natl. Acad. Sci. U. S. A., 15231527

222. Kim, S.K. and Shim, J. (1999) Interaction between F plasmid partition proteins SopA and SopB. Biochein Biophys Res Comrnun, 263, 113-117.

223. Kim U-J, Birren B.W., Slepak Т., Manchino V., Bousen C., Kang H-J, Simon М.1. Shizuya H. (1996) Construction and characterisation of Human Bacterial Artificial Chromosome library. Genomics 34, 213

224. Kirsebom, L. A. (1995) RNase P--a 'Scarlet Pimpernel'. Mol Microbiol 17:411 -420.

225. Kirsebom. L.A., Svard, S.G. (1994) Base pairing between Escherichia coli RNase P RNA and its substrate. UMBO J 13(20): 4870-4876.

226. Kitao and E. Nakano, Nucleotide sequence from bacteriophage phi 80 with high homology to the major coat protein gene of lambda. Nucl. Acids Res. 16 (1988), p. 764.

227. Kobrvn, K., and Chaconas, G. (2001) The circle is broken: telomere resolution in linear replicons. Curr. Opin. Microbiol., 4, 558-564.

228. Kobrvn, K. and Chaconas. G. (2002) ResT, a telomere resolvase encoded by the Lyme disease spirochete. Mol. Cell, 9, 195-201.

229. Kollek, R., W. Oertel, and W. Goebel. 1978. Isolation and characterization ofthe minimal fragment required for autonomous replication ("basic replicon") of a copy mutant (pKN102)of the antibiotic resistance factor Rl. Mol. Gen. Genet. 162:51-57.

230. Konieczny, 1.(2003) Strategies for helicase recruitment and loading in bacteria. EMBO reports, 4,37-41.

231. Konieczny, I., K. S. Doran, D. R. Helinski, and A. Blasina. 1997. Role ofTrfA and DnaA proteins in origin opening during initiation of DNA replication ofthe broad host range plasmid RK2. J. Biol. Chem. 272:20173-20178.

232. Kornberg, A., and T. Baker. 1992. In DNA replication. W. H. Freeman & Co., New York, N.Y.

233. Kozlowski. M., V. Thatte, P. С. K. Lau, L. P. Visentin, and V. N. Iyer. 1987. Isolation and structure ofthe replicon of the promiscuous plasmid pCUl. Gene 58:217-228.

234. Krevolin, M. D., and Calendar, R. (1985). The replication of bacteriophage P4 DNA in vitro. Partial purification ofthe P4 a gene product. J. Mol. Biol. 182, 509-517.

235. Krevolin. M. D„ Inman, R. В., Roof, D„ Kahn. M., and Calendar.R. (1985). Bacteriophage P4 DNA replication. Location ofthe P4 origin. J. Mol. Biol. 182, 519-527.

236. Kusukawa, N. Mori, H„ Kondo, A. and Hiraga, S. (1987) Partitioning ofthe F plasmid: overproduction of an essential protein for partition inhibits plasmid maintenance. Mol Gen Genet, 208, 365-372.

237. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227: 680-685.

238. Lane, D., Cavaille, J. and Chandler, M. (1994) Induction of the SOS response by 1S1 transposase. J Mol Biol, 242, 339-350.

239. Lane D., R. Rothenbuchler, A.-M. Merrillat and C. Aiken (1987) Analysis ofthe F plasmid centromere. Mol. Gen. Genet. 207 (1987), 406-412.

240. Leach.D.R. (1994) Long DNA palindromes, cruciform structures, genetic instability and secondary structure repair. Bioessays. 16: 893-900

241. Leach D., Lindsay J., Okelv E. (1987) Genome interactions which influence DNA palindrome mediated instability and inviability in Escherichia coli J. Cell. Sci. Suppl. 7(1), 33-40.

242. LeBowitz, J.H. & McMacken, R. (1986) The Escherichia coli dnaB replication protein is a DNA helicase. J. Biol. Chem., 261, 4738-4748.

243. Lee, E. II, A. Romberg, M. Hidaka, T. Kobayashi, and T. Horiuchi. 1989. Escherichia coli replication termination protein impedes the action of helicases. Proc. Natl. Acad. Sci. USA 86:9104-9108.

244. H. Lehnherr, E. Maguin, S. Jafri and M.B. Yannolinsky, Plasmid addiction genes of bacteriophage PI: doc, which causes cell death on curing of prophage, and phd, which prevents host death when prophage is retained./. Mol. Biol. 233 (1993), pp. 414-428.

245. Lemonnier. M., Bouet. J.Y., Libante, V. and Lane, D. (2000) Disruption of the F plasmid partition complex in vivo by partition protein SopA. Mol Microbiol, 38, 493-505

246. LessI, M„ Bal/er, D„ Lurz, R„ Waters, V.L., Guiney, D.G., and Lanka, E. (1992) Dissection of IncP conjugative plasmid transfer: definition of the transfer region Tra2 by mobilization of the Tral region in trans. J Bacteriol 174: 2493-2500.

247. M. Levin, R. Hendrix and S. Casjens, A programmed translational frameshift is required for the synthesis of a bacteriophage lambda tail assembly protein./. Mol. Biol. 234 (1993), pp. 124-139.

248. L.K. Lewis, G.R. Harlow, L.A. Gregg-Jolly and D.W. .Mount. Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J. Mol. Biol. 241 (1994). pp. 507-523.

249. Libante, V., Thion, L. and Lane, D. (2001) Role of the ATP-binding site of SopA protein in partition of the F plasmid. J Mol Biol, 314, 387-399

250. J. Lingner, J.P. Cooper and T.R. Cecil, Telomerase and DNA end replication: no longer a lagging strand problem?. Science 269 (1995), pp. 1533-1534

251. Lin, D. C-H. and A.D. Grossman. (1998). Identification and characterization of a bacterial chromosome partition site. Cell 92: 675-685

252. Lin, L. S., and R. J. Meyer. 1986. Directly repeated, 20 bp sequence of plasmid R1162 is required for replication, expression of incompatibility, and copy-number control. Plasmid 15:35-47.

253. Lindqvist, В. H., and Six, E. W. (1971). Replication of bacteriophage P4 DNA in a nonlysogenic host. Virology 43, 1-7.

254. Liu, Т., Renberg, S.K., and Haggard-Ljungquist, E. (1998) The E protein of satellite phage P4 acts as an anti-repressor by binding to the С protein of helper phage. Mol Microbiol Ж 1041-1050.

255. Lobocka M. A. Svarchevsky, V. Rybchin and M. Yarmolinsky, Characterization of the primary immunity region of the Escherichia coli linear plasmid prophage N15./. Bacteriol. 178 (1996), pp. 2902-2910

256. Lobocka, M. and Yarmolinsky, M. (1996) PI plasmid partition: a mutational analysis of ParB. J Mol Biol, 259, 366-382.

257. Lutz, R. and H. Bujard. (1997). Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/Ii-h regulatory elements. Nucleic Acids Res. 25: 1203-1210.

258. Lynch, A.S. and Wang, J.C. (1995) SopB protein-mediated silencing of genes linked to the sopC locus of Escherichia coli F plasmid. Proc Natl Acad Sci USA, 92, 1896-1900.

259. Manen, D., G. Xia, and L. Caro. (1994). A locus involved in the regulation of replication in plasmid pSClOl. Mol. Microbiol. 1 1: 875-884

260. Manen, D., L. C. Upegui-Gonzalez. and L. Caro. 1992. Monomers and dimers of the RepA protein in plasmid pSClOl replication: domains in RepA. Proc. Natl. Acad. Sci. USA 89:8923-8927.

261. Marians, K. J. (1992) I'rokaryotic DNA replication, Annu. Rev. Biochem., 61, 673719.

262. Martin K.A., M.A. Davis and S. Austin (1991), Fine-structure analysis of the Pl-plasmid partition site. J. Bacteriol. 173, 3630-3634

263. Masai, H„ Y. Kaziro, and K.-I. Arai. 1983. Definition of oriR, the minimum DNA segment essential for initiation of R1 plasmid replication in vivo. Proc. Natl. Acad. Sci. USA 80:6814-6818.

264. Masai, M., and K.-I. Arai. 1987. RepA and DnaA proteins are required for initiation ofRl plasmid replication in vitro and interact with the oriR sequence. Proc. Natl. Acad. Sci. USA 84:4781-4785.

265. Masai, M., and К. I. Arai. 1988. R1 plasmid replication in vitro: RepA- and DnaA-dependent initiation at oriR, p. 113-121. In R. E. Moses, and W. C. Sammers (ed.), DNA replication and mutagenesis. American Society for Microbiology, Washington, D.C.

266. Masukata H., and J. Tomizawa. 1990. A mechanism of formation of a persistent hybrid between elongating RNA and template DNA. Cell 62:331-338.

267. McCormick, M.B., Coulonibe, P.A. and Fuchs, E. (1991) Sorting out IF networks: consequences of domain sw apping on IF recognition and assembly. J Cell Biol, 113, 11111124.

268. J.P. McDonald, E.G. Frank, A.S. Levine and R. Woodgate, Intermolecular cleavage by UmuD-like mutagenesis proteins. Proc. Natl Acad Sci. USA 95 (1998), pp. 1478-1483.

269. M.P. McLenigan, O.I. Kulaeva, D.G. Ennis, A.S. Levine and R. Woodgate, The bacteriophage P1 HumD protein is a functional homolog of the prokarvotic UmuD'-like proteins and facilitates SOS mutagenesis in E. coli. J. Bacteriol. 181 (1999), pp. 70057013.

270. McEachem, M. J., Bolt, M. A., Tooker, P. A., and Helinski, D. R. (1989). Negative control of plasmid R6K replication: Possible role of intermolecular coupling of replication origins. Proc. Natl. Acad. Sci. USA 86, 7942-7946.

271. Mendelman, L.V., Beauchamp, B.B., and Richardson, C.C. (1994) Requirement for a zinc motif for template recognition by the bacteriophage T7 primase. EMBO J., 13: 39093916

272. Messer, W. (2002) The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol. Rev., 26: 355-374

273. Messer, W. and Weigel, C. (1997) DnaA initiator also a transcription factor. Mol. Microbiol. 24: 1-6.

274. Miller, J.H. (1972). Experiments in Molecular Genetics. Cold Spring Harbour Laboratory- Press, Cold Spring Harbour.N.Y.

275. Minden, J. S., and K. J. Marians. 1985. Replication of pBR322 DNA in vitro with purified proteins. Requirement for topoisomerase I in the maintenance of template specificity. J. BioI.Chem. 261:11906-11917.

276. Moller-Jensen, J., Jensen, R.B., Lowe, J. and Gerdes, K. (2002) Prokarvotic DNA segregation by an actin-Iike filament. Embo J, 21, 3119-3127.

277. Mori H., Y. Mori, C. Ichinose, H. Niki, T. Ogura, A. Kato and S. Hiraga (1989) Purification and characterization of SopA and SopB proteins essential for F plasmid partitioning. J. Biol. Chem. 264, 15535-15541

278. Mori II, A. Kondo, A. Ohshima, T. Ogura and S. Hiraga (1989) Structure and function of the F plasmid genes essential for partitioning. J. Mol. Biol. 174 (1986), 1-15

279. Motallebi-Veshareh, M„ D.A. Rouch and C.M. Thomas. (1990). A family of ATPases involved in active partitioning of diverse bacterial plasmids. Mol. Microbiol. 4: 1455-1463

280. Mukhopadhyav, G., К. M. Carr, J. M. Kaguni, and D. K. Chattoraj. 1993. Open-complex formation by the host initiator. DnaA, at the origin ofPl plasmid replication. EMBOJ. 12:4547-4554.

281. Murotsu, Т., К. Matsubara, H. Sugisaki, and M. Takanami. 1981. Nine unique repealing sequences in a region essential for replication and incompatibility of the mini-F plasmid. Gene 15:257-271.

282. Murray M.G., Thomson W.F. (1980) Rapid isolation of highmolecular weight plant DNA. 1980, Nucleic Acids Res., 8, 4321

283. Nash, H.A., and Robertson, C.A. (1989) Heteroduplex substrates for bacteriophage lambda site-specific recombination, cleavage and strand transfer products. 'Ibe EMBOJ, 8, 3523-3533

284. Nieto, C., R. Giraldo, E. Fernande/.-Tresguerres, and R. Diaz. 1992. Genetic and functional analysis of the basic replicon of pPSlO, a plasmid specific for Pseudomonas isolated from Pseudomonas syringae pathovar savastanoi. J. Mol. Biol. 223:415-426.

285. Niki H. and S. Hiraga, (1997) Subcellular distribution of actively partitioning F plasmid during the cell division cycle in E. coli. Cell 90, 951-957.

286. Niki H and S. Hiraga, (1999) Subcellular localization of plasmids containing the oriC region of the Escherichia coli chromosome, with or without the sopABC partitioning system. Mol. Microbiol. 34, 498-503

287. Nomura, N., and D. S. Ray. 1980. Expression of DNA strand initiation sequence of ColEl plasmid in a single-stranded DNA phage. Proc. Natl. Acad. Sci. USA 77:6566-6570.

288. Novick, R. P. 1987. Plasmid incompatibility. Microbiol. Rev. 51:381-395.

289. Novick, R. P. 1989. Staphylococcal plasmids and their replication. Annu. Rev. Microbiol. 43:537-565.

290. Nunes-Duby, S.E., К won, I I.J., Tirumalai, R.S., Ellenberger, Т., and Landy, A. (1998) Similarities and differences among 105 members of the Int family of site-specific recombinases. Nucleic Adds Res 26: 391-406.

291. Oakey,H.J., Cullen,B.R. and Owens,L. (2002) The complete nucleotide sequence of the Vibrio harveyi bacteriophage VHML. J. Appl. Microbiol. 93: 1089-1098

292. T. Ogura and S. Hiraga, Partition mechanism of F plasmid: two plasmid gene-encoded products and a cis-acting region are involved in partition. Cell 32 (1983), pp. 351360.

293. Ogura, T. Miki and S. Hiraga (1980) Copy-number mutants of the plasmid carrying the replication origin of the Escherichia coli chromosome: Evidence for a control region of replication. Proc. Natl. Acad. Sci. USA 77 (1980), 3993-3997

294. Ogura, Т., Niki, H., Mori, H., Morita, M., Hasegawa, M., Ichinose, C. and Hiraga, S. (1990) Identification and characterization of gyrB mutants of Escherichia coli that are defective in partitioning of mini-F plasmids. J Bacteriol, 172, 1562-1568

295. Olovnikov A. (1973) A theory of marginotomv. The incomplete copying oftemplate margin in enzymic synthesis of plynucleotides and biologica significance of the phenomenon.,/. Thcorct. Biol., 41, 181-190.

296. B.Il. Otto. S.J. van Dooren. J.H. Nuijens. J. Luirink and B. Oudega, Characterization of a hemoglobin protease secreted by the pathogenic Escherichia coli strain EB1. J. Exp. Med. 188 (1998), pp. 1091-1103.

297. Рак, M„ and S. Wickner. 1997. Mechanism of protein remodeling by ClpA chaperone. Proc. Natl. Acad. Sci. USA 94:4901-4906.

298. VV. Pansegrau and E. Lanka, A common sequence motif among prokaryotic DNA primases. Nucl. Acids Res. 20 (1992), p. 4931.

299. Pearson, W.R., and Lipman, D.J. (1988) Improved tools for biological sequence comparison. Proc Nad Acad Sci USA 85: 2444-2448.

300. Peck-Miller, К. A., and Allinan, S. (1991) Kinetics of the processing of the precursor to 4.5 S RNA, a naturally occurring substrate for RNase P from Escherichia coli. J Mol Biol 221: 1-5.

301. Pere/.-Casal, J., A. E. Gammie, and J. H. Crosa. 1989. Nucleotide sequence analysis and expression ofthe minimum Repl replication region and incompatibility determinants of pCo9lV-K30. J. Bacteriol. 171:2195-2201.

302. Perry, R.D., S.C. Straley, J.D. Fetherston, D.J. Rose, J. Gregor, J. and F.R. Blattner. (1998). DNA sequencing and analysis of the low-Ca^-response plasmid pCDl of Yersinia pestis KIM5. Infect. Immun 66: 4611-4623.

303. F. Piazza, M. Zappone, M. Sana, F. Briani and G. Deho, Polynucleotide phosphorylase of Escherichia coli is required for the establishment of bacteriophage P4 immunity. J. Bacteriol. 178 (1996), pp. 5513-5521.

304. Picardeau, M., Lobry, J.R., and Hinnebusch, B.J. (1999) Physical mapping of an origin of bidirectional replication at the centre of the Borrelia burgdorferi linear chromosome. Mol. Microbiol. 32, 437-445

305. Pinder,D.J., Blake,C.E., Lindsev,J.C., Leach,D.R. (1998) Replication strand preference for deletions associated with DNA palindromes. Mol.Microbiol. 28: 719-727

306. Piatt. R., Drescher, C\. Park, S-K, and Phillips, G. (2000). Genetic system for reversible integration of DNA constructs and lacZ gene fusions into the Escherichia coli chromosome. Plasmid, 43, 12-23.

307. Qin Z and Cohen S.N. (1998) Replication al the telomeres of the Streptomvces linear plasmid pSLA2. Mol. Microbiol., 28, 893-903

308. Radnedge, L„ Davis, М.Л. and Austin, S.J. (1996) PI and P7 plasmid partition: ParB protein bound to its partition site makes a separate discriminator contact with the DNA that determines species specificity. EMBO J, 15, 1155-1162.

309. Radnedge, L„ Youngren, В., Davis, M. and Austin, S. (1998) Probing the structure of complex macromolecular interactions by homolog specificity scanning: the PI and P7 plasmid partition systems. Embo J, 17, 6076-6085.

310. Rao,V.O„ Thaker.V., Black,L.W. (1992) A phage T4 in vitro packaging system for cloning long DNA molecules. Gene, 113, 25

311. Ravin, N.V. (2003) Mechanisms of replication and telomere resolution of the linear plasmid prophage N15. FUMS Microbiol Lett. 221: 1-6.

312. Ravin, N. & Lane D. (1999) Partition of the linear plasmid, N15: functional interactions with the sop locus of the F plasmid. J. Bacteriol., 181, 6898-6906.

313. Ravin, N.V., Kuprianov, V.V., Gilcrease, E.B., & Casjens, S.R. (2003) Bidirectional replication from an internal ori site of the linear N15 plasmid prophage. Nucleic Acids Res., 31,6552-6560.

314. Ravin N.V, Rech J., Lane D. (2003). Mapping of functional domains in F plasmid partition proteins reveals a bipartite SopB-recognition domain in SopA./. Mol. Biol., 329, 875-889.

315. Ravin. N.V., Strakhova, T.S., Kuprianov. V.V. (2001) The protelomerase of the phage-plasmid N15 is responsible for its maintenance in linear form. J. Mol. Biol., 312, 899-906

316. Ravin, N.V., Svarchevsky, A.N., and Deho, G. (1999) The antiimunitv system of phage-plasmid N15: identification of the antirepressor gene and its control by a small processed RNA. Mol. Microbiol. 34: 980-994.

317. Ravin V., Ravin N. Casjens S., Ford M„ Hatfull G., Hendrix R. (2000). Genomic sequence and analysis of the atypical bacteriophage N15. J. Mol. Biol., 299. 53-73

318. Ravin, V.K. and Shulga M.G. (1970) Evidence for extrachromosomal location of prophage N15. Virology, 40, 800-807.

319. Reece, K.S. and Phillips, G.J. (1995) New plasmids carrying antibiotic-resistance cassettes. Gene, 165, 141-142.

320. Riedel, H.-D., Heinrich, J., and Schuster, H. (1993) Cloning, expression, and characterization of the icd gene in the imml operon of bacteriophage PI./ Bacteriol 175: 2833-2838.

321. Rodionov, O., Lobocka M. and Yarmolinsky, M. (1999) Silencing of genes flanking the PI plasmid centromere. Science, 283, 546-549.

322. D.B. Roth, J.P. Menetski, P.B. Nakajima, M.J. Bosma and M. Gellert, V(D)J recombination: broken DNA molecules with covalcntly sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70 (1992), pp. 983-991.

323. Rozanov DV, D'Ari R, Sineokv SP (1998) RecA-independent pathways of lambdoid prophage induction in Escherichia coli. J Bacteriol. 180: 6306-15.

324. V.N. Rybchin and A.N. Svarchevsky, The plasmid prophage N15: a linear DNA with covalently closed ends. Mol. Microbiol. 33 (1999), pp. 895-903.

325. Sabbattini, P., Forti, F., Ghisotti, D., and Deho, G. (1995) Control of transcription termination by an RNA factor in bacteriophage P4 immunity: identification of the target sites./ Bacteriol 177: 1425-1434.

326. Sabbattini, P., Six, E„ Zangrossi, S„ Briani, F„ Ghisotti, D., and Deho, G. (1996) Immunity specificity determinants in the P4-like retronphage nR73. Virology 216: 389-396.

327. Sakai, H., and T. Romano. 1996. DNA replication of the IncQ broad-host-range plasmids in gram-negative bacteria. Biosci. Biotechnol. Biochem. 60:377-382.

328. Sambrook, E.J. Fritsch and T. Maniatis. Molecular Cloning: A Laboratory Manual (2nd edit, ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).

329. F. Sanger, A.R. Coulson, G.F. Hong, D.F. Hill and G.B. Petersen, Nucleotide sequence of bacteriophage lambda DNA. J. Mol. Biol. 162 (1982), pp. 729-773.

330. Sasaki, I., and Bertani, G. (1965) Growth abnormalities in Hfr derivatives of Escherichia coli strain C. J. Gen. Microbiol. 40, 365-376.

331. Scherzinger, E., M. M. Bagdasarian, P. Scholz, R. Lurz, B. Ruckert, and M. Bagdasarian.1984. Replication of the broad host-range plasmid RSF1010: requirement for three plasmid encoded proteins. Proc. Natl. Acad. Sci. USA 81:654-658.

332. Scherzinger, E., V. Haring, R. Lurz, and S. Otto. 1991. Plasmid RSF1010 DNA replication in vitro promoted by purified RSF1010 RepA, RepB and RepC proteins. Nucleic Acids Res. 19:1203-1211.

333. Scholz, P., V. Haring, B. Wittmann-Liebold, K. Ashman, M. Bagdasarian, and E.

334. Scherzinger. 1989. Complete nucleotide sequence and gene organization of the broad-host-range plasmid RSF1010. Gene 75:271-288.

335. Schnos, M., and Inman, R.B. (1970). Position of branch point in replicating lambda DNA. J. Mol. Biol., 51, 61-73.

336. Schroth G.P., Ho P.S.(1995) Occurrence of potential cruciform and H-DNA forming sequences in genomic DNA Nucleic Acids Res. 23, 1977-1983.

337. Scott, J.R., West, B.W., and Laping, J.L. (1978) Superinfection immunity and prophage repression in phage PI. Virology 85: 587-600.

338. Sharpe M.E. and J. Errington, (1999) Upheaval in the bacterial nucleoid. An active chromosome segregation mechanism. Trends Genet. 15, 70-74

339. Shi, J., & Biek, D.P. (1995) A versatile Iow-copy-number cloning vector derived from plasmid F. Gene, 164, 55-58.

340. Shizuya,H., Birren.B., Kim,U-J., Manchino,V., Slepac.T, Tachiiri.Y., Simon,M.I. (1992) Cloning and stable maintainance of 300-kilobase-pair fragments of human DNA in Echerichia coli using an F-factor-based vector. Proc.Natl.Acad.Sci.USA, 89, 8794

341. Shuman, S. (1998). Vaccinia virus DNA topoisomerase: a model eukaryotic type IB enzyme. Biochim. Biophys. Acta 1400, 321-337.

342. Shurvinton C.E., Stahl MM., Stahl F.M. (1987) Large palindromes in the lambda phage genome are preserved in a Rec* host by inhibiting lambda DNA replication // Proc.Natl. Acad. Sci. USA. 84, 1624-1628.

343. Simons, R.W., F. Houman and N. Kleckner.(1987). Improved single and multicopy lac-based cloning vector for protein and operon fusions. Gene 53: 85-96.

344. Sinden,R. (1994) Cruiciform structures in DNA, in "DNA: Structure and Functions", Academic Press, San Diego, CA

345. Sinden DR., Zheng G.X., Brankamp R.G., Allen K. (1991) On the deletion of inverted repeated DNA in Escherichia coli: effect of length, thermal stability and cruciform formation in vivo. Genetics. 129, 991-1005

346. Sinderen D. van, H. Karsens, J. Kok, P. Terpstra, M.H. Ruiters, G. Venema and A. Nauta, Sequence analysis and molecular characterization of the temperate lactococcal bacteriophage rlt. Mol. Microbiol. 19 (1996), pp. 1343-1355.

347. Srutkowska S, Konopa G, Wegrzyn G., (1998) A method for isolation of plasmid DNA replication intermediates from unsynchronized bacterial cultures for electron microscopy analysis. Acta Biochim Pol. 45: 233-240.

348. Stalker, D. M., С. M. Thomas, and D. R. Helinski. 1981. Nucleotide sequence of the region of the origin of replication of the broad host range plasmid RK2. Mol. Gen. Genet. 181:8-12.

349. Stenzel, Т. Т., Т. MacAllister, and D. Bastia. 1991. Cooperativity at a distance promoted by the combined action of two replication initiator proteins and a DNA bending protein at the replication origin ofpSClOl. Genes Dev. 5:1453-1463.

350. Stenzel, Т. Т., P. Pate!, and D. Bastia. 1987. The integration host factor of Escherichia coli binds to bent DNA at the origin of replication of the plasmid pSClOl. Cell 49:709-717.

351. Sternberg N., Hoess R.(1983) 'Hie moleculae genetic of bacteriophage PI. 1983, Ann.Rev.Genet., 17, 123

352. Sternberg N. (1990) Bacteriophage PI cloning system for the isolation, amplification and recovery1 of DNA fragments as large as 100 kilobase pairs. Proc.Natl.Acad.Sci. USA, 87, 103

353. Stewart, P., Chaconas, G., and Rosa, P. (2003) Conservation of plasmid maintenance functions between linear and circular plasmids in Borrelia burgdorferi. J. Bacterial., 185:3202-3209

354. Susskind, M.M., and Botstein, D. (1975) Mechanism of action of Salmonella phage P22 antirepressor. J Mol Biol 98: 413-424.

355. Swindells, M. B. 1995. Identification of a common fold in the replication terminator protein suggests a possible model for DNA binding. Trends Biochem. Sci. 20:300-302.

356. Tait, R. С., С. 1. Kado, and R. L. Rodriguez. 1983. A comparison of the origin of replication of pSa with R6K. Mol. Gen. Genet. 192:32-38.

357. Tamanoi, F., Saito, H., and Richardson, С. C. (1980). Physical mapping of primary and secondary origins of bacteriophage T7 DNA replication. Proc. Natl. Acad. Sci. USA 77, 2656-2660.

358. Tang, X. В., D. D. Womble, and R. H. Round. 1989. DnaA protein is not essential for replication of incF II plasmid NR1. J. Bacteriol. 171:5290-5295.

359. M. Tang, X. Shen, E.G. Frank, M. O'Donnell, R. Woodgale and M.F. Goodman, UmuD'(2)C is an error-prone DNA polymerase, Escherichia coli pol V. Proc. Natl Acad. Sci. USA 96 (1999), pp. 8919-8924.

360. Taylor, K., and Wegrzvn, G. (1995) Replication of coliphage lambda DNA. FEMS Microbiol. Rev. 17, 109-119.

361. Tetart, F., Desplats, C. & Krisch, H. (1998). Genome plasticity in the distal tail fibre locus of theT-even bacteriophage: recombination between conserved motifs swaps adhesin specificity. J. Mol. Biol. 282, 543-556

362. K. Tilly, Independence of bacteriophage N15 lytic and linear plasmid replication from the heat shock proteins Dnal, DnaK and GrpE. J. Bacteriol. 173 (1991), pp. 66336642.

363. Tocchetti, A., Serina, S., Terzano, S„ Deho, G., and Ghisotti, D. (1998). Identification of two replicons in phageplasmid P4. Virology' 245, 344-352.

364. Tocchetti, A., Galimberti. G., Deh6, G., and Ghisotti, D.(1999). Characterization of the oril and orill origins of replication in phage-plasmid P4. J. Virol. 73, 7308-7316.

365. Tolun, A., and D. R. Helinski. 1981. Direct repeats of the plasmid incC region express F incompatibility. Cell 24:687-694.

366. Tomizawa J., Y. Sakakibara, and T. Kakefuda 1975. Replication of colicin El plasmid DNA added to cell extracts. Proc. Natl. Acad. Sci. USA 72:1050-1054.

367. Tomizawa, J. 1975. Two distinct mechanisms of synthesis of DNA fragments on colicin El plasmid DNA. Nature 257:253-254.

368. Thresher, R., and Griffith, J. (1992) Electron microscopic visualization of DNA and DNA-protein complexes as adjunct to biochemical studies. Methods in Enzymology, 211, 481-490.

369. Uhlin, В. E., and K. Nordstrom. 1978. A runaway-replication mutant of plasmid Rldrd-19: temperature-dependent loss of copy number control. Mol. Gen. Genet. 165:167179.

370. Vostrov, О. Vostrukhina, A. Svarchevsky and V. Rybchin, Proteins responsible for lysogenic conversion caused by coliphages N15 and phi80 are highly homologous. J. Bacteriol. 178 (1996), pp. 1484-1486.

371. Walker J.E., M. Saraste and N.J. Gay. (1982). 1С. coli Fl-ATPase interacts with a membrane protein component of a proton channel. Nature 298: 867-869

372. Wandersman, C., and Yarmolinskv, M. (1977) Bipartite control of immunity conferred by the related heteroimmune plasmid prophages, PI and P7 (formerly Amp). Virology 77: 386-400.

373. Wang, J.C. (1996). DNA topoisoinerases. Annu. Rev. Biochein. 65, 635-692.

374. Watson J. (1972) Origin of concatemeric T7 DNA. Nature New Biol, 239, 197-201.

375. Wegrzyn, G. Wegrzyn and K. Taylor (1995) Plasmid and host functions required for lambda plasmid replication carried by the inherited replication complex. Mol. Gen. Genet. 247(1995), pp. 501-508

376. Wegrzyn, G., Wegrzyn, A., Konieczny I., Bielawski K., Konopa G., Obuchowski M., helinski D.R., and Taylor, K. (1995) Involvement of the host initiator function dnaA in the replication of coliphage lambda Genetics, 139, 1469-1481.

377. Wegrzyn, G., Wegrzyn, A.,Panikiewicz A, & Tay lor, К. (1996) Allele specificity of the Escherichia coli dnaA gene function in the replication of plasmids deric\ved from phage lambda. Mol. Gen. Genet., 252, 580-586.

378. Weslon-Hafer K., Berg D.E. (1991) Limits to the role of palindrome in deletion formation. J. Bacteriol. 173, 315-318.

379. Wickner, S., and D. Chattoraj. 1987. Replication of mini-Pi plasmid DNA in vitro requires two initiation proteins, encoded by the rep A gene of phage PI and the dnaA gene of Escherichia coli. Proc. Nail. Acad. Sci. USA 84:3668-3672.

380. Wickner, S., J. Hoskins, and K. McKenney. 1991. Function of DnaJ and DnaK as chaperones in origin-specific DNA binding by RepA. Nature 350:165-167.

381. W.B. Whitman, D.C. Coleman and W.J. Wiebe, Prokaryotes: the unseen majority. Proc. Natl Acad. Sci. USA 95 (1998), pp. 6578-6583.

382. Woelker, В., and W. Messer. 1993. The structure of the initiation complex at the replication origin, oriC, of Escherichia coli. Nucleic Acids Res. 21:5025-5033.

383. Woese, C. R., O. Kandler, and M. L. Wheelis. 1990. Towards a natural system of organisms. Proposal for the domains Archaea, Bacteria and Eucarya. Proc. Natl. Acad. Sci. USA 87:4576-4579.

384. D.L. Wulff, Y.S. Ho, S. Powers and M. Rosenberg, The int genes of bacteriophages P22 and lambda are regulated by different mechanisms. Mol. Microbiol. 9 (1993), pp. 261 — 271

385. Yagil, E., Dolev, S., Oberto, J., and Weisberg, R. (1989) Determinants of site-specific recombination in the lambdoid coliphage HK022. An evolutionary change in specificity. J Mol Biol 207: 695-717

386. Yamaichi, Y. and Niki, H. (2000) Active segregation by the Bacillus subtilis partitioning system in Escherichia coli. Proc Natl Acad Sci USA, 97, 14656-14661.

387. Yanisch-Perron, J. Vieira and J. Messing, Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC 19 vectors. Gene 33 (1985), pp. 103-119.

388. Yankovski.N.K., Fonstein.M.Yu. Debabov.V.G. (1985) Monomer circular phasmid DNA molecules can be efectively packaged in vitro and used as vector DNA molecules. Biolech'85 Europe, 1985, Geneva, 709-714

389. Yankovski.N.K., M.Yu.Fonstein, S.Yu.Lashina, N.O.Bukanov, N.V.Yakubovich, L.M.Ermakova. B.A.Rebentish, A.A.Janulaitis, V.G.Debabov. (1989) Phasmids as effective and simple tools for construction and analysis of gene libraries. 1989, Gene, 81, 203-210

390. Yarmolinsky and N. Sternberg, Bacteriophage PI. In: R. Calendar, Editor, The Bacteriophages vol. 1, Plenum Press, New York (1988), pp. 291-438.

391. Yates P., D. Lane and D.P. Biek (1999) The F plasmid centromere, sopC, is required for full repression of the sopAB operon. J. Mol. Biol. 290, 627-638

392. Yates, P. A. (1997). Studies of mutations affecting the replication and partition of the mini-F plasmid in Escherichia coli. PhD thesis. University of Kentucky, Lexington, K.Y, U.S.A.

393. Youngren B. and S. Austin (1997) Altered ParA partition proteins of plasmid PI act via the partition site to block plasmid propagation. Mol. Microbiol. 25, 1023-1030.

394. Yun, Т., Yanpnek, D., (1977). Electron microscope analysis of bacteriophage PI, PI Cm and P7. Determination of genomic size, sequence homology, and location of antibiotic-resistance determinants. Virol. 77, 376-385.

395. Zavitz, К. H., and K. J. Marians. 1991. Dissecting the functional role of PriA protein-catalyzed primosome assembly in Escherichia coli DNA replication. Mol. Microbiol. 5:2869-2873.

396. N. Zhang and R. Young, Complementation and characterization of the nested Rz and Rzl reading frames. Mol. Gen. Genet. 262 (2000), pp. 659-667

397. Ziegelin, G., and Lanka, E. (1995). Bacteriophage P4 DNA replication. FEMS Microbiol. Rev. 17,99-107.

398. Ziegelin, G., Calendar, R., Lurz, R., and Lanka, E. (1997b). The helicase domain of phage P4 a protein overlaps the specific DNA binding domain. J. Bacteriol. 179, 40874095.

399. Ziegelin, G., Linderoth, N. A., Calendar, R., and Lanka, E. (1995). Domain structure of phage P4 a protein deduced by mutational analysis. J. Bacteriol. 177, 4333-4341.

400. Ziegelin, G., Scherzinger, E., Lurz, R., and Lanka, E. (1993). Phage P4 a protein is multifunctional with origin recognition, helicase and primase activities. EMBO J. 12, 37033708.

401. Zillig, W„ A. Kletzin, C. Schleper, 1. Holz, D. Janekovick, J. Hain. M. Lanzendorfer, and J. K. Kristjansson. (1994). Screening for Sulfolobales, their plasmids and their viruses in Icelandic solfataras. Syst. Appl. Microbiol. 16:609-628.

402. Zuker.M., and Stiegler, P. (1981) Optimal computer folding of large RNA sequences using thermodynamics and auxiliary- information. Nucleic Acids Res 9: 133-148.

Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания. В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.