Изменение эпигенетического статуса плюрипотентных клеток человека в процессе дифференцировки in vitro тема диссертации и автореферата по ВАК 03.00.15, кандидат биологических наук Волчков, Павел Юрьевич

Диссертация и автореферат на тему «Изменение эпигенетического статуса плюрипотентных клеток человека в процессе дифференцировки in vitro». disserCat — научная электронная библиотека.
Автореферат
Диссертация
Артикул: 339350
Год: 
2008
Автор научной работы: 
Волчков, Павел Юрьевич
Ученая cтепень: 
кандидат биологических наук
Место защиты диссертации: 
Москва
Код cпециальности ВАК: 
03.00.15
Специальность: 
Генетика
Количество cтраниц: 
112

Оглавление диссертации кандидат биологических наук Волчков, Павел Юрьевич

Список сокращений

Введение

Глава I. Обзор литературы.

1.1 Эпигенетические модификации при оплодотворении и развитии эмбриона.

1.2 Репрограммирование генома in vitro.

1.3 Метилирование ДНК. Механизмы de novo метилирования.

1.4 Регуляция экспрессии генов опосредованная РНК - интерференцией.

1.5 Роль метилирования ДНК в регуляции транскрипции генов.

2.1 ЭСК человека, как модельный объект для изучения раннего эмбриогенеза.

2.2 Потенциал дифференцировки ЭСК человека.

2.3 Дифференцировка ЭСК в гематопоэтические и эндотелиальные клетки.

2.4 Регуляция плюрипотентности и самоподдержания ЭСК.

Глава П. Материалы и методы

Глава III. Результаты исследований и их обсуждение

3.1.1 Различие в эпигенетическом статусе линий ЭСК человека не затрагивает метилирования регуляторных районов генов ключевых транскрипционных факторов, необходимых для самоподдержания и сохранения плюрипотентности.

3.1.2 Эпигенетический статуе регуляторных областей ОСТ-4 ассоциированных генов DPPA-3 и DPPA-5 варьирует в разных линиях ЭСК человека, но не влияет на их экспрессию.

3.2.1 Получение эндотелиальных клеток из ЭСК человека в двумерной системе.

3.2.2 Селекция и анализ эндотелиальных клеток из дифференцированных ЭСК человека.

3.2.3 Подбор антител для селекции эндотелиальных клеток 67 3.3.1 Роль метилирования в регуляции экспрессии генов GATA-2, GATA-3 при дифференцировке ЭСК человека в эндотелий.

3.3.2 Метилирование промоторной области гена eNOS при дифференцировке ЭСК человека в клетки эндотелия.

Выводы

Введение диссертации (часть автореферата) На тему "Изменение эпигенетического статуса плюрипотентных клеток человека в процессе дифференцировки in vitro"

Одним из эпигенетических механизмов, регулирующих экспрессию генов, является метилирование регуляторных областей генов, приводящее к активации или ингибированию соответствующих генов. Как известно, на ранних стадиях эмбрионального развития происходят значительные изменения уровня метилирования генома. Пассивное деметилирование идет до стадии предимплантанционной бластоцисты. Со стадии бластоцисты в клетках внутренней клеточной массы идет тотальное de novo метилирование генома, которое участвует в репрессии повторяющихся элементов генома и способствует тканеспецифичсской дифференцировке. Пассивное тотальное деметилирование, а затем метилирование генома на ранних стадиях развития - это часть репрограммирования генома in vivo. Оно необходимо для того, чтобы родительские геномы освободились от гамето - специфичного эпигенетического паттерна, вследствие чего достигается тотипотентпость бластомеров. Затем, по мере развития эмбриона, происходит специализация клеток и приобретение тканеспецифического эпигенетического статуса. При переносе в ооцит соматического ядра должно происходить репрограммирование генома, однако, оно происходит не полностью. Это приводит к разнообразным нарушениям в экспрессии генов, в том числе и ключевых транскрипционных факторов, необходимых для нормального развития эмбриона. Эмбриональные стволовые клетки (ЭСК) человека предоставляют широкие возможности для изучения биологии развития человека, молекулярных механизмов дифферепцировки и поддержания плюрипотентности, а также открывают огромные перспективы использования ЭСК для лечения широкого спектра заболеваний. Одной из основных задач на пути к применению производных ЭСК человека является разработка технологий контролируемой дифференцировки ЭСК и получение иммунологически совместимых с реципиентом клеток. Возможное решение проблемы иммунологической совместимости -это получение линий ЭСК путем переноса ядер соматических клеток реципиента в ооцит. Однако, для этого должна быть решена проблема неполного репрограммирования генома при переносе ядер.

Таким образом, исследование эпигеиетической регуляции поддержания плюрипотентности и дифференцировки ЭСК человека и разработка методов получения необходимых типов клеток из ЭСК человека являются актуальными задачами.

Глава I. Обзор литературы.

1.1 Эпигенетические модификации при оплодотворенни и развитии эмбриона.

Термин эпигенетика произошел от термина эпигенезис, который обозначал отображение генома клетки во время развития, дающее определенный фенотип клетки. В настоящее время под эпигенетическими механизмами понимаются наследуемые изменения в функционировании генов, не связанные с изменением последовательности ДНК. Эпигенетические модификации генома - это метилирование ДНК, метилирование и ацетилирование гистонов, организация негистоновых белков хроматина. Эпигенетические модификации обратимы. Эпигенетические модификации генома служат для закрепления определенного статуса хроматина, открытого или закрытого. Модификации гистонов и метилирование ДНК тесно связаны. Метилирование ДНК может приводить к модификации гистонов и, наоборот, модификация гистонов может приводить к метилированию ДНК (Jaenisch, R., Bird, А., 2003). Принято считать, что метилирование ДНК служит для того, чтобы маркировать неактивную область генома. Модификации гистонов могут быть как активирующие, так и репрессирующие. На основании данных о соответствии модификаций гистонов активному или неактивному состоянию была выдвинута гипотеза о гистоновом коде, в которой сопоставляется модификация гистонов по определенным аминокислотным остаткам и состояние хроматина, которому они соответствуют (Jenuwein, Т., Allis, C.D., 2001).

В процессе эмбрионального развития, гаметогенеза и при тканеспецифической дифференцировке геном подвергается изменению паттерна метилирования ДНК и модификаций гистонов. На ранних стадиях развития женские первичные половые клетки арестованы на стадии профазы мейоза I, а мужские зародышевые клетки арестованы на стадии митоза до тех пор, пока не восстановится сперматогенез (Morgan, H.D., et al., 2005). Эпигенетический статус первичных половых клеток до миграции в зародышевый гребень существенно не отличаются от прочих клеток эпибласта, включая случайную инактивацию X хромосомы, ДНК метилирование и экпрессию импринтирующихся генов (Szabo, Р.Е., 2002). Позже, вместе с тотальным деметилированием первичных половых клеток, исчезает разница между импринтируемыми генами (Hajkova, P., et al., 2002). Деметилирование генома первичных половых клеток идет в присутствии поддерживающей ДНК метилтрансферазы DNMT1, поэтому есть предположения, что деметилирование на этой стадии осуществляется активно. Однако, деметилирование не затрагивает многие семейства ретротранспозонов генома. Во время гаметогенеза одновременно с созреванием гамет идет тотальное de novo метилирование генома (Hajkova, P., et al., 2002). После оплодотворения родительские геномы находятся на разных стадиях клеточного цикла, отличаются степенью компактизации хроматина и эпигенетическим статусом. Хроматин отцовского генома вместо гистонов содержит протамины. Материнский геном находится на стадии метафазы II и содержит гистоны. После оплодотворения протамины в отцовском хроматине заменяются гистонами, а материнский геном завершает мейоз. Гистоны НЗ и Н4, которые ассоциированы с отцовским хроматином, более ацетилированы, чем те, которые уже присутствуют в материнском хроматине (Adenot, P.G., et al., 1997, Santos, F., et al., 2002). Это может быть или следствием пассивного включения имеющихся гистонов из цитоплазмы, которые более ацетилированы, или активного включения более ацетилированных вариантов гистонов. После замены протаминов на гистоны в отцовском геноме наблюдается тотальная потеря метилирования (Santos, F., et al., 2002, Mayer, W., et al., 2000, Dean, W., et al., 2001, Beaujean, N. et al., 2004, Fulka, H., et al., 2004, Oswald, J., et al., 2000, Lane, N. et al., 2003). Деметилирование завершается до начала репликации ДНК в отцовском пронуклеусе. Некоторые участки генома не деметилируются на этой стадии, например, гетерохроматин в прицентромерных областях, ретротранспозоны, импринтируемые гены. Механизм и функции деметилирования отцовского генома пока не известны. Ясно то, что цитоплазма ооцита содержит агенты, деметилирующие отцовский геном.

Деметилирование отцовского генома необходимо для обеспечения транскрипционной активности. У некоторых видов отцовский геном активируется раньше, чем материнский (Aoki, F., et al., 1997). Для видов, у которых геном активируется на более ранних стадиях эмбрионального развития, показано более интенсивное деметилирование генома в зиготе, чем у видов с более поздней активацией (Memili, Е., et al., 2000). Деметилирование является частью процесса, который возвращает высокоспециализированному геному гамет эмбриональную тотипотентность.

Материнский хроматин не претерпевает таких серьёзных изменений, как отцовский. В материнском геноме статус метилирования ДНК и модификации гистонов соответствует как активным, так и неактивным состояниям (Adenot, P.G., et al., 1997, Santos, F„ et al., 2002, Cowell, I.G., et al., 2002, Reik, W., et al., 2003, Liu, H., et al., 2004, Lepikhov, K., et al., 2004, Erhardt, S., et al., 2003, Kourmouli, N., et al., 2004, Arney, K.L., et al., 2002).

Как уже упоминалось, гистоны, которые включаются в отцовский хроматин, гипер ацетилированы, однако, пока ДНК не полностью деметилирована в отцовском хроматине, можно наблюдать гистоны, метилированные по НЗК4, НЗК9 и НЗК27. Возможно, подобные модификации гистонов предназначены для предотвращения деметилирования этих областей генома. Появление метилированных гистонов свидетельствует об их деацетилировании и последующем монометилировании гистонметилтрапсферазами (Wang, Н., et al., 2001, Tachibana, ML, et al., 2002, Dodge, J.E., et al., 2004). Ди- и триметилирование аминокислотных остатков гистонов происходит позднее, например, модификация НЗК9теЗ появляется приблизительно па стадии 4 клеток (Santos, F., et al., 2005). Модификация гистонов отцовского генома ведет к тому, что он приближается по состоянию модификации к материнскому.

С одноклеточной стадии до стадии бластоцисты происходит значительное изменение в глобальном метилировании генома и модификации гистонов. Уровень метилирования ДНК уменьшается в соответствии с увеличением количества делений (Monk, М., et а!., 1987). Понижение уровня метилирования ДНК является следствием репликации ДНК (Howlett, S.K., et al., 1991) и неравного уровня метилирования сестринских хроматид. ДНК метилтрансфераза DNMT1, находившаяся в цитоплазме ооцита, не проникает в ядро в течение первых трёх делений (Carlson, L.L., et al., 1992, Bestor, Т.Н., et al., 2000), то есть, происходит пассивное деметилирование генома. Большинство различных последовательностей теряет метилирование на этой стадии, но импринтируемые гены сохраняют свой уровень метилирования. DNMT1 метилтрансфераза входит в ядро только на стадии 8 клеточного эмбриона. Каким образом поддерживается уровень метилирования в некоторых областях, не ясно. Возможно, модификации гистонов способствуют поддержанию уровня метилирования импринтируемых генов. В геноме мыши глобальный уровень модификации гистонов НЗК4ше, НЗК9те и НЗК9те2 во время пассивного деметилирования изменяется незначительно (Erhardt, S., et al., 2003), но данные, полученные на эмбрионах быка, показывают уменьшение НЗК9те2 и увеличение НЗК9ас, что свидетельствует об общей активации генома (Santos, F., et al., 2003).

Формирование бластоцисты сопровождается появлением двух типов клеток: клеток трофобласта и клеток внутренней клеточной массы. На стадии восьми -шестнадцатиклеточной морулы клетки, расположенные внутри, преимущественно становятся клетками внутренней клеточной массы, а клетки, расположенные снаружи, -клетками трофобласта (Johnson, М.Н., et al., 2004). Под действием активного и пассивного деметилирования в клетках трофобласта наблюдается низкий уровень метилирования (Santos, F., et al., 2002, Santos, F., et al., 2003, Manes, C., et al., 1981), в то время как в клетках внутренней клеточной массы идет интенсивное de novo метилирование (Santos, F.,et al., 2002), которое осуществляет DNMT3b, присутствующая в клетках внутренней клеточной массы и отсутствующая в клетках трофобласта (Watanabe, D., et al., 2002). De novo метилирование должно способствовать тканеспецифической дифференцировке, а также репрессировать потенциально транскрипционо активные повторяющиеся элементы генома. После имплантанции эмбриона, помимо de novo метилирования, в поддержание уровня метилирования существенный вклад вносит ДНК метилтрансфераза DNMT1 (Lei, Н., et al., 1996). Также было показано, что DNMT3a и DNMT3b необходимы для стабильного поддержания уровня метилирования ДНК в ЭСК мыши. Инактивация DNMT3a и DNMT3b приводит к деметилированию 5' области гена Xist, различно метилированной области (DMR) гена Igf2 и последовательному деметилированию повторяющихся последовательностей (Okano, М., et al., 1999).

Уровнь метилирования генома в клетках внутренней клеточной массы существенно выше, чем в клетках трофобласта. Разница в уровне метилирования наблюдается у всех исследованных видов млекопитающих (Santos, F., et al., 2002, Beaujean, N., et al., 2004, Santos, F., et al., 2003, Manes, C., et al., 1981). Уровень репрессивных модификаций гистонов в клетках внутренней клеточной массы также выше, чем в клетках трофобласта. Экспрессия метилтрансфераз необходима для нормального развития эмбриона и получения эмбриональных стволовых клеток (Li, Е., et al., 1992, Okano, М., et al., 1999, Erhardt, S., et al., 2003, Dodge, J.E., et al., 2004, Tachibana, M., et al., 2002).

1.2 Репрограммирование генома in vitro.

Ткани взрослого организма состоят из множества (более 200) типов клеток, и разной степени дифференцированное™, включая мультипотентные клетки, клетки-предшественники и терминально дифференцированные клетки. Каждому типу клеток соответсвует определенный паттерн экспрессии генов, который и определяет конкретный фенотип клеток. В поддержании определенного паттерна экспрессии генов участвуют эпигенетические модификации, такие как метилирование ДНК, ацетилирование и метилирование гистонов, и негистоновых белков, участвующих в компактизации хроматина. Таким образом, каждый клеточный тип характеризуется определенным эпигенетическим статусом генома, который «программирует» экспрессию генов клетки. Для большинства клеток организма - терминально дифференцированных или вышедших из клеточного цикла, эпигенетический статус генома зафиксирован и, таким образом, обеспечивает экспрессию определенного числа генов. Во время эмбриогенеза, гаметогенсза или при развитии некоторых болезней может происходить так называемое репрограммирование генома. То есть, эпигенетический статус генома подвергается глобальному изменению. После оплодотворения репрограммирование генома необходимо, чтобы вернуть плюрипотентное состояние клеткам эмбриона. Репрограммирование первичных половых клеток также необходимо для обеспечения последующего плюрипотентного состояния генома клеток эмбриона, и для того, чтобы убрать модификации, участвующие в импринтинге генов. Де-дифференцировка клеток во время опухолеобразования также сопровождается репрограммированием генома. Искусственно геном можно репрограммировать с помощью переноса соматического ядра в эпуклеированный ооцит или с помощью слияния клеток, находящихся па разных стадиях развития. Необходимо отметить, что одно из первых исследований репрограмирования генома было проведено Г.В. Лопашовым в 40-х годах прошлого века в России.

Первые успехи в клонировании млекопитающих показали, что терминально дифференцированная клетка «генетически тотипотентна». Клонирование мыши, когда донорами ядер являлись зрелые лимфоциты с реорганизованными генами цепей иммуноглобулинов (Hochedlinger, К., et al., 2002) и генетически меченные постмитотические обонятельные нейроны (Eggan, К., et al., 2004, Li, J., et al., 2004) продемонстрировало, что терминальная дифферепцировка не блокирует генетический потенциал ядра, и ядро из терминально дифференцированных клеток можно использовать для получения клонированных животных. Другими словами, эпигенетические изменения, сопровождающие терминальную дифференцировку, в идеальном случае, обратимы.

Раковые клетки обычно несут как генетические, так и эпигенетические изменения, которые блокируют терминальную дифференцировку и приводят к неконтролируемому росту. До недавнего времени было не ясно, насколько важны эпигенетические изменения для опухолеобразования и обратимы ли они. Клонирование эмбрионов с использованием переноса ядер из клеток опухоли мозга (Li, L., el al., 2003) и из клеток меланомы (Hochedlinger, К., et al., 2004), прояснило ситуацию. Химерные мыши, полученные с помощью инъекции ЭСК из таких эмбрионов в бластоцисту, были нормальны. Это показывает, что фенотип использованных раковых клеток отчасти был вызван эпигенетическими изменениями, которые обратимы при переносе ядра. Эти данные доказывают важность эпигенетических модификаций для нормального развития, терминальной дифференцировки и этиологии некоторых заболеваний.

Получение животных с помощью переноса ядер очень неэффективно, большинство эмбрионов погибает до или сразу после имплантации, и лишь небольшое количество клонов выживает после рождения. Часто в организме клонированных животных наблюдаются нарушения, приводящие к ожирению (Tamashiro, K.L., et al., 2002) и преждевременной смерти (Ogonuki, N., et al., 2002). Ранние эксперименты на амфибиях показали обратную зависимость между возрастом клетки- донора ядра и выживаемостью клонов. Репрограммирование при клонировании может быть функционально оценено по числу сформированных бластоцист, числу родившихся клонов, числу клонов, достигших половозрелого состояния или эффективности получения ЭСК из клонированной бластоцисты. Кроме этих параметров, о полноте репрограммирования можно судить по реактивации генов, необходимых для нормального развития. В работе Bortvin A., et al (2003) была проанализирована реактивация гена ОСТ4 и ОСТ4-ассоциированных генов, при развитии клонированных бластоцист, полученных при переносе ядер кумулусных клеток в энуклеированный ооцит (Bortvin, A., et al., 2003). Реактивация гена ОСТ4 необходима для эмбриогенеза. Генетический нокаут гена ОСТ4 приводит к тому, что в бластоцисте отсутствуют плюрипотентные клетки (Nichols, J., et al., 1998), то есть клетки эпибласта. ОСТ4-ассоциированиые гены были выбраны для исследования как экспрессирующиеся в том же временном интервале, что и ген ОСТ4, причем экпрессия генов детектируется в плирипогентных клетках и не наблюдается в соматических. Данные о реактивации этих генов после переноса ядер соматических клеток в энуклеировапые ооциты позволили судить о биологической роли этих генов в нормальном развитии эмбриона. Из 48 фенотипически нормальных клонированных бластоцист, лишь в 62% бластоцистах реактивировались все исследуемые гены. Причем процент реактивации каждого гена оказался различным. Исследуемые гены можно было разделить па плохо реактивирующиеся, такие как ОСТ4, и хорошо реактивирующиеся, такие как гены DPPA3 и DPPA5. На основании этих данных можно судить об участии эпигенетических механизмов в регуляции исследуемых генов. Наибольшая эффективность клонирования была показана при использовании ядер из бластомеров делящегося эмбриона (Cheong, Н.Т., et al., 1993, Hiiragi, Т., et al., 2005). Клонирование мышей с использованием ядер из ЭСК (Eggan, К., et al 2005, Rideout, W.M., et al., 2000) намного эффективнее, чем клонирование с использованием ядер из зрелых клеток, таких как фибробласты (Wakayama, Т., Yanagimachi, R., 1999) или клетки Сертоли (Ogura, A., et al., 2000). Кроме того, получение линий ЭСК из клонированных бластоцист более эффективно, чем получение клонированных мышей. Репрограммирование не ограничивается стадией ооцита, а продолжается в клетках внутренней клеточной массы бластоцисты. Поэтому для клонированния мышей с использованием ядер терминально дифференцированных нейронов, было применено клонирование в два этапа: получение ЭСК из клонированной бластоцисты с последующим переносом ядер из ЭСК в ооцит для получения клонированной мыши (Eggan, К., et al., 2004). Однако, из некоторых терминально дифференцированных клеток, например, из зрелых клеток Т-киллеров, клонированные мыши получаются в одну стадию (Inoue, К., et al., 2005). Из этих данных можно сделать несколько выводов: во-первых, чем выше уровень дифференцировки клетки-донора ядра, тем ядро менее восприимчиво к репрограммированию. Во-вторых, формирование бластоцисты и получение ЭСК сопровождается меньшим количеством генетических и эпигенетических нарушений, чем дальнейшее развитие эмбриона. Как следствие, получение ЭСК из клонированной бластоцисты проще, чем получение клонированных животных.

В ряде работ была исследована эффективность клонирования, когда донорами ядер являлись стволовые клетки взрослого организма. Клонирование с использованием в качестве доноров ядер нейрональных стволовых клеток оказалось в три раза эффективнее, чем при использовании в качестве доноров ядер фибробластов (Blelloch, R., et al., 2006). В клетках - донорах был проанализирован уровень метилирования генома. Оказалось, что в фибробластах уровень метилирования выше, чем в нейрональных стволовых клетках и в ЭСК. Эти данные поддерживают предположение о том, что именно эпигенетический статус ядра клетки донора влияет на эффективность репрограмирования при клонировании. Однако, это наблюдение не распространяется на все стволовые клетки взрослого организма. Так, было показано, что, когда донорами ядер являлись гематопоэтические стволовые клетки (Inoue, К., et al., 2006), эффективность клонирования выше, чем при использовании в качестве доноров ядер дифференцированных В- и Т-клеток (Hochedlinger, К., et al., 2002), но ниже, чем при использовании ядер клеток естественных киллеров (Inoue, К., 2005).

Нарушения в развитии при репродуктивном клонировании показывают, что, скорее всего, нарушения в эпигенетическом репрограммировании должны приводить к нарушениям в экспрессии генов. Действительно, у клонов на разных стадиях развития, и даже у взрослых особей, наблюдаются нарушения в регуляции экспрессии некоторых генов, зависящие от типа клетки-донора ядра (Ng, R.K. & Gurdon, J.В., 2005, Kohda, Т., et al., 2005, Humpherys, D., et al., 2002). Сохранение донор-специфичной экспрессии у клонов показывает наличие так называемой эпигенетической памяти (Ng, R.K. & Gurdon, J.В., 2005, Jaenisch, R., 2004) в ядре клетки-донора, и может объяснить данные о том, что мыши, клонированные с использованием переноса ядра от неродственных клеток -доноров, имеют различные нарушения (Tamashiro, K.L., et al., 2002, Ogonuki, N., et al., 2002). Было показано, что для полного репрограммировапия соматического генома и устранения эпигенетической памяти необходимо, чтобы геном в процессе развития, прошел через стадию образования первичных половых клеток, так как в процессе созревания первичных половых клеток геном претерпевает еще одно эпигенетическое репрограмировапие. У потомства клонированных мышей заметных нарушений не выявлено (Tamashiro, K.L., et al., 2002). На основании данных о том, что репрограммирование соматического ядра происходит не полностью, возникает вопрос, происходит ли полностью репрограммирование в ЭСК, полученных из клонированной бластоцисты. На самом деле, ЭСК из клонированной бластоцисты не отличаются по своим свойствам от нормальных ЭСК. Они обладают неограниченным пролиферативным потенциалом и образуют тератомы при введении иммунодефицитным мышам. Эффективность клонирования при использовании таких ЭСК в качестве доноров ядер для переноса в ооцит оказалась такой же, как у нормальных ЭСК. Паттерн экспрессии генов ЭСК, полученных из клонированной бластоцисты, не выявил никаких отличий от нормальных ЭСК. При получении ЭСК, возможно, происходит некий отбор клеток, которые претерпели, или продолжают претерпевать полное репрограммирование до плюрипотентного состояния, и поэтому ЭСК, полученные из клонированных бластоцист, имеют такой же потенциал, что и ЭСК, полученные из оплодотворенного эмбриона. Что касается экпериментов по получению клонированных бластоцист человека, то пока они оказались неудачными. Были опубликованы работы Hwang WS, в которых сообщалось, что были получены ЭСК человека из клонированной бластоцисты (Hwang W.S., 2004, 2005), но позже они были отозваны. Тем не менее, клонированные бластоцисты были получены при пересадке ядра человека в энуклеировапный ооцит кролика. Из таких бластоцист нельзя получить стабильных линий ЭСК из-за ядерно-митохондриальной несовместимости (Dey, R., et al., 2000) - феномена, который был описан для межвидовых гибридов. Первые эксперименты по клонированию обезьян выявили нарушения веретена деления (Simerly, С., et al., 2003), позже эти трудности были преодолены с помощью модификации процедуры переноса ядер (Simerly, С., et al., 2004). Кроме того, клонированные обезьяны были получены из эмбриональных клеток (Meng, L., et al., 1997), что подтверждает принципиальную возможность клонирования приматов.

Репрограммирование генома происходит и при слиянии клеток, находящихся на разных стадиях развития. У большинства гибридов, полученных с помощью слияния клеток с разным уровнем дифференцировки, доминирует фенотип менее дифференцированного типа клеток. В результате слияния плюрипотентных клеток тератокарциномы мыши с первичными тимоцитами мыши получаются плюрипотентные гибриды, которые обладают всеми свойствами клеток эмбриональной карциномы, включая способность индуцировать опухоли (Miller, R.A., et all., 1976). Доминирование плюрипотентного фенотипа также было показано в опытах по слиянию соматических клеток и примордиальных зародышевых клеток мыши (Tada, М., et al., 2003, Tada, М., et al., 1997) и ЭСК мыши (Matveeva, N.M., et al., 1998,Tada, M., et al., 2003, Tada, M., et al., 2001). Аналогичные данные были получены и для ЭСК человека (Yu, J., et al., 2006). Действительно ли соматические хромосомы претерпевают репрограммирование в результате слияния или они остаются молчащими? Было показано, что при слиянии женских лимфоцитов и ЭСК неактивная X хромосома реактивируется (Tada, М., et al., 2001), деметилируется и реактивируются гены, поддерживающие плюрипотенгность, в тератомах при инъекции иммунодефицитным мышам экспрессируются гены, характерные для трех зародышевых листков. Таким образом, при слиянии клеток хромосомы соматической клетки подвергаются репрограммированию. Клетки эмбриональной карциномы F9 образуют недифференцированные опухоли. При слиянии клеток эмбриональной карциномы F9 с тимоцитами уровень дифференцированных клеток в опухолях возрос (Rousset, J.P., et al., 1983). Однако, в других экспериментах по слиянию клеток эмбриональной карциномы и дифференцированных клеток пришли к противоположным результатам (Oshima, R.G., et al., 1981). Из опытов по слиянию клеток возникает два ключевых вопроса: во-первых, что необходимо для репрограммирования соматического генома - содержимое ядра или цитоплазмы плюрипотентной клетки, и во-вторых, нужна ли репликация ДНК для репрограммирования. При слиянии отдельных компартменов клетки (кариобласта или цитобласта) ЭСК с нейроном, изолированным из нейросферы, в гибридах, полученных от слияния кариобласта ЭСК с нейроном детектировалась реактивация трансгена OCT4-GFP. В гибридах, полученных при слиянии цитобласта ЭСК с нейроном, такая реактивация не наблюдалась (Do, J.Т., et al., 2004). Эти данные показывают, что для репрограммирования необходимы ядерные компоненты. Данные по клонированию амфибий и мыши подтверждают это предположение - удачное репрограммирование возможно только при инъекции ядра в ооцит, где в цитоплазме присутствуют ядерные факторы.

Необходимость репликации ДНК для репрограммирования менее ясна. Несмотря на то, что в одном эксперименте по слиянию ЭСК и соматической клетки была показана необходимость репликации для репрограммирования (Do, J.T., et al., 2004), эксперименты по переносу ядра показали независимый от репликации механизм репрограммирования, возможно, использующий активное деметилирование ДНК (Simonsson, S., et al., 2004). Возможно, противоречивые выводы объясняются тем, что для экспериментов были использованы разные типы клеток (ооцит и ЭСК) и использовались разные методы (перенос ядра и слияние клеток). Репрограммирование соматических клеток до плюрипотентных без использования переноса ядер - потенциально привлекательный подход для получения необходимого типа клеток для терапии (Cowan, С.A., et al., 2005).

Однако, для этого необходимо удаление ядра ЭСК из гибрида после репрограммирования соматического ядра, чтобы получить диплоидную клетку. Если для полного репрограммирования необходима репликация ДНК, то выборочно удалить хромосомы ЭСК из гибрида не представляется возможным.

Альтерантивой переносу ядер и слиянию клеток для изучения репрограммирования является бесклеточная система. Работа с клеточными экстрактами, в принципе, может позволить выделить компоненты, необходимые для репрограммирования. Например, обработка соматических клеток лягушки в экстракте, приготовленном из яиц Xenopus показало, что ТАТА-связывающийся белок (ТВР) активно диссоциирует из хроматина под действием АТФ - зависимого ремоделирующего фактора ISWI (Kikyo, N., et al., 2000), что говорит об его участии в репрограммировании. В другом эксперименте при обработке клеток Xenopus экстрактом из ооцитов наблюдали увеличение числа транскриптов ОСТ4. К сожалению, стабильного репрограммирования до плюрипотентного состояния не удалось получить. Похожие эксперименты по индукции репрограммирования были проведены на клеточной линии 293Т, клетки выдерживали в экстрактах из клеток эмбриональной карциномы (Taranger, С.К., et al., 2005) или линии Т - клеток (Hakelien, A.M., et al., 2002), и измеряли экспрессию ОСТ4 и Т-клеточного рецептора. Была отмечена активация Т-клеточного рецептора, однако функциональной перестройки локуса Т-клеточного рецептора не произошло. Таким образом, репрограммировать соматическую клетку в другие клеточные типы с помощью этого метода проблематично.

1.3 Метилирование ДНК. Механизмы de novo метилирования.

Метилирование ДНК найдено у прокариотических и эукариотических организмов. У прокариот ДНК метилируется по адениновому и цитозиновому остатку и является частью собственной системы рестрикции. Метилирование ДНК у многоклеточных эукариот ассоциировано с неактивным состоянием хроматина и ингибированием экспрессии генов. Метилируется остаток цитозина в последовательности C-p-G, в положении С5. Мутации, инактивирующие метилтраисферазу DNMT3a и DNMT3b у мышей летальны, что подтверждает значение метилирования ДНК для поддержания жизнеспособности (Li, Е., 1992, Okano, М., 1999). Существует два механизма, с помощью которых метилирование ДНК ингибирует экспрессию генов: прямой (метилированный цитозиновый остаток препятствует связыванию транскрипционного фактора (Watt, F.,. 1988)), и опосредованный белками, связывающимися с метилированным остатком цитозина и оказывающими репрессионное действие па область связывания (Boyes, J., 1991, Hendrich, В.,. 1998). Белки, связывающиеся с метилированным остатком цитозина MBP (Mehtyl-CpG-binding-protein), связываются с молекулами ко-репрессорами для ингибирования транскрипции и для модификации и ремоделирования хроматина (Jones, P.L., 1998, Nan, X., 1998,, Ng, Н.Н, 1999, Sarraf, S.A., 2004, Wade, P.A., 1999, Zhang, Y„ 1999).

Цитозиновые метилтрансферазы млекопитающих можно разделить на два класса, основываясь на их субстратном предпочтении. Так называемые de novo метилтрансферазы DNMT3a и DNMT3b ответственны за метилирование CpG сайтов, неметилированных в обеих цепях ДНК. Метилтрансфераза DNMT1 копирует статус метилирования при репликации со старой цепи на вновь синтезированную. Метилтрансфераза DNMT2 демонстрирует слабую ДНК- метилтрансфсразную активность in vitro (Hermann, А., 2003), ее ингибирование в ЭСК мыши не оказывает детектируемого эффекта на геномный статус метилирования (Okano, М., 1998). Вероятно, этот фермент в действительности мало влияет на уровень метилирования генома. Белок DNMT3L структурно похож на DNMT метилтрансферазы, не обладает собственной метилтрансферазной активностью, но физически ассоциирован с DNMT3a и DNMT3b, и модулирует их каталитическую активность (Suetake, I., 2004). Таким образом, коровый компонент ДНК -метилтрансферазной системы состоит из поддерживающей статус метилирования метилтрансферазы и метилтрансфераз, метилирующих последовательность ДНК de novo.

Механизмы привлечения ДНК метилтрансфераз к конкретным участкам генома в настоящее время исследованы недостаточно. Существует три основных мнения на этот счет. Первое - DNMT3 метилтрансферазы могут сами узнавать последовательность ДНК или хроматин через специальный домен. Второе - DNMT3a и DNMT3b могут привлекаться через белок - белковые взаимодействия транскрипционными репрессорами или другими факторами. Третье - система РНК - интерференции может влиять на de novo метилирование определенных участков ДНК.

DNMT3 в клетках мыши локализованы в прицентромерных гетерохроматиновых участках. Функциональные исследования показали, что консервативный домен PWWP ДНК-метилтрансфераз-3 необходим для такой локализации. Мутации в этом домене приводят к уменьшению связывания хроматина DNMT3b (Ge, Y.Z., 2004) и, соответственно, к уменьшению метилирования классических сателлитных последовательностей (Shirohzu, Н., 2002). Данные, полученные in vitro, показывают, что домен PWWP DNMT3b взаимодействует с ДНК вне зависимости от последовательности нуклеотидов (Qiu, С., 2002). Метилтрансферазы могут быть привлечены к генам с помощью сайт-специфических транскрипционных репрессоров. Это было показано на онкогенном белке PML-RAR, который получился в результате хромосомных перестроек. PML-RAR связывается с промоторной областью генов за счет RAR части и привлекает ДНК метилтрансферазу к промотору за счет PML части, что приводит к гиперметилированию генов-мишеней в опухолевых клетках (Di Croce, L., 2002). Для белка Мус было показано, что он непосредственно связывается с DNMT3a и это взаимодействие необходимо для эффективной репрессии гена мишени р2Г//7/(Вгеппег, С., 2005). Это означает, что белок Мус привлекает DNMT3a на промотор гена р21с//,/, что приводит к de novo метилированию промоторной области гена p21c'/j/. Точечные мутации в каталитическом домене, инактивирующие DNMT3a, блокируют репрессионное действие фермента и белка Мус на геп р21с,',/.

1.4 Регуляция экспрессии генов опосредованная РНК - интерференцией.

Канонический механизм регуляции экспрессии генов включает образование двухцепочечных коротких РНК (так называемых малых интерферирующих РНК и микро РНК), которые могут приводит к деградации мРНК, ингибированию трансляции или транскрипции(Ме|51ег, G., TuschI, Т., 2004), а гак же к реорганизации хроматина (Bernstein, Е., Allis, C.D., 2005). Репрессия с помощью РНК - интерференции высоко специфична, благодаря тому, что короткие РНК находят гомологичные мишени, например в мРНК. Малые интерферирующие РНК образуются из двуцепочной РНК, а микро РНК из двуцепочных РНК шпилек. Образование малых интерферирующих РНК и микро РНК -многоступенчатый процесс, в котором участвует эндорибонуклеаза Dicer. Dicer процессирует РНК с образованием двуцепочечных РНК размером примерно, 21-24 п.н. с двумя выступающими пуклеотидными остатками на 3' конце. В составе комплекса RISC (RNA induced silencing complex) при высокой спецефичности короткие РНК приводят к деградации мРНК, при невысокой специфичности к ингибированию трансляции. У растений и некоторых грибов индукция системы Р11К-интерференции приводит к ингибированию экспрессии генов на пост-транскрипционном и транскрипционном уровнях. У растений ингибирование экспрессии генов на транскрипционном уровне с помощью РНК интерференции приводит к de novo метилированию генов (Matzke, М.А., 2005).В РНК — зависимом метилировании ДНК участвуют более длинные двуцепочечные короткие РНК размером 24-26 п.н. Сходный механизм de novo метилирования, опосредованный РНК интерференцией, был продемонстрирован в двух работах на культурах клеток млекопитающих (Kawasaki, Н., 2004, Morris, K.V., 2004). Двухцепочечная короткая РНК, соответствующая промоторной области гена, вызывает ингибирование гена-мишени и de novo метилирование соответствующей промоторной области. Однако в других публикациях со сходными экспериментами de novo метилирования соответствующего района не наблюдалось (Park, C.W., 2004, Svoboda, P., 2004, Ting, A.H., 2005).

Генетический нокаут гена Dicer приводит к смерти эмбрионов мыши на ранних стадиях развития (Bernstein, Е., et al., 2003). При изучении ЭСК мыши с делецией по гену Dicer, наблюдалась транскрипция в норме не транскрибирующихся центромерных еателитных повторов (Kanellopoulou, С., 2005), что свидетельствует о необходимости системы РНК интерференции для инактивации этой области генома. Кроме транскрипции еателитных центромерных повторов, наблюдалось снижение уровня метилирования центромерных повторов. Этот факт косвенно подтверждает связь системы РНК интерференции и системы метилирования ДНК. В другом независимом исследовании (Murchison, Е.Р., 2005) не было обнаружено изменения уровня метилирования сателлитных повторов в ЭСК мыши, дефицитных по гену Dicer. Таким образом, эксперименты, полученные на клетках млекопитающих, не дают столь однозначных, как на растениях, результатов, свидетельствующих о роли системы РНК интерференции в процессе транскрипционной инактивации генов посредством системы метилирования ДНК.

1.5 Роль метилирования ДНК в регуляции транскрипции генов.

На сегодняшний день существуют две основные модели, описывающие механизм ингибирования экспрессии генов с помощью метилирования ДНК. Первая -метилирование конкретной области ДНК может непосредственно ингибировать транскрипцию, блокируя посадку транскрипционных активаторов, которые чувствительны к метилированию сайтов связывания (Watt, F., 1988). Вторая модель опосредована МВР (метил-С-5-цитидин связывающиеся белки) белками, которые узнают метилированную ДНК и с помощью ко-репрессоров ингибируют экспрессию генов (Nan, X., 1998, Nan, X., 1997). Для некоторых промоторов ингибирование, опосредованное метилированием, эффективно лишь в контексте хроматина (Kass, S.U., 1997). То есть метилированние промоторной области без изменения структуры хроматина не приводит к инактивации промотора. Это значит, что активные компоненты этой репрессионной системы могут зависеть от модификации хроматина в исследуемой области.

В двух недавних работах была исследована роль эпигенетических модификаций реуляторных областей генов ОСТ4 и NANOG - ключевых транскрипционных факторов участвующих в поддержании плюрипотентности ЭСК мыши (Hattori, N., et al., 2004, Hattori, N., et al., 2007). При инактивации гена OCT4 ЭСК дифференцируются в экстраэмбриопальную трофоэктодерму, а превышение нормального уровня ведет к дифференцировке ЭСК в экстраэмбриональную эндодерму (Nichols, J., et al., 1998). Генетический нокаут гена NANOG приводит к дифференцировке ЭСК в экстраэбриональную эндодерму (Chambers, I., et al., 2003, Mitsui, К., et al., 2003). Оба транскрипционных фактора участвуют в регуляции экспрессии целого ряда генов, необходимых для раннего эмбриогенеза. В качестве объекта исследования были выбраны ЭСК мыши и трофобластные стволовые клетки мыши, экспрессирующие и неэкспрессирующие гены ОСТ4 и NANOG, соответственно. Уровень метилирования генома в клетках трофобласта существенно ниже, чем в клетках внутренней клеточной массы. Однако, регуляторные районы генов ОСТ4 и NANOG оказались гиперметилированы в трофобластных стволовых клетках, а в ЭСК та же область оказалась гипометилированной. При использовании репортерных конструкций содержащих регуляторные облати генов, in vitro метилирование регуляторных областей генов приводило к ингибированию экспрессии гена репортера. При обработке клеток 5'-азацитидином и/или трихостатином, которые ингибируют ДНК - метилтрансферазы и гистон-деацетилазы, соответственно, были получены неоднозначные данные. В случае ОСТ4 наблюдалась дозо-зависимая реактивация гена в линии клеток N1H3T3. Ген Nanog не реактивировался при подобной обработке трофобластных стволовых клеток. Основываясь на этих данных, исследователи предполагают, что эпигенетический статус регуляторпой области гена NANOG отличен от эпигенетического статуса регуляторной области гена ОСТ-4. Однако, данные иммунопреципитации хроматина показывают, что в регуляторных областях обоих генов гистоны НЗ и Н4 гипоацетилированы, а в ЭСК гиперацетилированы. Уровень ди- и триметилирования аминокислотных остатков НЗК4, которое характерно для активного состояния хроматина, был выше в ЭСК, чем в трофобластных стволовых клетках. Уровень метилированых гистонов по аминокислотным остаткам НЗК9 и НЗК27, которые характеризуют неактивный хроматин, был значительно выше в трофобластных стволовых клетках по сравнению с уровнем в ЭСК. В целом эпигенетический статус генов ОСТ4 и NANOG очень схож. При дифференцировке клеток эмбриональной карциномы NT2 в нейроны, экспресия генов ОСТ4 и NANOG резко понижается и наблюдается гиперметилированис регуляторных районов генов (Deb-Rinker, P., et al., 2005). Эти данные демонстрируют участие эпигенетических механизмов в регуляции экспрессии ключевых транскрипционных факторов, необходимых для раннего эмбрионального развития.

При дальнейшем развитии клетки внутренней клеточной массы дифференцируются в различные типы клеток. Это сопровождается прекращением экспрессии генов, участвующих в поддержании плюрипотентности. Одновременно с этим, активируются транскрипционные факторы, направляющие клетки внутренней клеточной массы по тому или иному пути дифференцировки. В регуляции экспрессии таких транскрипционных факторов необходимой частью являются эпигенетические механизмы. Транскрипционные факторы семейства GATA участвуют в дифференцировке клеток в различные типы. Так например, транскрипционный фактор GATA-2 участвует в дифференцировке клеток в гематопоэтические и эндотелиальные клетки. GATA-2 регулирует собственную экспрессию во время дифференцировки гематопоэтических клеток (Grass, J.A., et al., 2003). Однако, для созревания эритроидных клеток необходимо инактивировать экпрессию GATA-2. GATA-1 связывается с энхансером гена GATA-2, и вызывает деацетилирование гистонов в области энхансера и обоих промоторов гена GATA-2. Происходит инактивация гена GATA-2, которая необходима для дальнейшей дифференцировки гематопоэтических клеток по эритроидному пути.

GATA-факторы участвуют в регуляции экспрессии целого ряда тканеспецифических генов. Например, при эндотелиальной дифференцировке GATA-2 участвует в регуляции экпрессии целого ряда генов. Однако, регуляция экспрессии тканеспецифических генов не ограничивается генетической регуляцией. Участие эпигенетических механизмов в регуляции тканеспецифичсской экпрсссии показана для большого числа генов (Singal, R., et al., 2002, Yamamura, H., et al., 1997, Siegfried, Z., et al., 1999). Вклад эпигенетических механизмов в регуляцию экпрессии генов хорошо изучен на примере тканеспецифической регуляции гена eNOS. Несмотря на то, что в регуляторпой области гена eNOS находятся сайты связывания конститутивных тарнскрипционных факторов Spl/Sp3, Etsl, экпрсссия гена eNOS ограничена эндотелием (Chan, Y., et al., 2004). Данные иммунопреципитации хроматина показали, что транскрипционные факторы Spl/Sp3, Etsl связываются с регуляторной областью гена eNOS только в эндотелиальных клетках, в которых экспрессируется ген eNOS. Опыты с использованием репортерной конструкции, содержащей промоторную область гена eNOS, встроенной в геном мыши, продемонстрировали специфическую экспрессию в эндотелии. Однако, эписомная репортерная конструкция, содержащая промоторную область гена eNOS, экспрессировалась и в неэндотелиальных клетках. Бисульфитное секвенирование регуляторной области гена eNOS показало, что в неэндотелиальных клетках промоторная область гена гиперметшшрована, а в эндотелиальных гипометилирована. Эти данные дали основания предполагать, что регуляция экспрессии гена осуществляется с помощью эпигенетических механизмов. Обработка клеток 5-азацитидином активировала экспрессию гена eNOS в неэндотелиальных клетках. Репортерная конструкция с in vitro метилированной промоторной областью гена eNOS понижает активность промотора, даже в присутствии транскрипционных факторов Spl/Sp3, Etsl. Однако, опыты по задержке подвижности в геле показали, что in vitro метилированная промоторная область связывается с транскрипционными факторами Spl/Sp3, Etsl так же, как и неметилированная. Вероятно, ингибирование экспрессии гена eNOS с помощью метилирования ДНК осуществляется не непосредственно, а через реорганизацию хроматина. Данные иммунопреципитации хроматина показали, что в эндотелиальных клетках в промоторной области гена eNOS гистоны НЗ и Н4 гиперацетилированы, по сравнению с неэндотелиальными клетками. Также было показано, что уровень метилирования гистонов по аминокислотным остаткам НЗК4, которое характеризует активное состояние хроматина, в промоторе гена eNOS значительно выше в эндотелиальных клетках, чем в неэндотелиальных. Ингибирование деацетилаз с помощью трихостатина А приводит к увеличению уровня ацетилированных гистонов и к активации экпрессии гена eNOS в неэндотелиальных клетках, в норме не экпрессирующих ген. Обработка эндотелиальных клеток с помощью метилтиоаденозина, который ингибирует метилирование гистонов по аминокислотным остаткам НЗК4 приводит к снижению уровня метилирования и к понижению экпрессии гена eNOS. Это демонстрирует,"что для поддержания активного состояния гена eNOS, как и многих других генов, необходим набор эпигенетический модификаций.

2.1 ЭСК человека, как модельный объект для изучения раннего эмбриогенеза.

ЭСК получают из клеток внутренней клеточной массы бластоцисты (эпибласта), и поэтому ЭСК являются in vitro аналогами клеток эпибласта, которые искусственно поддерживаются в плюрипотептном состоянии (Thomson, J.A., et al., 1998). Для ЭСК человека характерна экспрессия специфических маркеров таких как SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, щелочная фосфатаза (Thomson, J.A., el al., 1998, Chambers et al., 2004), CD30 (Lagarkova MA et al., 2008). ЭСК могут дифференцироваться in vitro в производные трех зародышевых листков. При подсадке иммунодефицитным мышам, ЭСК формируют новообразования, в которых также можно идентифицировать производные всех трех зародышевых листков (Thomson, J.A., et al., 1998). ЭСК являются удобным объектом для изучения различных процессов и механизмов, происходящих на ранних стадиях развития, в том числе для изучения механизмов, участвующих в поддержании плюрипотентного состояния ЭСК: внеклеточных и внутриклеточных сигнальных путей, взаиморегуляции транскрипционных факторов, вовлеченных в поддержание плюрипотентного состояния (Rodda, D.J., et al., 2005). После оплодотворения, на ранних стадиях развития вплоть до бластоцисты происходит ремоделирование генома млекопитающих, поэтому ЭСК являются уникальной моделью для изучения этого явления in vitro (Morgan, H.D., et al., 2005). Разработка методов дифференцировки ЭСК позволяет исследовать сигнальные и эпигенетические механизмы дифференцировки клеток в определенные клеточные типы. Существует целый ряд молекулярных механизмов, определяющих основные отличительные свойства ЭСК, а именно их способность пролиферировать в культуре в недифференцированном состоянии и одновременно сохранять способность к дифференцировке. Некоторые механизмы являются общими для ЭСК мыши и человека, некоторые различны.

Говоря о поддержании плюрипотентного состояния ЭСК млекопитающих, нельзя не отметить роль внешних ростовых факторов и фидера. Первые линии ЭСК мыши и человека были получены с использованием в качестве фидера первичных мышиных эмбриональных фибробластов. Это было необходимо как для поддержания ЭСК в недифференцированном состоянии, так и для их лучшего роста. Позднее для получения ЭСК человека была использована бессмертная клеточная линия мышиных фибробластов STO (Park, J.H., et al., 2003, http://www.wicell.org). Считается, что в дальнейшем эти клеточные линии уже нельзя использовать для целей регенеративной медицины или генной терапии, поскольку высока вероятность переноса патогенных микроорганизмов и вирусов от мышиных клеток человеческой ткани. Кроме этого, человеческие клетки начинают представлять мышиные антигены (Martin, M.J., et al., 2005), что может привести к отторжению трансплантанта. Появляются публикации о ведении и получении линий человеческих ЭСК в бесфидерных условиях (Valbuena, D., et al., 2006). Естественно, что бесфидерное культивирование требует детального знания о тех факторах внешней среды, которые являются необходимыми для поддержания линий ЭСК в недифференцированном состоянии и предотвращении их трансформации. Нельзя применить напрямую условия культивирования для ЭСК человека, разработанные для бесфидерного культивирования ЭСК мыши. Например, LIF, который используется для бесфидерного культивирования ЭСК мыши, не нужен для культивирования ЭСК человека (Daheron, L., et al 2004). LIF действует через поверхностный рецептор gp 130 и необходим для выведения клеток бластоцисты мыши из запрета на клеточное деление во время диапаузы. В процессе развития эмбриона человека стадии диапаузы нет, поэтому ЭСК человека обходятся без. LIF. Действие L1F на ЭСК мыши - яркий пример физиологических отличий, которые не позволяют переносить методологию культивирования и различных манипуляций с ЭСК, разработанную для одного вида, на другой (Nichols, J., et al., 2001).

2.2 Потенциал дифференцировки ЭСК человека.

Дифференцировка ЭСК по определенному пути сопровождается изменением паттерна экпрессии генов, от генов, характерных для плюрипотентного сотояния, к тканеспецифическим генам. Изменение паттерна экспрессии осуществляется за счет затухания экспрессии ключевых транскрипционных факторов, участвующих в поддержании плюрипотентности, и экспрессией тканеспецифических транскрипционных факторов. Параллельно работают эпигенетические механизмы регуляции экпрессии генов, которые репрессируют гены, необходимые для плюрипотентного состояния, и активируют тканеепецифические. Так как ЭСК - это in vitro аналог клеток эпибласта искусственно поддерживаемых в недифференцированном состоянии, при изменении условий культивирования ЭСК спонтанно дифференцируются в различные типы клеток. In vitro спонтанная дифференцировка ЭСК человека наблюдается как при длительном культивировании прикрепленных колоний, так и в процессе роста ЭТ в суспензии. В отличие от ЭСК мыши, не все линии ЭСК человека легко образуют эмбриоидные тельца, и ни одна линия ЭСК не образует эмбриоидные тельца из одиночных клеток.

Для ЭСК человека была показана способность к дифференцировке во многие типы клеток: нейроны и глия, эндотелий, кератиноциты, трофобласты, кардиомиоциты, остеобласты, клетки крови, гепатоциты, инсулин-продуцирующие клетки и некоторые другие.

Дифференцировка ЭСК человека в нейроны и астроциты, с использованием механической селекции предшественников, а затем культивирование продуктов спонтанной дифференцировки, была впервые описана двумя группами в 2001 году (Reubinoff, В. Е., et al., 2001, Zhang, S.C., et al., 2001). Нейральные предшественники после трансплантации в мозг новорожденных мышей способны к дифференцировке в три типа нейральных клеток и не образуют тератом. Множество протоколов было опубликовано с тех пор, были найдены факторы, увеличивающие количество нейральных предшественников: ретиноевая кислота, noggin - блокатор сигнального пути BMP, sonic hedgehog и другие (Lim, U.M., et al., 2006, Gossrau, G., et al., 2007). Опубликованы протоколы дифференцировки функциональных нейрональных клеток определенной специализации - например, допаминергических нейронов (Iacovitti, L., et al., 2007). Были получены данные о возможности длительного (более 100 пассажей) культивирования нейроэктодермальных предшественников в бессывороточной среде, в присутствии ростовых факторов (Reubinoff, В. Е., et al., 2001).

В 2003 были получены кератиноциты из ЭСК мыши, которые были использованы для реконструкции кожи (Coraux, С., et al., 2003). Иммуногистохимический анализ выявил экспрессию цитокератинов и маркеров эпидермиса. Относительно недавно была получена иммортализованная линия кератиноцитов из ЭСК человека (Iuchi, S., et al., 2006) Клетки экспрессируют маркеры, характерные для незрелых кератиноцитов, но доля зрелых кератиноцитов оказалась, существенно ниже, чем у постнатальных кератиноцитов эпидермиса человека.

Производные энтодермы получить оказалось труднее всего. В опубликованных сообщениях о дифференцировке ЭСК человека в инсулин-секретирующие клетки (Baharvand, Н., et al., 2006) и гепатоциты (Hay, D.C., et al., 2007), было показано, что по белковым и генетическим маркерам они совпадают с зрелыми инсулин-секретирующими клетками или гепатоцитами. Однако, факторы, определяющие диффсренцировку в энтодерму плохо охарактеризованы, и почти отсутствуют маркеры ранней энтодермальной дифференцировки.

В отличие от ЭСК мыши, которые легко дифференцируются в кардиомиоциты в отсутствии LIF, спонтанная дифференцировка ЭСК человека наблюдается у разных линий ЭСК в разном проценте случаев - от спонтанно сокращающихся участков в 70% ЭТ до полного отсутствия спонтанной дифференцировки (Heng, B.C., et al., 2004). Показано, что кардиомиоциты, дифференцированные из ЭСК человека, экспрессируют транскрипционные факторы Nkx 2.5, GATA4, а так же специфические маркеры кардиомиоцитов - тропонин 1 и тяжелую цепь альфа-миозина. Опубликована работа по дифференцировке кардиомиоцитов в бессывороточной среде, минуя стадию эмбриоидных телец (Хи, С., et al., 2006). При длительном культивировании, ЭСК могут подвергаться искусственной случайной селекции. Кроме того, как оказалось, ЭСК, идентичные по основным морфологическим характеристикам и экспрессии основных генов, могут отличаться эпигенетическим статусом в регуляторных областях некоторых генов. Эти факторы могут приводить к тому, что клеточные линии ЭСК будут иметь преимущественные пути дифференцировки. То есть, например, ЭСК будут легко дифференцироваться в нейроны и плохо в кардиомиоциты. Возможно, именно разница в эпигенетическом статусе ЭСК мыши и человека может объяснить столь различный потенциал дифференцировки.

2.3 Дифференцировка ЭСК в гематопоэтические и эндотелиальные клетки.

При нормальном развитии эмбриона сосудистая ткань формируется из мезодермы. Вскоре после гаструляции мезодерма формируется как отдельный слой между экто- и эндодермой. Предполагается, что эндотелиальные и гематопоэтические клетки происходят от общего мезодсрмального предшественника - гемангиобласта (Lacaud, G. et al., 2004). Клетки-предшественники, потенциально способные образовывать гематопоэтические и эндотелиальные клетки, были идентифицированы на модели мышиных ЭСК (Choi, К., et al., 1998, Chung, Y.S., et al., 2002, Nishikavva, S.I., et al., 1998) и лишь позже in vivo при изучении гаструляции мышиного эмбриона (Huber, T.L. et al., 2004). Существует три основных технических подхода для изучения дифференцировки ЭСК в клетки эндотелия и гематопоэтические клетки. Первый - дифференцировка ЭСК в эндотелиальные или гематопоэтические клетки через стадию ЭТ (Cerdan, С., et al., 2004, Chadwick, К., et al., 2003, Levenberg, S., et al., 2002, Ng, E.S., et al., 2005, Zambidis, E.T. et al., 2005, Zhan, X. et al., 2004). Второй - совместное культивирование ЭСК со стромальными клетками (Kaufman, D.S. et al., 2001, Vodyanik, M.A. et al., 2005). Третий -дифференцировка ЭСК в двумерных условиях (Hirashima, М., et al., 1999, Nishikawa, S.I., et al., 1998). Дифференцировка ЭСК человека в клетки эндотелия в двумерных условиях использовалась только одной группой исследователей (Gerecht-Nir, S., et al., 2003). Селекция эндотелиальных клеток осуществлялась по размеру клеток с помощью фильтрации через фильтр с диаметром пор 40 мкм. Из работы не ясно, какую долю составляли клетки эндотелия после селекции. Скорее всего, данный метод селекции не стоит использовать, если необходимо получить чистую популяцию клеток эндотелия.

Дифференцировка ЭСК через образование ЭТ - это всегда спонтанная, ненаправленная дифференцировка. Как уже упоминалось, ЭТ содержит клетки, происходящие из разных зародышевых листков, и поэтому доля клеток требуемого типа мала. Процент клеток эндотелия в эмбриоидных тельцах составляет около 2%. Кроме того, этот подход обладает еще несколькими ограничениями. Например, трудно наблюдать клетки в микроскоп, проводить анализ дифференцировки единичных клеток, трудно разделять клетки из агрегатов клеток в ЭТ. Однако, на сегодняшний день в большом количестве публикаций используется именно этот подход. Это обусловлено, в частности, тем, что направленная дифференцировка клеток требует специального подбора условий, а ЭТ - грубый модельный аналог развивающегося эмбриона, в котором присутствуют различные клетки, в том числе и необходимые исследователю. В отличие от дифференцировки через стадию ЭТ, прямая дифференцировка ЭСК проста для наблюдения за клетками и манипуляций с ними, однако требует предварительных исследований по подбору условий дифференцировки.

Для идентификации эндотелиальных предшественников и созревающих клеток эндотелия, полученных из ЭСК мыши используют VE-cadherin PECAM-1/CD31, CD34, Flkl, vWF и eNOS (Asahara, Т., et al., 1997, Hatzopoulos, A.K., et al., 1998, Albrecht, E.W., et al., 2003, Garlanda, C., Dejana, E., 1997, Nishikawa, S.I. et al., 1998, Rafii, S., LTyden, D., 2003). Несмотря на то, что гематопоэтические клетки имеют многие общие маркеры с эндотелиальными клетками, они не экспрессируют VE-cadherin и экспрессируют общий лейкоцитарный маркер CD45 (Rafii, S., Lyden, D., 2003).

При дифференцировке ЭСК мыши через стадию ЭТ экспрессия гена Flk-1, кодирующего рецептор VEGFR2, детектируется на третий день (Leahy, A., et al., 1999). В ЭСК мыши экспрессия гена Flk-1 характеризует латеральную мезодерму и также можег использоваться как ранний маркер эндотелиальных клеток и клеток крови, поэтому во многих экспериментах рецептор VEGFR1 используется для сепарации. Это позволяет делить ЭСК на ранних стадиях дифференцировки. В случае ЭСК человека ген Flk-1 экспрсссируется не только в ЭТ, но и в морфологически недифференцированных ЭСК (Kaufman, D.S., et al., 2001). Этот факт исключает использование Flk-1 для сепарации клеток эндотелия из ЭСК человека.

Несколько исследовательских групп показали, что примитивные эндотелий -подобные клетки, полученные из ЭТ, обладают характеристиками как эндотелиальных, так и гематопоэтических клеток предшественников (Levenberg, S., et al.„ 2002, Wang, L. et a., 2004, Zambidis, E.T., et al., 2005). Несмотря на то, что в исследованиях были использованы разные процедуры и разные линии клеток, динамика изменений экспрессии поверхностных маркеров в процессе дифференцировки предшественников в гематопоэтические и эндотелиальные клетки из ЭТ одинакова. Иммуногистохимические исследования и исследования с помощью проточной цитометрии показали, что предшественники, полученные из ЭТ человека на стадии 9-10 дней дифференцировки обладают примитивным эндотелиальным фенотипом, потому что экспрессируют поверхностные эндотелиальные белки РЕСАМ-1, CD31, Flk-1 и VE-cadherin, а так же не экспрессируют общий лейкоцитарный маркер CD45 и не экпрессируют белки vWF и eNOS, характеризующие клетки зрелого эндотелия. Такие клетки также называют CD45-PFV+, что значит CD45 - негативные, РЕСАМ-1, Flk-1, VE-cadherin - позитивные (Wang, L., et al., 2004). Другая группа исследователей показала, что предшественники, полученные из ЭТ после более длительного культивирования (13-15 дней), помимо РЕСАМ-1, Flk-1 и VE-cadherin, экпрессируют белки зрелых эндотелиальных клеток vWF и eNOS. В CD45- PFV+ клетках, полученных из ЭТ 9-10 дней, обнаружено повышение экспрессии эндотелиальных молекул адгезии, таких как эндотелии, Е-селектин, LFA-3 и генов, участвующих в передаче сигнала, таких как EDG-1, нейрофилии, ТЕК и Т1Е-2. Кроме этого, в этих клетках была обнаружена повышенная экспрессия генов, экспрессирующихся не только в клетках эндотелия, но и гематопоэтических клетках (FLK-1, FLT-1, FOG-1, HEX, RUNX-1 и TAL-1) (Wang, L., et al., 2004).

Несмотря на различия в экспериментальных подходах, в трех разных группах независимо показали, что примитивные эндотелий - подобные клетки, полученные из ЭТ, формировали зрелый эндотелий (Wang, L., et al., 2004, Levenberg, S., et al., 2002, Zambidis, E.T., et al., 2005). При культивировании клеток в течение 7 дней в эндотелиальной среде, они приобрели веретенообразную форму, экспресеировали РЕСАМ-1, VE-cadherin, vWF и eNOS, и не экспресеировали CD45 (Wang, L., et al., 2004). Клетки формировали сетчатую структуру такую же, как и зрелые человеческие эндотелиальные клетки из пупочной вены, что свидетельствует о их функциональности. Примитивные эндотелий - подобные клетки, изолированные из ЭТ после 13-15 дней диффереицировки, также способны развиваться в эндотелиальные клетки, образовывать сосудоподобные структуры in vitro и формировать капилляры при трансплантации иммунодефицитным мышам (Levenberg, S., et al., 2002). Другими исследователями было показано, что мезодермально - гематопоэтические -эндотелиальные колонии, полученные из ЭТ после 7-12 дней дифференцировки, могут давать прикрепленные и неприкрепленные клетки после дальнейшей дифференцировке в течение 2-4 недель. Некоторые из прикрепленных клеток экспресеировали CD31 и VE-cadherin, что указывало на их возможную принадлежность к эндотелию (Zambidis,- Е.Т., et al., 2005).

CD45- PFV+ клетки, кроме способности дифференцироваться в клетки эндотелия, обладают кроветворным потенциалом. Это было продемонстрировано in vitro (Mcnendez, P., et al. 2004, Wang, L. et al., 2004, Zambidis, E.T. et al., 2005) и in vivo (Wang, L., el al., 2005). Более чем 98% CD45- PFV+ предшественников при культивировании в среде, поддерживающей гемопоэз, в присутствии IL-3, GM-CSF и других факторов в течение 7 дней становятся CD45 положительными (Wang, L., et al., 2004). И по морфологическим, и по фенотипическим характеристикам гематопоэтические колонии, полученные из примитивных эндотелий - подобных предшественников, демонстрировали характеристики, свойственные для зрелых гематопоэтических клеток (Mcnendez, P., et al.,

2005, Wang, L., et al., 2004, Zambidis, E.T., et al., 2005). Для проверки способности клеток гематопоэтических производных CD45- PFV+ восстанавливать популяцию кроветворных клеток in vivo, использовали прямую инъекцию CD45- PFV+ гематопоэтических производных в костный мозг бедра иммунодефектных мышей. Несмотря на то, что пролиферация и миграция была хуже, чем у контрольных клеток пуповинной крови, трансплантация CD45- PFV+ гематопоэтических производных дала линии гематопоэтических клеток, включая миелоидные, лимфоидные и эритроидные линии (Wang, L., et al., 2005). Это свидетельствует о том, что ранние эндотелий - подобные клетки (CD45- PFV+ популяция клеток из ЭТ) способны образовывать гематопоэтические стволовые клетки.

Для того, что бы экспериментально доказать, что CD45- PFV+ клетки способны давать и эндотелиальные, и гематопоэтические клетки, были изолированы единичные CD45- PFV+ клетки, из ЭТ после 9-10 дней дифференцировки. После 14 дней культивирования, клетки окрашивали на CD45 и VE-cadherin, этим идентифицируя гематопоэтические и эндотелиальные клетки соответственно. При культивировании в среде, способствующей гематопоэтической дифференцировке, CD45- PFV+ клетки были не способны к пролиферации в культуре. При использовании эндотелиальной среды с низкой частотой поддерживалась эндотелиальная пролиферация. При культивировании клеток в смешанных условиях 50% «эндотелиальной» среды и 50% «гематопоэтической», клетки дифференцировались в гематопоэтические и в эндотелиальные клетки, с низкой частотой (Wang, L., et al., 2004), сходной с частотой, полученной для мышиных ЭСК (Choi, К., et al., 1998). Эти результаты свидетельствуют о том, что часть CD45- PFV+ клеток обладает характеристиками гемангиобласта. Низкая пролиферация единичных CD45- PFV+ клеток исследователями объясняется не оптимизированной техникой анализа. Другое возможное объяснение низкой пролиферации заключается в том, что CD45- PFV+ из ЭТ по своим генетическим и эпигенетическим характеристикам не полностью соостветсвуют in vivo аналогам- клеткам, выбранным как позитивный контроль.

2.4 Регуляция плюрипотентности и самоподдержаиня ЭСК.

ОСТ4, Sox2, Nanog - ключевые регуляторы, необходимые для образования и поддержания внутренней клеточной массы бластоцисты мыши и самоподдержания и плюрипотентности ЭСК (Avilion, А.А., et al., 2003, Chambers, I., et al., 2003, Mitsui, K., et al., 2003, Nichols, J., et al., 1998, Niwa, H., et al., 2000, Scholer, H.R., et al., 1990). OCT4 -транскрипционный фактор, содержащий POU домен, кодируемый геном Pou5fl. В отсутствии ОСТ4 in vivo (эпибласт) и in vitro (ЭСК) клетки дифференцируются в трофобласты. Превышение эндогенного уровня экспрессии ОСТ4 в ЭСК приводит к дифференцировке в экстраэмбриональную эндодерму. Этот дивергентный эффект наводит на мысль о том, что ОСТ4 регулирует транскрипцию генов, участвующих в регуляции процессов, необходимых для поддержания плюрипотентности ЭСК in vitro и эпибласта in vivo. Сайт связывания ОСТ4 - 8 нуклеотидная последовательность ATGCAAAT. В ЭСК Oct4 часто связывается с регуляторной областью гена-мишени совместно с транскрипционным фактором Sox2, чьи сайты связывания обычно располагаются рядом (Chambers, I., Smith, А., 2004, Pesce, М., Scholer, H.R., 2001).

Nanog был идентифицирован как транскипционный фактор, содержащий гомеодомен, способный поддерживать ЭСК в плюрипотентном состоянии в отсутствии LIF. Эмбрионы с генетическим нокаутом гена Nanog дифференцируются в экстраэмбриональную эндодерму. В процессе развития зародыша Nanog необходим позже, чем ОСТ4, но и тот и другой необходимы для поддержания плюрипотентности. Nanog непосредственно регулирует экспрессию ОСТ4 и Sox2. Эти два транскрипционных фактора регулируют гены, участвующие в поддержании плюрипотентности или ингибировании дифференцировки. Кроме того, Nanog регулирует гены Foxd3 и Setdbl (Loh, Y.H., et al., 2006). Foxd3 кодирует транскрипционный репресеор, необходимый для поддержания внутренней клеточной массы (эпибласта) и ЭСК (Guo, Y., el al., 2002, Hanna, L.A., et al., 2002). Setdbl кодирует метилтрансферазу гистона НЗ, необходимую для выживания ЭСК мыши (Dodge, J.E., et al., 2004). Перечисленные гены необходимы для нормального эмбрионального развития. Для некоторых из этих генов, например для гена ОСТ4, показано участие эпигенетических механизмов в регуляции их экпрессии. Для ОСТ4 также показана низкая эффективность реактивации при переносе ядра соматической клетки в энуклеированый ооцит (Bortvin, A., et al., 2003). То есть, эпигенетические модификации мешают реактивации гена, поэтому, наряду с изучением генетических механизмов регуляции экспрессии генов, ответственных за поддержания плюрипотентности, необходимо также изучить их эпигенетическую регуляцию.

Как следует из вышеизложенного материала, реализация той или иной программы дифференцировки, которая приводит к появлению клеток определенного фенотипа, осуществляется на генетическом и эпигенетическом уровнях. Более того, реализация этих программ должна приводить к формированию физиологически функциональных клеток того или иного фенотипа. Таким образом, задачами настоящего исследования являлись: определение эпигенетических изменений ключевых транскрипционных факторов, поддерживающих плюрипотентность ЭСК, разработка метода направленной дифференцировки ЭСК в физиологически функциональные клетки и определение изменения эпигенетического статуса ключевых генов, вовлеченных в регуляцию разнообразных функий специализированных клеток.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЙ

Ферменты и реактивы

В работе использовались ферменты и реактивы, производимые Sigma, Merck, ICN Biomedicals, Inc. Invitrogen, Chemicon, Hyclone. Пластик фирм Greiner, Corning и Costar.

Приготовление покрытых матриксом культуральных чашек и планшетов

Желатинизирование: Раствор 0.1% желатина (Sigma) готовили, автоклавируя суспензию желатина в деионизованной воде в течение 45 мин (0.5 атм, 120°С) Лунки планшетов или 35 мм культуральные чашки покрывали раствором желатина и инкубировали в течение 10 мин. при 37°С, непосредственно перед использованием желатин удаляли. Покрытие коллагеном IV: коллаген (Sigma) растворяли в ЮтМ уксусной кисло re (Sigma) до конечной концентрации 10 мкг/мл, наносили в каждую лунку б-ти луночной планшеты, инкубировали 12 часов при 8°С или 1 час при 37°С, отбирали незаполимеризовававшийся раствор и дважды промывали PBS.

Покрытие агарозой: 1,5% агарозу (Bio Rad) расплавляли на водяной бане (95°С) наносили в чашки Петри, давали заполимеризоваться и диализовали против среды в течение 12 часов.

Покрытие матригелем: для покрытия 48-луночных плашек использовался In Vitro Angiogenesis Assay Kit ECM625 (Chemicon) согласно прилагаемой инструкции. Приготовленный раствор компонентов наносился в лунку и инкубировался до полимеризации 1 час при 37°С.

Клеточные линии

В работе использовались линии эмбриональных стволовых клеток человека ESM01, ESM02 и ESM03 (Lagarkova, М.А. et al., 2006), первичные эндотелиоциты пупочной вены

HUVEC), предоставленные П.П. Лактионовым (ИХБФМ СО РАН, Новосибирск) и первичные инактивированные мышиные эмбриональные фибробласты (МЭФ).

Приготовление фидерного слоя мышиных эмбриональных фнбробластов Состав среды для культивирования МЭФ

Среда для культивирования МЭФ имела следующий состав: DMEM (Hyclone, high glucose), 10% фетальная бычья сыворотка (Hyclone) , антибиотики пенициллин-стрептомицин (50 ЕД/мл; 50 мкг/мл) (Invitrogen). Приготовленная среда фильтровалась через 0.22 мкм целлюлозно-ацетатный фильтр с низким связыванием белка (Corning). Получение мышиных эмбриональных фибробластов

Фибробласты приготавливали из 12-дневных эмбрионов F1 (C57BL/6JxCBA/Ca ). Эмбрионы, предварительно извлеченные из матки мыши, измельчали и кратковременно пипетировали в 2мл 0,25% трипсин/ЭДТА (Invitrogen), после чего инкубировали 10 минут при 37 °С. Инактивировали трипсин/ЭДТА 5 мл среды для культивирования и переносили в 15 мл пробирку, где диссоциировали пипетированием. Далее оставляли на несколько секунд для осаждения крупных фрагментов ткани и супернатапт переносили в 100 мм культуральную чашку или 75 см флакон. На следующий день пересевали клетки 1:3, если клетки достигли 80-85% монослоя. Через 24 часа сменяли среду на свежую, а на следующий день МЭФ замораживали или использовали для приготовления фидерного слоя. Среда для заморозки МЭФ имела следующий состав: DMEM (Invitrogen), 20% фетальная бычья сыворотка (Invitrogen), 10% ДМСО (ICN Biomedicals, Inc.).

МЭФ для приготовления фидера использовали до 4-го пассажа, смену культуральной среды проводили через день. Обработка МЭФ митомицином С

Готовили раствор митомицина С (Sigma) с концентрацией 1мг/мл в PBS, фильтровали через 0.22 мкм целлюлозно-ацетатный фильтр (Corning). Для остановки пролиферации в среду для МЭФ добавляли митомицин С в конечной концентрации 10 мкг/мл, инкубировали в течение 2 часов при 37 С и 5% СОг. Затем клетки снимали с помощью трипсин/ЭДТА как описано выше. Количество клеток подсчитывали в камере Горяева и высевали в необходимой плотности на желатинизированный культуральный пластик. Фидер использовался на следующий день.

Культивирование ЭСК человека

Состав среды для культивирования ЭСК человека

Среда для культивирования ЭСК человека имела следующий состав: Knockout DMEM (Invitrogen), 20% ES Serum Replacement (Invitrogen), 2 мМ L-глутамин (Invitrogen), 0.1 мМ р-меркаптоэтанол (Sigma), 1% смесь аминокислот (Invitrogen), рекомбинантный bFGF (4 нг/мл) (Chemicon), пенициллин/стрептомицин (50 ЕД/мл; 50 мкг/мл) (Invitrogen).

Эмбриональные стволовые клетки культивировали при 37°С и 5% СОг па фидерном слое МЭФ, инактивированных митомицином С в желатинизированных 35 мм культуральных чашках Петри (Corning и Greiner). Перед пересевом ЭСК на новый фидер с него удаляли среду для культивирования МЭФ и добавляли среду для культивирования ЭСК. Клетки пассировали каждые 5-6 дней культивирования механической диссекцией или обработкой 0.05% трипсином. Замораживание и оттаивание ЭСК человека

Среда для замораживания ЭСК человека имела следующий состав: 90% Сыворотки ES defined (Hyclone), 10 % ДМСО. Колонии снимали с фидера, как описано выше, центрифугировали, надосадочную жидкость удаляли, осадок суспендировали в среде для заморозки. В каждую криовиалу помещали 1 мл клеточной суспензии и сразу переносили на 24 часа на -70°С. На следующий день криовиалы перемещали в жидкий азот для продолжительного хранения. В 1 мл среды замораживали клетки одной 35 мм чашки с 50% монослоя

Формирование и культивирование эмбрноидных телец

Состав среды для культивирования эмбриоидиых телец

Среда для культивирования эмбриоидных телец имела следующий состав: Knockout DMEM (Invitrogen), 20% фетальная бычья сыворотка (Hyclone ЕС ) , 2 мМ L-глутамин, 0.1 мМ p-меркаптоэтанол (Invitrogen), 1% смесь аминокислот (Invitrogen), пенициллин-стрептомицин (50 ЕД/мл; 50 мкг/мл) (Invitrogen). Приготовленная среда фильтровалась через 0.22 мкм целлюлозно-ацетатный фильтр с низким связыванием белка (Corning). Формирование эмбриоидных телец

Колонии эмбриональных стволовых снимались коллагеназой IV (Gibco). Для этого удаляли культуральную среду, клетки промывали PBS, добавляли 0,5 мл раствора коллагеназы IV (1 мг/мл) на 35 мм чашку, инкубировали при 37°С в течение 7-10 минут. Затем удаляли раствор коллагеназы IV, промывали дважды PBS и добавляли 1 мл культуральной среды. Колонии соскабливали пластиковым наконечником на 5-200 мкл, осторожно диссоциировали на фрагменты (400-600 клеток), центрифугировали, надосадочную жидкость удаляли, осадок суспендировали в среде для культивирования эмбриоидных телец и переносили в чашки Петри, покрытые слоем 1.5% агарозы (BioRad), диализованной Knockout DMEM, для избежания прикрепления к пластику. На следующий день ЭСК формировали плавающие округлые агрегаты. Среда сменялась через день. На 45 день культивирования эмбриональные тельца увеличивались в размере, начинала появляться полость.

Дифференцировка ЭСК человека в эндотелиальные клетки и культивирование эндотелиальных клеток.

Для индукции эндотелиальной дифференцировки колонии недиференцированных ЭСК снимали механической диссекцией или коллагеназой IV как описано выше и переносились на чашки Петри, покрытые коллагеном IV типа (Sigma) в среду, содержащую DMEM/F12 (HyClone), 15% фетальной бычей сыворотки (HyClone, characterized), 1% смесь аминокислот (Invitrogen) пенициллин/стрептомицин (50 ЕД/мл; 50 мкг/мл) (Invitrogen), рекомбинантный bFGF (5 нг/мл) (Chemicon), SCF (20 нг/мл) (Chemicon), VEGF от 5 до 25 нг/мл (Chemicon), EGF (2нг/мл) (Chemicon)

Иммуномагнитная сепарация - MACS (Magnetic cell sorting) Для выделения of CD31+ клеток, клетки, растущие на чашках, покрытых коллагеном IV на 5 или 8 день, диссоциировали обработкой 0.05% трипсин/ЭДТА(Нус1опе) при 37°С в течение 10 мин,после инактивации трипсина 5% сывороткой дважды промывали PBS, содержащим 0.5% BSA, инкубировали 30 мин с мышиными антителами против CD31 человека (BD) и затем с IgG козы против антител мыши, пришитыми к магнитным шарикам (Miltenyi Biotec) в течение 15 мин при 8°С. После каждого этапа клетки дважды промывали PBS, содержащим 0.5% BSA. Для получения фракции CD31 позитивных клеток производили элюцию на колонке (Miltenyi Biotec) прикрепленной к магнитному блоку Mini-MACS separation unit (Miltenyi Biotech), согласно рекомендациям производителя. Оценка жизнеспособности проводилась с помощью (Лимфоциты. Методы, 1990) окраски клеток акридиновым оранжевым и бромистым этидием (Sigma). По 100 мкг/мл каждого в PBS приливали к равному объему клеточной суспензии, окраску оценивали в камере Горяева под флуоресцентным микроскопом Leica DMR. Живые клетки не окрашиваются бромистым этидием, а мертвые клетки окрашиваются и бромистым этидием, и акридиновым оранжевым, соответственно, при наложении картинок, полученных в красном и зеленом фильтрах, мертвые клетки - оранжевые, а живые - зеленые.

Проточная цитофлуометрия

Клетки были ресуспендированы в PBS, содержащем 2% FBS в концентрации 5 х 105 клеток/мл и инкубированы 30 минут на 4°С с первичными анти-С031 антителами (BD Biosciences) после чего клетки дважды отмывались PBS и 2% FBS и затем инкубировались со вторичными антителами коньюгированными с флуорохромом Alexa 488 (Molecular

Probes). Данные анализировались с помощью проточного флуоцитометра FACSCalibur (BD Biosciences) с использованием програмное обеспечение FlowJo (Tre Star Inc.). Доля позитивных клеток определялась с помощью сравнения с контрольным окрашиванием клеток мышиными антителами изотипа IgGl kappa (BD Biosciences).

Тест на матригеле (Matrigel Assay)

0.5.2x104 клеток высевалось в покрытые матригелем лунки 48-луночной планшеты, (Chemicon) в 0,5 мл ростовой среды для эидотелия без факторов роста, инкубировались 12 часов при 37°С, 5% СОг. Морфология клеток анализировалась в фазовом контрасте на инвертированном световом микроскопе (Nikon Eclipse TS100F)

Иммуноцитохимический анализ

Для иммуногистохимического анализа эмбриональных стволовых клеток и эмбриоиных телец использовались следующие антитела: первичные (mouse anti-human CD31 (BD), rabbit anti-human CD31 (Dako) mouse anti-human vWF(BD), mouse anti-human CD 105 (BD), mouse anti-human CD34 (Miltenyi Biotec),mouse anti-human VE-cadherin (ABCAM), anti-human Flk 1 (Chemicon), mouse anti-human CD 133 (MiltenyiBiotec) и вторичные (goat anti-mouse Alexa Fluor 488 или 546 Ig , goat anti-rabbit Alexa Fluor 546 Ig (Molecular Probes)).

Окраска антителами клеточных культур

1. Клетки на плашке или покровном стекле промывали 2 раза PBS

2. Клетки фиксировали 5 мин при -20С в 100% метаноле

3. Промывали PBS-0,1 %Tween20 2 раза

4. Блокировали неспецифическую сорбцию антител инкубацией в течение 30 мин в растворе PBS-0,l%Tween20, содержащем 5% сухого обезжиренного молока (или 5% FBS), 5% сыворотки козы при комнатной температуре.

5. Первичные антитела наносили в разведениях, рекомендованных производителем (обычно 1-10 мкг/мл), в PBS-0,l%Tween20, содержащем 5% сухого обезжиренного молока. Инкубировали 1 час при комнатной температуре.

6. Отмывали 3 раза по 5 мин в PBS-0,l%Tween20

7. Вторичные антитела наносили в разведениях 1:1000 - 1:500, инкубировали 30 мин при комнатной температуре.

8. Отмывали 3 раза по 5 мин в PBS-0,1 %Tween20

9. Инкубировали с DAPI (4',6-диамино-2-фенилииндол дигидрохлорид) 0,1 мкг/мл в PBS 10 мин.

10. Отмывали 1 раз в PBS-0,l%Tween20

11. Заключали под Mowiol (Sigma) под покровное стекло

Окраска антителами срезов эмбриоидных телец

Эмбриоидные тельца промывали дважды PBS, затем заливали жидкостью для заморозки ткани (Leica), замораживали в парах жидкого азота в течение 5 минут, затем делали срезы толщиной 5-10 мкм на криотоме Leica. Срезы фиксировали на предметном стекле охлаждённым до -20°С ацетоном или метанолом в течение 5 минут, промывали дважды по 5 мин PBS. Блокировали неспецифическую сорбцию антител и инкубировали с антителами как описано выше. Видеомикроскопия.

Окрашенные флуоресцентной меткой препараты клеток изучали при помощи видеоидентификационной микроскопии на флуоресцентном микроскопе Leica DMR. Остальные препараты изучали с помощью светового микроскопа Nikon Eclipse TS100.

Компьютерный анализ регуляторных областей (определение сайтов рестрикции, выбор зондов, выбор праймеров). Последовательности ДНК, содержащие предполагаемые регуляторные области исследуемых генов, были получены с помощью поисковой системы BLAT http://geiwme.ucsc.edu/cgi-bin/huBLAT) и программы Human Genome Browser Gateway (http://www.genome.ucsc.edii/cui-bin/hgGatewav). Анализ последовательностей на наличие сайтов рестрикции производился с помощью компьютерной программы NEBcutter 2.0 (http://tools.neb.com/NEBcutter2/index.php^ Последовательности зондов согласно перечисленным выше критериям анализировались на отсутствие неспецифических гомологии с помощью поисковой программы BLAST на сервере NCBI (http://www.ncbi.nlm.nih.gov/BLAS4).

Агарозный гель-электрофорез ДНК.

Гель-электрофорез ДНК проводили в 0.8 - 1.5 % агарозном геле, содержащем буфер ТАЕ (Tris-Acetate-EDTA) с 10 мкг/мл бромистого этидия. ДНК детектировали с помощью трансиллюминатора в ультрафиолете (302нм).

Выделение хромосомной ДНК и приготовление образцов хромосомной ДНК для Саузерн-блот-гибридизационного анализа.

Клетки или эмбриоидные тельца, предварительно отмытые от среды в PBS, суспендировали в 0, 7 мл буфера, содержащего 100 мМ NaCl, 10 мМ Tris-HCl рН 8.0, 25 мМ ЭДТА рН 8.0, 0.5% SDS и 0.1 мг/мл протеиназы К. Обработку протеиназой К осуществляли в течение ночи при 5б°С. ДНК экстрагировали равным объемом фенола/ хлороформа, затем равным объемом хлороформа и преципитировали 1/12 объема 7,5 М ацетата аммония, 3 объемами этанола. После двукратной промывки в 70% этаноле ДНК растворяли в буфере ТЕ в концентрации 0,2 мг/мл.

Для Саузерн-блот-гибридизационного анализа образцы хромосомной ДНК обрабатывались несколькими рестрикционными эндонуклеазами в течение ночи при 37°С. На каждую реакцию брали по 5-7 мкг образца ДНК при соотношении 5-10 ед. каждого фермента на 1 мкг ДНК. Для избавления от примеси РНК образцы обрабатывали панкреатической рибонуклеазой А (0.25 мг/мл) в течение 15-30 минут при 37 С. Образцы

ДНК экстрагировали фенолом, преципитировали этанолом и растворяли в 30 мкл воды для нанесения на электрофорез.

Выделение тотальной РНК из клеточных культур.

Для выделения тотальной РНК из клеточных культур использовали колонки MiniRNA kit (Qiagen) согласно прилагающемся инструкциям. Обработка Днказой осуществлялась непосредственно на колонках, с использованием прилагающемуся к набору MiniRNA kit Днказы и буфера.

Реакция обратной транскрипции.

Реакцию обратной транскрипции проводили с использованием случайных шестинуклеотидных праймеров (Amersham Biosciences), ферментов RevertAid M-MuLV Reverse Transcriptase (EP0441, Fermentas), Ribonuclease Inhibitor (RNasin, N211A, Promega), dNTP (27-2035-02, Pharmacia Biotech) при 37°C в течение 60 минут. На одну реакцию брали 0,5 - 1 мкг тотальной РНК. Продукты обратной транскрипции использовались для дальнейшего анализа с помощью полимеразной цепной реакции.

Полимеразная цепная реакция.

Для проведения ПЦР-амплификации продуктов реакции обратной транскрипции мы брали 0,1 - 0,5 часть реакционной смеси. Для ПЦР-амплификации с модифицированной бисульфтом натрия ДНК брали также 0,1 - 0,5 часть реакционной смеси. Для синтеза зондов для гибридизации брали 0,2-0,5 мкг геномной ДНК из лимфоцитов человека. Реакционная смесь содержала по 10 пмоль каждого праймера (нпф «Синтол»), 0,2 мМ смесь нуклеотидов и Taq полимеразу (ЕР0402, Fermentas) с соответствующим буфером. Последовательности праймеров для ОТ-ПЦР указанны в Таблице №2, для бисульфитного секвенирования в Таблице №3, для синтеза зондов для гибридизации в Таблице №1

Название гена Последовательность праймеров

DPPA3 5' TGTTGGG AC ATG ATCTATGCCT3'

5' ССАССАССACTGCCCАТААЗ'

DPPA5 5' CGG ACTGTTCTCCGCCTCTT3' 5' GCTCGCTGCCAGC АССТТЗ'

ОСТ4 5' GGC ATTCCCATCCCG ATACTG3' 5' CCAGGCCC АТТСА AGGGTTG3'

NANOG 5'TGGGCACGGAGTAGTCTTG3' 5'GGATGCATGCACCTTAAATTC3'

Таблица № 1

Электрофорез и перенос образцов ДНК на мембрану

Для Саузерн-блот гибридизации фрагменты ДНК, полученные с помощью обработки хромосомной ДНК рестрикционными эндонуклеазами, разделяли в 0.9% агарозном геле при нагрузке 5-10 мкг ДНК на дорожку. В качестве стандартов молекулярных масс использовали набор фрагментов, отличающихся на 1 т.п.н. (Gene Ruler 1 kb ladder, Fermentas). После завершения электрофореза гель обрабатывали следующим образом:

1. Апуринизация: инкубация геля в 0.25М НС1 в течение 5 минут.

2. денатурация: инкубация геля в растворе 0.5 М NaOH/ 1.5 М NaC] в течение 40 минут с одной сменой раствора.

3. нейтрализация: инкубация геля в растворе 1М Tris-HCl рН 8.0/ 1.5 М NaCl в течение 40 минут с одной сменой раствора.

После обработки осуществляли перенос ДНК на нейлоновую мембрану Hybond-N (Amersham) в буфере lOxSSC в течение ночи методом капиллярного блоттинга.

Фиксация ДНК на фильтре достигалась облучением фильтра ультрафиолетом (302 нм) в течение 10 мин. на трансиллюминаторе.

Название гена Последовательность праймеров

VE-cadherin 5'CCGGCGCCAAAAGAGAGA3' 5' СACGGACGCATTGAАСААСЗ'

GATA-2 5'CCCTAAGCAGCGCAGCAAGAC3' 5 'TGACTTCTCCTGCATGCACT3'

GATA-3 5'TCACAAAATGAACGGACAGAAC3' 5' GGGTTAA ACG AGCTGTTCTTG3' eNOS 5'GTGATGGCGAAGCGAGTGAAG3' 5'CCGAGCCCGA ACACACAGAAC3'

CD31 5' GCTGTTGGTGG A AGGAGTGC3' 5' GAAGTTGGCTGGAGGTGCTC3'

Flkl 5 'TGGAGGTGACTGAGTGCAG3' 5' GACCATGCCAGCATAGCTG3'

DPPA3 5'TACTCCGTCGAGAGTCTGTAG3' 5'TTGGGCTTCTAAGACACATGG3'

DPPA5 5' ACCTG A AAGATCCAGAGGTGT3' 5'CCGGCTTCATTGCATTGGCT3'

ОСТ4 5'CGACCATCTGCCGCTTTGAG3' 5'CCCCCTGTCCCCCATTCCTA3'

NANOG 5' AGCATCCGACTGTAA AGAATCTTCAC3' 5' CGGCCAGTTGTTTTTCTGCCACCT3'

GAPDH 5'GAAGGTGAAGGTCGGAGTCA3' 5' TTC ACACCC ATGACGAACAT3'

Таблица № 2

Приготовление меченых ДНК-зондов

Зонды для гибридизации по Саузерну получали методом рассеянной ДНК-затравки ( Megaprime labeling kit, Amersham) как описано производителем. В качестве матрицы использовали выделенные из агарозного геля фрагменты ПЦР. Процент включения определяли с помощью связывания ДНК из реакционной смеси на GF/C фильтре, отмывая ДНК от невключившихся нуклеотидов 10 % ТХУ. Стандартный процент включения составлял 50-70%. Очистку от невключившихся нуклеотидов осуществляли с помощью" PCR QIAquick Spin Column (Qiagen).

Гибридизация.

Предгибридизация мембран проводилась в буфере, содержащем 0.5 М Na-фосфат, рН 7.2; 7% SDS; 1 мМ ЭДТА, рН 8.0, денатурированую ДНК спермы лосося (Sigma) в концентрации 100 мкг/мл в течении 2-3 часов при 65 "С.Гибридизацию проводили в буфере того же состава, содержащем денатурированный кипячением меченный зонд (1-2.5 цО'/мл, 1-6x106 срт) при 65 °С в течение 18-24 часов. Мембраны отмывали в 1% SDS/ 2xSSC 2 раза по 20 мин, затем в 0,1%SSC/0,1% SDS при 65оС. Отмытые мембраны радиоавтографировались с экранами для детекции радиоактивного фосфора к прибору Cyclone Storage Phosphor Screen фирмы Packard в течение 12-24 часов. Изображения анализировали с помощью программы OptiQuant той же фирмы.

Геномное бисульфитное секвенирование

Геномная ДНК была подвергнута бисульфитной модификации в соответствии с инструкциями, прилагающимися к киту для бисульфитной модификации ДНК (S7824, CpGenome™ Fast DNA Modification Kit, Chemicon). Аликвоты ДНК, модифицированной бисульфитом натрия, были использованы для ПЦР при 45 циклах амплификации. Праймеры (нпф «Синтол») для ПЦР были подобраны к промоторным районам генов eNOS, GATA-2, GATA-3, соответсвующие модифицированной бисульфитом матрице (Таблица № ). Продукты ПЦР были клонированы в вектор pGEM с помощью набора pGEM-T Easy (А 1360, Promega). 10 клонов каждого продукта ПЦР были секвенированы. Статистическая достовернасть разницы уровня метилирования ДНК промоторных районов генов определялась с помощью критериев t - теста Стьюдента. Уровень статистической достоверности был принят р < 0,05.

Название гена Последовательность праймеров Положение праймеров относительно старта транскрипции eNOS 5' TGATTTTTTGGTGGTTTTATTTTGTT3' 5' СТСТТС АААТТАССС АТАТТАСТАТЗ' -321 37

GATA-2 5'AGTGTGGATGTATAGGGTGTG3' 5' АСАААСААТАААСАААСТТАААСААЗ' -217 67

GATA-3 5' GATGATATTAGAAATTTTTTTAAGTTG3' 5'ААТССТССС АААТААТТАААААСААЗ' -139 252

Таблица №3

Заключение диссертации по теме "Генетика", Волчков, Павел Юрьевич

выводы

1. Показано, что экспрессия генов транскрипционных факторов ОСТ-4 и NANOG в ходе дифференцировки ЭСК человека сопровождается изменением уровня метилирования их регуляторных районов.

2. Продемонстрировано, что уровень метилирования регуляторных районов генов Dppa-З и Dppa-5 различается между линиями ЭСК человека и не отражается на уровне экспрессии этих генов во время дифференцировки.

3. Разработан новый протокол дифференцировки ЭСК человека в функциональные клетки эндотелия.

4. Впервые показано, что повышение экспрессии генов транскрипционных факторов, участвующих в дифференцировке в эндотелий, GATA-2, GATA-3 и гена eNOS при дифференцировке ЭСК человека в клетки эндотелия сопровождается деметилированием регуляторных районов этих генов.

5. Впервые показано, что во время дифференцировки ЭСК человека в клетки эндотелия антисмысловой по отношению к гену eNOS ген SONe не участвует в регуляции экспрессии гена eNOS.

Список литературы диссертационного исследования кандидат биологических наук Волчков, Павел Юрьевич, 2008 год

1. Прыжкова М.В., Получение, характеристика и возможности дифференцировки эмбриональных стволовых клеток человека. Диссертация 2004.

2. Albrecht, E.W., Stegeman, C.A., Heeringa, P., Henning, R.H., van Goor, H. Protective role of endothelial nitric oxide synthase. J Pathol. 2003, 199, 8-17.

3. Aoki, M., Yasutake, M., Murohara, T. Derivation of functional endothelial progenitor cells from human umbilical cord blood mononuclear cells isolated by a novel cell filtration device. Stem Cells. 2004, 22: 994-1002.

4. Aoki, F., Worrad, D.M., Schultz, R.M. Regulation of transcriptional activity during the first and second cell cycles in the preimplantation mouse embryo. Dev Biol. 1997, 181:296-307.

5. Arney, K.L., Bao, S., Bannister, A.J., Kouzarides, Т., Surani, M.A. Histone methylation defines epigenetic asymmetry in the mouse zygote. Int J Dev Biol. 2002, 46: 317320.

6. Asahara, Т., Murohara, Т., Sullivan, A., Silver, M., van der Zee, R., Li, Т., Witzenbichler, В., Schatteman, G., Isner, J.M. Isolation of putative progenitor endothelial cells for angiogenesis. Science. 1997, 275, 964-967.

7. Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., Lovell-Badge, R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 2003, 17, 126-140.

8. Baharvand, H., Jafary, H., Massumi, M., Ashtiani, S.K. Generation of insulin-secreting cells from human embryonic stem cells. Dev Growth Differ. 2006, 48: 323-332.

9. Beaujean, N., Hartshome, G., Cavilla, J., Taylor, J., Gardner, J., Wilmut, I., Meehan, R., Young, L. Non-conservation of mammalian preimplantation methylation dynamics. Curr Biol. 2004, 14:266-267.

10. Bernstein, E., Allis, C.D. RNA meets chromatin. Genes Dev. 2005, 19: 16351655.

11. Bernstein, E., Kim, S.Y., Carmell, M.A., Murchison, E.P., Alcorn, H., Li, M.Z., Mills, A.A., Elledge, S.J., Anderson, K.V., Hannon, GJ. Dicer is essential for mouse development. Nat Genet. 2003, 35: 215-217.

12. Bird, A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002, 16:6.21.

13. Bortvin, A., Eggan, K., Skaletsky, II., Akutsu, H., Berry, D.L., Yanagimachi, R., Page, D.C., Jaenisch, R. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development. 2003, 130: 1673-1680.

14. Bortvin, A., Goodheart, M., Liao, M., Page, D.C. Dppa3 / Pgc7 / stella is a maternal factor and is not required for germ cell specification in mice. BMC Dev. Biol. 2004, 4: 2-6

15. Bouwman, P., Gollner, H., Elsasser, H.P., Eckhoff, G., Karis, A., Grosveld, F., Philipsen, S., Suske, G. Transcription factor Sp3 is essential for post-natal survival and late tooth development. EMBO J. 2000, 19: 655-661.

16. Boyes, J., Bird, A. DNA methylation inhibits transcription indirectly via a methyl-CpG binding protein. Cell. 1991,64: 1123-1134.

17. Burch, J.B. Regulation of GATA gene expression during vertebrate development. Semin Cell Dev Biol. 2005, 16: 71-81.

18. Byrne, J.A., Mitalipov, S.M., Clepper, L., Wolf, D.P. Transcriptional profiling of rhesus monkey embryonic stem cells. Biol Reprod. 2006, 75: 908-915.

19. Carlson, L.L., Page, A.W., Bestor, Т.Н. Properties and localization of DNA methyltransferase in preimplantation mouse embryos: implications for genomic imprinting. Genes Dev. 1992, 6: 2536-2541.

20. Cerdan, C., Rouleau, A., Bhatia, M., VEGF-A165 augments erythropoietic development from human embryonic stem cells. Blood. 2004, 103, 2504-12.

21. Chadwick, K., Wang, L., Li, L., Menendez, P., Murdoch, В., Rouleau, A., Bhatia, M. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood. 2003, 102, 906-915.

22. Chambers, 1., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell. 2003, 113, 643-655.

23. Chambers, I., Smith, A. Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene. 2004, 23, 7150-7160.

24. Chan, Y., Fish, J.E., D'Abreo, C. The cell-specific expression of endothelial nitric-oxide synthase: a role for DNA methylation. J Biol Chem. 2004, 279: 35087-35100.

25. Charron, F., Nemer, M. GATA transcription factors and cardiac development. Semin Cell Dev Biol. 1999, 10: 85-91.

26. Cheong, H.T., Takahashi, Y., Kanagawa, H. Birth of mice after transplantation of early cell-cycle-stage embryonic nuclei into enucleated oocytes. Biol Reprod. 1993, 48: 958-963.

27. Choi, K., Kennedy, M., Kazarov. A., Papadimitriou, J.C., Keller, G. A common precursor for hematopoietic and endothelial cells. Development. 1998, 125, 725-732.

28. Chung, Y.S., Zhang, W.J., Arentson, E., Kingsley, P.D., Palis, J., Choi, K. Lineage analysis of the hemangioblast as defined by FLK1 and SCL expression. Development. 2002, 129, 5511-5520.

29. Coraux, C., Hilmi, C., Rouleau, M., Spadafora, A., Hinnrasky, J., Ortonne, J.P., Dani, C., Aberdam, D. Reconstituted skin from murine cmbryonic stem cells. Curr Biol. 2003, 13: 849-853.

30. Cowan, C.A., Atienza, J., Melton, D.A., Eggan, K. Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells. Science. 2005, 309: 1369-1373.

31. Cowan, P.J., Tsang, D., Pedic, C.M. The human ICAM-2 promoter is endothelial cell-specific in vitro and in vivo and contains critical Spl and GATA binding sites. J Biol Chem. 1998, 273: 11737-11744.

32. Daheron, L., Opitz, S.L., Zaehres, H., Lensch, W.M., Andrews, P.W., Itskovitz-Eldor, J., Daley, G.Q. LIF/STAT3 signaling fails to maintain self-renewal of human embryonic stem cells. Stem Cells. 2004, 22: 770-778.

33. Dean, W., Santos, F., Stojkovic, M., Zakhartchenko, V., Walter, J., Wolf, E., Reik, W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci USA. 2001, 98: 13734-13738.

34. Deb-Rinker, P., Ly, D., Jezierski, A., Sikorska, M., Walker, P.R. Sequential DNA methylation of the Nanog and Oct-4 upstream regions in human NT2 cells during neuronal differentiation. J Biol Chem. 2005, 280: 6257-6260.

35. Dey, R., Barricntos, A., Moraes, C.T. Functional constraints of nuclear-mitochondrial DNA interactions in xenomitochondrial rodent cell lines. J Biol Chem. 2000, 275: 31520-31527.

36. Do, J.T., Scholer, H.R. Nuclei of embryonic stem cells reprogram somatic cells. Stem Cells. 2004, 22: 941-949.

37. Dodge, J.E., Kang, Y.K., Beppu, H„ Lei, H., Li, E. Histone H3-K9 methyltransferase ESET is essential for early development. Mol Cell Biol. 2004, 24: 2478-2486.

38. Dorfman, D.M., Wilson, D.B., Bruns, G.A., Orkin, S.H. Human transcription factor GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endothelial cells. J Biol Chem. 1992, 267: 1279-1285.

39. D'Souza, F.M., Sparks, R.L., Chen, H., Kadowitz, P.J., Jeter, J.R. Jr. Mechanism of eNOS gene transfer inhibition of vascular smooth muscle cell proliferation. Am J Physiol Cell Physiol. 2003,284: 191-199.

40. Eggan, K., Baldwin, K., Tackett, M., Osborne, J., Gogos, J., Chess, A., Axel, R., Jaenisch, R. Mice cloned from olfactory sensory neurons. Nature. 2004, 428: 44-49.

41. Fish, J.E., Marsden, P.A. Endothelial nitric oxide synthase: insight into cell-specific gene regulation in the vascular endothelium. Cell Mol Life Sci. 2006, 63: 144-162.

42. Fish, J.E., Matouk, C.C., Rachlis, A., Lin, S., Tai, S.C., D'Abreo, C., Marsden, P.A. The expression of endothelial nitric-oxide synthase is controlled by a cell-specific histone code. J Biol Chem. 2005, 280: 24824-24838.

43. Fulka, H., Mrazek, M., Tepla, O., Fulka, J. DNA methylation pattern in human zygotes and developing embryos. Reproduction. 2004, 128: 703-708.

44. Garlanda, C., Dejana, E. Heterogeneity of endothelial cells. Specific markers. Arterioscler Thromb Vase Biol. 1997, 17, 1193-1202.

45. Ge, Y.Z., Pu, M.T., Gowher, II., Wu, H.P., Ding, J.P., Jeltsch, A., Xu, G.L. Chromatin targeting of de novo DNA methyltransferases by the PWWP domain. J Biol Chem. 2004, 279: 25447-25454.

46. George, K.M., Leonard, M.W., Roth, M.E. Embryonic expression and cloning of the murine GATA-3 gene. Development. 1994, 120: 2673-2686.

47. Gerecht-Nir, S., Ziskind, A., Cohen, S., Itskovitz-Eldor, J. Human embryonic stem cells as an in vitro model for human vascular development and the induction of vascular differentiation. Lab Invest. 2003, 83: 1811-1820.

48. German, Z., Chambliss, K.L., Pace, M.C., Arnet, U.A., Lowenstein, С J., Shaul, P.W. Molecular basis of cell-specific endothelial nitric-oxide synthase expression in airway epithelium. J Biol Chem. 2000, 275: 8183-8189.

49. Gossrau, G., Thiele, J., Konang, R., Schmandt, Т., Brustle, O. BMP-mediated modulation of lineage diversification during neural differentiation of embryonic stem cells. Stem Cells. 2007

50. Grass, J.A., Boyer, M.E., Pal, S„ Wu, J., Weiss, M.J., Bresnick, E.H. GATA-1-dependent transcriptional repression of GATA-2 via disruption of positive autoregulation and domain-wide chromatin remodeling. Proc Natl Acad Sci USA. 2003, 100: 8811-8816.

51. Guillot, P.V., Liu, L., Kuivenhoven, J.A., Guan, J., Rosenberg, R.D., Aird, W.C. Targeting of human eNOS promoter to the Hprt locus of mice leads to tissue-restricted transgene expression. Physiol Genomics. 2000, 2: 77-83.

52. Guo, Y., Costa, R., Ramsey, H., Starnes, Т., Vance, G., Robertson, K., Kelley, M., Reinbold, R., Scholer, H., Hromas, R. The embryonic stem cell transcription factors Oct-4 and

53. FoxD3 interact to regulate endodermal-specific promoter expression. Proc Natl Acad Sci USA. 2002, 99, 3663-3667.

54. Hajkova, P., Erhardt, S., Lane, N., Haaf, Т., El-Maarri, O., Reik, W., Walter, J., Surani, M.A. Epigenetic reprogramming in mouse primordial germ cells.Mech Dev. 2002, 117: 15-23.

55. Hakelien, A.M., Landsverk, H.B., Robl, J.M., Skalhegg, B.S., Collas, P. Reprogramming fibroblasts to express T-cell functions using cell extracts. Nat Biotechnol. 2002, 20: 460-466.

56. Hanna, L.A., Foreman, R.K., Tarasenko, I.A., Kessler, D.S., Labosky, P.A. Requirement for Foxd3 in maintaining pluripotent cells of the early mouse embryo. Genes Dev. 2002, 16, 2650-2661.

57. Hattori, N., Imao, Y., Nishino, K., Hattori, N., Ohgane, J., Yagi, S., Tanaka, S., Shiota, K. Epigenetic regulation of Nanog gene in embryonic stem and trophoblast stem cells. Genes Cells. 2007, 12: 387-396.

58. Hattori, N., Nishino, К., Ко, Y.G., Hattori, N., Ohgane, J., Tanaka, S., Shiota, K. Epigenctic control of mouse Oct-4 gene expression in embryonic stem cells and trophoblast stem cells. J Biol Chem. 2004, 279: 17063-17069.

59. Hatzopoulos, A.K., Folkman, J., Vasile, E., Eiselen, G.K., Rosenberg, R.D. Isolation and characterization of endothelial progenitor cells from mouse embryos. Development. 1998, 125, 1457-1468.

60. Hay, D.C., Sutherland, L., Clark, J., Burdon, T. Oct-4 knockdown induces similar patterns of endoderm and trophoblast differentiation markers in human and mouse embryonic stem cells. Stem Cells. 2004, 22: 225-235.

61. Hay, D.C., Zhao, D., Ross, A., Mandalam, R., Lebkowski, J., Cui, W. Direct Differentiation of Human Embryonic Stem Cells to Hepatocyte-like Cells Exhibiting Functional Activities. Cloning Stem Cells. 2007, 9: 51-62.

62. Hendrich, В., Bird, A. Identification and characterization of a family of mammalian methyl-CpG binding proteins. Mol Cell Biol. 1998, 18: 6538-6547.

63. Heng, B.C., Haider, H.Kh., Sim, E.K., Cao, Т., Ng, S.C. Strategies for directing the differentiation of stem cells into the cardiomyogenic lineage in vitro. Cardiovasc Res. 2004, 62:34-42.

64. Hermann, A., Schmitt, S., Jeltsch, A. The human Dnmt2 has residual DNA-(cytosine-C5) methyltransferase activity. J Biol Chem. 2003, 278: 31717-31721.

65. Hiiragi, Т., Solter, D. Reprogramming is essential in nuclear transfer. Mol Reprod Dev. 2005, 70:417-421.

66. Hirashima, M., Kataoka, H., Nishikawa, S., Matsuyoshi, N., Nishikawa, S. Maturation of embryonic stem cells into endothelial cells in an in vitro model of vasculogenesis. Blood. 1999, 93, 1253-1263.

67. Hochedlinger, K., Blelloch, R., Brennan, C., Yamada, Y., Kim, M., Chin, L., Jaenisch, R. Reprogramming of a melanoma genome by nuclear transplantation. Genes Dev. 2004, 18:1875-1885.

68. Hochedlinger, K., Jaenisch, R. Monoclonal mice generated by nuclear transfer from mature В and T donor cells. Nature. 2002, 415: 1035-1038.

69. Howlett, S.K., Reik, W. Methylation levels of maternal and paternal genomes during preimplantation development. Development. 1991, 113: 119-127.

70. Huber, T.L., Kouskoff, V., Fehling, H.J., Palis, J., Keller, G. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature. 2004, 432, 625630.

71. Inoue, K., Ogonuki, N., Miki, H., Hirose, M., Noda, S., Kim, J.M., Aoki, F., Miyoshi, H., Ogura, A. Inefficient reprogramming of the hematopoietic stem cell genome following nuclear transfer. J Cell Sci. 2006, 119: 1985-1991.

72. Inoue, K., Wakao, H., Ogonuki, N., Miki, H., Seino, K., Nambu-Wakao, R., Noda, S., Miyoshi. H., Koseki, H., Taniguchi. M., Ogura, A. Generation of cloned mice by direct nuclear transfer from natural killer T cells. Curr Biol. 2005, 15: 1114-1118.

73. Itskovitz-Eldor, J., Schuldiner, M., Karsenti, D., Eden, A., Yanuka, O., Amit, M., Soreq, H., Benvenisty, N. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers. Mol Med. 2000, 6: 88-95.

74. Iuchi, S., Dabelsteen, S., Easley, K., Rheinwald, J.G., Green, H. Immortalized keratinocyte lines derived from human embryonic stem cells. Proc Natl Acad Sci USA. 2006, 103: 1792-1797.

75. Jaenisch, R., Bird, A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet. 2003, 33: 245-254.

76. Jenuwein, Т., Allis, C.D. Translating the histone code. Science. 2001, 293: 10741080.

77. Johnson, M.H., McConnell, J.M. Lineage allocation and cell polarity during mouse embryogenesis. Semin Cell Dev Biol. 2004, 15: 583-597.

78. Jones, P.L., Veenstra, G.J., Wade, P.A., Vermaak, D., Kass, S.U., Landsberger, N., Strouboulis, J., Wolffe, A.P. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet. 1998, 19: 187-191.

79. Kanellopoulou, С., Muljo, S.A., Kung, A.L., Ganesan, S., Drapkin, R., Jenuwein, Т., Livingston, D.M., Rajewsky, K. Dicer-deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing. Genes Dev. 2005, 19: 489-501.

80. Kappel, A., Schlaeger, T.M., Flamme, I. Role of SCL/Tal-1, GATA, and ets transcription factor binding sites for the regulation of flk-1 expression during murine vascular development. Blood. 2000, 96: 3078-3085.

81. Kass, S.U., Landsberger, N., Wolffe, A.P. DNA methylation directs a time-dependent repression of transcription initiation. Curr Biol. 1997,7: 157-165.

82. Katsuyama, K., Shichiri, M., Marumo, F., Hirata, Y. NO inhibits cytokine-induced iNOS expression and NF-kappaB activation by interfering with phosphorylation and degradation of IkappaB-alpha. Artcrioscler Thromb Vase Biol. 1998, 18: 1796-1802.

83. Kaufman, D.S., Hanson, E.T., Lewis, R.L., Auerbach, R., Thomson, J.A. Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc Natl Acad Sci US A. 2001, 98, 10716-10721. .

84. Kawasaki, H., Taira, K. Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature. 2004, 431: 211-217.

85. Kikyo, N., Wade, P.A., Guschin, D., Ge, H., Wolffe, A.P. Active remodeling of somatic nuclei in egg cytoplasm by the nucleosomal ATPase ISWI. Science. 2000, 289: 23602362.

86. Kohda, Т., Inoue, K., Ogonuki, N., Miki, H., Naruse, M., Kaneko-Ishino, Т., Ogura, A., Ishino, F. Variation in gene expression and aberrantly regulated chromosome regions in cloned mice. Biol Reprod. 2005, 73: 1302-1311.

87. Kuroda, Т., Tada, M., Kubota, H., Kimura, H., Hatano, S.Y., Suemori, H., Nakatsuji, N., Tada, T. Octamer and Sox elements are required for transcriptional cis regulation ofNanog gene expression. Mol Cell Biol. 2005, 25: 2475-2485.

88. Lacaud, G., Keller, G., Kouskoff, V. Tracking mesoderm formation and specification to the hemangioblast in vitro.Trends Cardiovasc Med. 2004, 14, 314-317.

89. Lagarkova, M.A., Volchkov, P.Y., Lyakisheva, A.V., Philonenko, E.S., Kiselev, S.L. Diverse epigenetic profile of novel human embryonic stem cell lines. Cell Cycle. 2006, 5: 416-420.

90. Lane, N., Dean, W., Erhardt, S., Hajkova, P., Surani, A., Walter, J., Reik, W. Resistance of IAPs to methylation reprogramming may provide a mechanism for epigenetic inheritance in the mouse. Genesis. 2003, 35: 88-93.

91. Lei, H., Oh, S.P., Okano, M., Juttermann, R., Goss, K.A., Jaenisch, R., Li, E. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development. 1996, 122:3195-31205.

92. Lepikhov, K., Walter, J. Differential dynamics of histone H3 methylation at positions K4 and K9 in the mouse zygote. BMC Dev Biol. 2004, 4: 12.

93. Levenberg, S., Golub, J.S., Amit, M., Itskovitz-Eldor, J., Langer, R. Endothelial cells derived from human embryonic stem cells. Proc Natl Acad Sci USA. 2002, 99: 43914396.

94. Li, E., Bestor, Т.Н., Jaenisch, R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell. 1992, 69:915-926.

95. Li, J., Ishii, Т., Feinstein, P., Mombaerts, P. Odorant receptor gene choice is reset by nuclear transfer from mouse olfactory sensory neurons. Nature. 2004, 428: 393-399.

96. Li, L., Connelly, M.C., Wetmore, C., Curran, Т., Morgan, J.I. Mouse embryos cloned from brain tumors. Cancer Res. 2003, 63: 2733-2736.

97. Lim, U.M., Sidhu, K.S., Tuch, B.E. Derivation of Motor Neurons from three Clonal Human Embryonic Stem Cell Lines. Curr Ncurovasc Res. 2006, 3: 281-288.

98. Liu, H., Kim, J.M., Aoki, F. Regulation of histone H3 lysine 9 methylation in oocytes and early pre-implantation embryos. Development. 2004, 131: 2269-2280.

99. Lugus, J.J., Chung, Y.S., Mills, J.C., Kim, S.I., Grass, J.A., Kyba, M., Doherty, J.M., Bresnick. E.H., Choi. K. GATA2 functions at multiple steps in hemangioblast development and differentiation. Development. 2007, 134: 393-405.

100. Manes, C., Menzel, P. Demethylation of CpG sites in DNA of early rabbit trophoblast. Nature. 1981, 293,: 589-590.

101. Marin, M., Karis, A., Visser, P., Grosveld, F., Philipsen, S. Transcription factor Spl is essential for early embryonic development but dispensable for cell growth and differentiation. Cell. 1997, 89: 619-628.

102. Martin, M.J., Muotri, A., Gage, F., Varki, A., Human embryonic stem cells express an immunogenic nonhuman sialic acid. Nature Medicine 2005, 11: 228 — 232.

103. Matzke, M.A., Birchler, J.A. RNAi-mediated pathways in the nucleus. Nat Rev Genet. 2005, 6: 24-35.

104. Mayer, W., Niveleau, A., Walter, J. Fundele, R., Haaf, T. Demethylation of the zygotic paternal genome. Nature. 2000, 403: 501-502.

105. Meister, G., Tuschl, T. Mechanisms of gene silencing by double-stranded RNA. Nature. 2004, 431: 343-349.

106. Memili, E., First, N.L. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared with other species. Zygote. 2000, 8: 87-96.

107. Menendez, P., Wang, L., Chadwick, K., Li, L., Bhatia, M. Retroviral transduction of hematopoietic cells differentiated from human embryonic stem cell-derived CD45(neg)PFV hemogenic precursors. Mol Ther. 2004, 10,1109-1120.

108. Meng, L., Ely, J.J., Stouffer, R.L., Wolf, D.P. Rhesus monkeys produced by nuclear transfer. Biol Reprod. 1997, 57: 454-459.

109. Miller, R.A., Ruddle, F.H. Pluripotent teratocarcinoma-thymus somatic cell hybrids. Cell. 1976,9:45-55.

110. Mitsui, К., Tokuzawa, Y., Itoh, II., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., Yamanaka, S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell. 2003, 113, 631-642.

111. Monk, M., Boubelik, M., Lehnert, S. Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development. 1987, 99: 371-382.

112. Morgan, H.D., Santos, F., Green, K,, Dean, W., Reik, W. Epigenetic reprogramming in mammals. Hum Mol Genet. 2005, 14: 47-58.

113. Morris, K.V., Chan, S.W., Jacobsen, S.E., Looney, D.J. Small interfering RNA-induced transcriptional gene silencing in human cells. Science. 2004, 305: 1289-1292.

114. Murchison, E.P., Partridge, J.F., Tam, O.H., Cheloufi, S., Hannon, G.J. Characterization of Dicer-deficient murine embryonic stem cclls. Proc Natl Acad Sci USA. 2005, 102:12135-12140.

115. Musaro, A., McCullagh, K.J., Naya, F.J., Olson, E.N., Rosenthal, N. IGF-1 induces skeletal myocyte hypertrophy through calcineurin in association with GATA-2 and NF-ATcl. Nature. 1999,400:581-585.

116. Nan, X., Campoy, F.J., Bird, A. MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Cell. 1997, 88: 471-481.

117. Nan, X., Ng, H.H., Johnson, C.A., Laherty, C.D., Turner, B.M., Eisenman, R.N., Bird, A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature. 1998, 393: 386-389.

118. Ng, E.S., Davis, R.P., Azzola, L., Stanley, E.G., Elefanty, A.G. Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic differentiation. Blood. 2005, 106, 1601-1603.

119. Ng, H.H., Zhang, Y., Hendrich, В., Johnson, C.A., Turner, B.M., Erdjument-Bromage, H., Tempst, P., Reinberg, D., Bird, A. MBD2 is a transcriptional repressor belonging to the MeCPl histone deacetylase complex. Nat Genet. 1999, 23: 58-61.

120. Ng, R.K., Gurdon, J.B. Epigenctic memory of active gene transcription is inherited through somatic cell nuclear transfer. Proc Natl Acad Sci USA. 2005, 102: 19571962.

121. Nichols, J., Chambers, I., Taga, Т., Smith, A. Physiological rationale for responsiveness of mouse embryonic stem cells to gp 130 cytokines. Development. 2001, 128: 2333-2339.

122. Nichols, J., Zevnik, В., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H., Smith, A. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell. 1998, 95, 379-391.

123. Niwa, H., Miyazaki, J., Smith, A.G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet. 2000, 24, 372-376.

124. Nordhoff, V., Hubner, K., Bauer, A., Orlova, I., Malapetsa, A., Scholer, H.R. Comparative analysis of human, bovine, and murine Oct-4 upstream promoter sequences. Mamm Genome. 2001, 12: 309-317.

125. Ogonuki, N., Inoue, K., Yamamoto, Y., Noguchi, Y., Tanemura, K., Suzuki, O., Nakayama, H., Doi, K., Ohtomo, Y., Satoh, M., Nishida, A., Ogura, A. Early death of mice cloned from somatic cells. Nat Genet. 2002, 30: 253-254.

126. Ogura, A., Inoue, K., Ogonuki, N., Noguchi, A., Takano, K., Nagano, R., Suzuki, O., Lee, J., Ishino, F., Matsuda, J. Production of male cloned mice from fresh, cultured, and cryopreserved immature Sertoli cells. Biol Reprod. 2000, 62: 1579-1584.

127. Okano, M., Bell, D.W., Haber, D.A., Li, E. DNA methytransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell. 1999, 99: 247257.

128. Okano, M., Xie, S., Li, E. Dnmt2 is not required for de novo and maintenance methylation of viral DNA in embryonic stem cells. Nucleic Acids Res. 1998, 26: 2536-2540.

129. Okumura-Nakanishi, S., Saito, M., Niwa, H., Ishikawa, F. Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells. J Biol Chem. 2005, 280: 5307-5317.

130. O'Neill, L.P., VerMilyea, M.D., Turner, B.M. Epigenetic characterization of the early embryo with a chromatin immunoprecipitation protocol applicable to small cell populations. Nat Genet. 2006, 38: 835-841.

131. Orkin, S.H. Hematopoiesis: how does it happen? Curr Opin Cell Biol. 1995, 7:870-877.

132. Oshima, R.G., McKerrow, J., Cox, D. Murine embryonal carcinoma hybrids: decreased ability to spontaneously differentiate as a dominant trait. J Cell Physiol. 1981, 109: 195-204.

133. Oswald, J., Engemann, S., Lane, N., Mayer, W., Olek, A., Fundele, R., Dean, W. Reik, W., Walter, J. Active demethylation of the paternal genome in the mouse zygote. Curr Biol. 2000, 10:475-478.

134. Pan, G., Li, J., Zhou, Y., Zheng, H., Pei, D. A negative feedback loop of transcription factors that controls stem cell pluripotency and self-renewal. FASEB J. 2006, 20: 1730-1732.

135. Pan, J., McEver, R.P. Characterization of the promoter for the human P-selectin gene. J Biol Chem. 1993, 268: 22600-22608.

136. Pan, X., Minegishi, N., Harigae, H. Identification of human GATA-2 gene distal IS exon and its expression in hematopoietic stem cell fractions. Journal of biochemistry 2000, 127: 105-112.

137. Park, C.W., Chen, Z., Kren, B.T., Steer, C.J. Double-stranded siRNA targeted to the huntingtin gene does not induce DNA methylation. Biochem Biophys Res Commun. 2004, 323:275-280.

138. Park, J.H., Kim, S.J., Oh, E.J., Moon, S.Y., Roh, S.I., Kim, C.G., Yoon, H.S. Establishment and maintenance of human embryonic stem cells on STO, a permanently growing cell line. Biol. Reprod. 2003, 69: 2007-2014.

139. Pata, I., Studer, M., van Doorninck, J.H. The transcription factor GATA3 is a downstream effector of Hoxbl specification in rhombomere 4. Development. 1999, 126: 55235531.

140. Payer, В., Saitou, M., Barton, S.C., Thresher, R., Dixon, J.P., Zahn, D., Colledge, W.H., Carlton, M.B., Nakano, Т., Surani, M.A. Stella is a maternal effect gene required for normal early development in mice. Curr Biol. 2003, 13: 2110-2117.

141. Peng, Y., Jahroudi, N. The NFY transcription factor inhibits von Willebrand factor promoter activation in non-endothelial cells through recruitment of histone deacetylases. J Biol Chem. 2003, 278: 8385-8394.

142. Perkins, K.J., Davies, K.E. Ets, Ap-1 and GATA factor families regulate the utrophin В promoter: potential regulatory mechanisms for endothelial-specific expression. FEBS Lett. 2003, 538: 168-172.

143. Pesce, M., Marin, Gomez, M., Philipsen, S., Scholer, H.R. Binding of Spl and Sp3 transcription factors to the Oct-4 gene promoter. Cell Mol Biol (Noisy-le-grand). 1999, 45: 709-716.

144. Pesce, M., Scholer, H.R. Oct-4: gatekeeper in the beginnings of mammalian development.Stem Cells. 2001, 19, 271-278.

145. Qiu, C., Sawada, K., Zhang, X., Cheng, X. The PWWP domain of mammalian DNA methyltransferase Dnmt3b defines a new family of DNA-binding folds. Nat Struct Biol. 2002, 9: 217-224.

146. Quirici, N., Soligo, D., Caneva, L., Servida, F., Bossolasco, P., Deliliers, G.L. Differentiation and expansion of endothelial cells from human bone marrow CD133(+) cells. Br J Haematol. 2001, 115: 186-194.

147. Rafii, S., Lyden, D. Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration. Nat Med. 2003, 9, 702-712.

148. Reik, W., Santos, F., Mitsuya, K., Morgan, H., Dean, W. Epigenetic asymmetry in the mammalian zygote and early embryo: relationship to lineage commitment? Philos Trans R Soc Lond В Biol Sci. 2003, 358: 1403-1409.

149. Reubinoff, В. E., Itsykson, P., Turetsky, Т., Pera, M. F., Reinhartz, E., Itzik, A. and Ben-Hur, T. Neural progenitors from human embryonic stem cells. Nat. Biotechnol. 2001, 19, 1134-1140.

150. Rideout, W.M., 3rd, Wakayama, Т., Wutz, A., Eggan, K., Jackson-Grusby, L., Dausman, J., Yanagimachi, R., Jaenisch, R. Generation of mice from wild-type and targeted ES cells by nuclear cloning. Nat Genet. 2000, 24: 109-110.

151. Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, В., Ng, H.H., Robson, P. Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem. 2005, 280: 2473124737.

152. Rousset, J.P., Bucchini, D., Jami, J. Hybrids between F9 nullipotent teratocarcinoma and thymus cells produce multidifferentiated tumors in mice. Dev Biol. 1983, 96: 331-336.

153. Royston, B.D., Royston, D., Pearson, J.D. Aprotinin inhibits platelet adhesion to endothelial cells. Blood Coagul Fibrinolysis. 1992, 3: 737-742.

154. Santos, F., Hendrich, В., Reik, W., Dean, W. Dynamic reprogramming of DNA methylation in the early mouse embryo.Dev Biol. 2002, 241: 172-182.

155. Santos, F., Peters, A.H., Otte, A.P., Reik, W., Dean, W. Dynamic chromatin modifications characterise the first cell cycle in mouse embryos. Dev Biol. 2005, 280: 225-236.

156. Santos, F., Zakhartchenko, V., Stojkovic, M., Peters, A., Jenuwein, Т., Wolf, E., Reik, W., Dean, W. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol. 2003, 13: 1116-1121.

157. Sarraf, S.A., Stancheva, I. Methyl-CpG binding protein MBD1 couples histone H3 methylation at lysine 9 by SETDB1 to DNA replication and chromatin assembly. Mol Cell. 2004, 15:595-605.

158. Scholer, H.R., Ruppert, S., Suzuki, N., Chowdhury, K., Gruss, P. New type of POU domain in germ line-specific protein Oct-4. Nature. 1990, 344:435-439.

159. Shen, Y., Chow, J., Wang, Z., Fan, G. Abnormal CpG island methylation occurs during in vitro differentiation of human embryonic stem cells. Hum Mol Genet. 2006, 15: 26232635.

160. Shimizu, R., Yamamoto, M. Gene expression regulation and domain function of hematopoietic GATA factors. Semin Cell Dev Biol. 2005, 16: 129-136.

161. Siegfried, Z., Eden, S., Mendelsohn, M., Feng, X., Tsuberi, B.Z., Cedar, H. DNA methylation represses transcription in vivo. Nat Genet. 1999, 22: 203-206.

162. Simerly, C., Dominko, Т., Navara, C., Payne, C., Capuano, S., Gosman, G., Chong, K.Y., Takahashi, D., Chace, C., Compton, D., Hewitson, L., Schatten, G. Molecular correlates of primate nuclear transfer failures. Science. 2003, 300: 297.

163. Simonsson, S., Gurdon, J. DNA demethylation is necessary for the epigenetic reprogramming of somatic cell nuclei. Nat Cell Biol. 2004, 6: 984-990.

164. Singal, R., van Wert, J.M., Ferdinand, L. Jr. Methylation of alpha-type embryonic globin gene alpha pi represses transcription in primary erythroid cells. Blood. 2002, 100: 42174222.

165. Suetake, I., Shinozaki, F., Miyagawa, J., Takeshima, H., Tajima, S. DNMT3L stimulates the DNA methylation activity of Dnmt3a and Dnmt3b through a direct interaction. J Biol Chem. 2004, 279: 27816-27823.

166. Svoboda, P., Stein, P., Filipowicz, W., Schultz, R.M. Lack of homologous sequence-specific DNA methylation in response to stable dsRNA expression in mouse oocytes. Nucleic Acids Res. 2004, 32: 3601-3606.

167. Szabo, P.E., Hubner, K., Scholer, H., Mann, J.R. Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev. 2002, 115: 157-160.

168. Tada, M., Morizane, A., Kimura, H., Kawasaki, H., Ainscough, J.F., Sasai, Y., Nakatsuji, N., Tada, T. Pluripotency of reprogrammed somatic genomes in embryonic stem hybrid cells. Dev Dyn. 2003, 227: 504-510.

169. Tada, M., Tada, Т., Lefebvre, L., Barton, S.C., Surani, M.A. Embryonic germ cells induce epigenetic reprogramming of somatic nucleus in hybrid cells. EMBO J. 1997, 16: 6510-6520.

170. Tada, M., Takahama, Y., Abe, K., Nakatsuji, N., Tada, T. Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr Biol. 2001, 11:1553-1558.

171. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M. Embryonic stem cell lines derived from human blastocysts. Science. 1998, 282: 1145-1147.

172. Ting, A.H., Schuebel, K.E., Herman, J.G., Baylin, S.B. Short double-stranded RNA induces transcriptional gene silencing in human cancer cells in the absence of DNA methylation. Nat Genet. 2005, 37: 906-910.

173. Tsai, F.Y., Orkin, S.H. Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation. Blood. 1997, 89: 3636-3643.

174. Tsuji-Takayama, K., Inoue, Т., Ijiri, Y., Otani, Т., Motoda, R., Nakamura, S., Orita, K. Demethylating agent, 5-azacytidine, reverses differentiation of embryonic stem cells. Biochem Biophys Res Commun. 2004, 323: 86-90.

175. Villar, I.C., Francis, S., Webb, A., Hobbs, A.J., Ahluwalia, A. Novel aspects of endothelium-dependent regulation of vascular tone. Kidney Int. 2006, 70: 840-853.

176. Vodyanik, M.A., Bork, J.A., Thomson, J.A., Slukvin, I.I. Human embryonic stem cell-derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and analysis of lymphohematopoietic potential. Blood. 2005, 105, 617-626.

177. Wade, P.A., Gegonne, A., Jones, P.L., Ballestar, E., Aubry, F„ Wolffe, A.P. Mi-2 complex couples DNA methylation to chromatin remodelling and histone deacetylation. Nat Genet. 1999,23:62-66.

178. Wakayama, Т., Yanagimachi, R. Cloning of male mice from adult tail-tip cells. Nat Genet. 1999, 22: 127-128.

179. Wang, H., Cao, R., Xia, L., Erdjument-Bromage, H., Borchers, C., Tempst, P., Zhang, Y. Purification and functional characterization of a histone H3-lysine 4-specific methyltransferase. Mol Cell. 2001, 8: 1207-1217.

180. Watanabe, D., Suetake, I., Tada, Т., Tajima, S. Stage- and cell-specific expression ofDnmt3a and Dnmt3b during embryogenesis. Mech Dev. 2002, 118: 187-190.

181. Watt, F., Molloy, P.L. Cytosine methylation prevents binding to DNA of a HeLa cell transcription factor required for optimal expression of the adenovirus major late promoter. Genes Dev. 1988,2: 1136-1143.

182. Weiss, M.J., Orkin, S.H. GATA transcription factors: key regulators of hematopoiesis. Exp Hematol. 1995, 23: 99-107.

183. Xu, C, He, J.Q., Kamp, T.J., Police, S., Нао, X., O'Sullivan, C„ Carpenter, M.K., Lebkowski, J., Gold JD. Human embryonic stem cell-derived cardiomyocytes can be maintained in defined medium without serum. Stem Cells Dev. 2006, 15: 931-941.

184. Xu, D., Wilson, T.J., Chan, D., De Luca, E., Zhou, J., Hertzog, P.J., Kola, I. Etsl is required for p53 transcriptional activity in UV-induced apoptosis in embryonic stem cells. EMBO J. 2002, 21: 4081-4093.

185. Yu, J., Vodyanik, M.A., He, P., Slukvin, I.I., Thomson, J.A. Human embryonic stem cells reprogram myeloid precursors following cell-cell fusion. Stem Cells. 2006, 24: 168176.

186. Zafonte, B.T., Liu, S., Lynch-Kattman, M., Torregroza, I., Benvenuto, L., Kennedy, M., Keller, G., Evans, T. Smadl expands the hemangioblast population within a limited developmental window. Blood. 2007, 109:516-523.

187. Zambidis, E.T., Oberlin, E., Tavian, M., Peault, B. Blood-forming endothelium in human ontogeny: lessons from in utero development and embryonic stem cell culture. Trends Cardiovasc Med. 2006, 16: 95-101.

188. Zhan, X., Dravid, G., Ye, Z., Hammond, H., Shamblott, M., Gearhart, J., Cheng, L. Functional antigen-presenting leucocytes derived from human embryonic stem cells in vitro.Lancet. 2004, 364, 163-171.

189. Zhang, R., Min, W., Sessa, W.C. Functional analysis of the human endothelial nitric oxide synthase promoter. Spl and GATA factors are necessary for basal transcription in endothelial cells. J Biol Chem. 1995, 270: 15320-15326.

190. Zhang, S.C., Wernig, M., Duncan, I.D., Brustle, O., Thomson, J.A. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat. Biotechnol. 2001, 19: 1129-1133

191. Zhang, Y., Ng, H.H., Erdjument-Bromage, H., Tempst, P., Bird, A., Reinberg, D. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev. 1999, 13: 1924-1935.

192. Zhao, С., Meng, A. Spl-Hke transcription factors are regulators of embryonic development in vertebrates. Dev Growth Differ. 2005, 47: 201-211.

193. Zhou, Y., Lim, K.C., Onodera, K. Rescue of the embryonic lethal hematopoietic defect reveals a critical role for GATA-2 in urogenital development. EMBO J. 1998, 17: 66896700.

194. Zhou, Y., Yamamoto, M., Engel, J.D. GATA2 is required for the generation of V2 interneurons. Development. 2000, 127: 3829-3838.

195. Zvetkova, I., Apedaile, A., Ramsahoye, В., Mermoud, J.E., Crompton, L.A., John, R., Feil, R., Brockdorff, N. Global hypomethylation of the genome in XX embryonic stem cells. Nat Genet. 2005, 37: 1274-1279.

Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания.
В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.

Автореферат
200 руб.
Диссертация
500 руб.
Артикул: 339350