Механизмы взаимодействия энхансеров и промоторов тема диссертации и автореферата по ВАК 03.00.03, доктор биологических наук в форме науч. докл. Георгиева, София Георгиевна

Диссертация и автореферат на тему «Механизмы взаимодействия энхансеров и промоторов». disserCat — научная электронная библиотека.
Автореферат
Диссертация
Артикул: 135769
Год: 
2002
Автор научной работы: 
Георгиева, София Георгиевна
Ученая cтепень: 
доктор биологических наук в форме науч. докл.
Место защиты диссертации: 
Москва
Код cпециальности ВАК: 
03.00.03
Специальность: 
Молекулярная биология
Количество cтраниц: 
57

Введение диссертации (часть автореферата) На тему "Механизмы взаимодействия энхансеров и промоторов"

Контроль транскрипции у высших эукариотических организмов осуществляется в основном благодаря взаимодействию между собою цис-регуляторных элементов, энхансеров или сайленсеров и промоторов. С промоторами связываются базовые факторы транскрипции, а с энхансерами и сайленсерами - активирующие или ингибирукяцие белковые факторы, соответственно. Взаимодействие белков, находящихся на промоторах и энхансерах (или сайленсерах) определяет в значительной мере уровень экспрессии гена. Другим важнейшим фактором, определяющим уровень экспрессии гена является состояние хроматина, прежде всего, уровень ацетилирования гистонов нуклеосом, на который часто влияют факторы, связанные с цис-элементами, а также специальные группы белков (Ро1усотЬ, 'ГпЛогах и др.), влияющие на конденсацию или деконденсацшо хроматина.

Энхансеры (для краткости сайленсеры не будут далее упоминаться) могут находиться в разных местах относительно гена, и на разных расстояниях от последнего. Иногда эти расстояния достигают 100 тпн и более. При взаимодействии энхансера и промотора происходит выпетливание ДНК, расположенной

Бывают ситуации, когда промотор находится ближе к энхансеру чужого гена, чем к своему собственному. Таким образом, взаимодействие энхансера и промотора основано на наличии дальних взаимодействий в геноме на расстоянии вплоть до сотен тпн. (или сотых долей мм. при расчете на длину ДНК).

Возникает два важных вопроса. Первый вопрос, - как энхансер находит свой промотор и избегает взаимодействия с чужим промотором? Можно предположить, что гены разделены специальными погпаничными элементами,

40фичность а

КНИГА ИМЕЕТ

В перепл. слип, соеднн. БЫ П. о л Н и: исходит ггоры, взаимодействия в геноме? Некоторые данные поддерживали вторую гипотезу. Так хорошо известный белок Zeste, продукт гена zeste, может связываться с промоторной и энхансерной зоной некоторых генов и образовывать мультимерные комплексы за счет белок-белковых взаимодействий. Георгиевым П. (1994) генетическими методами были открыты три гена, е(у)1, е(у)2 и е(у)3, работающие в кооперации с геном zeste в регуляции экспрессии ряда генов Drasophila melanogaster. Они являются кандидатами на роль организаторов энхансер-промоторных взаимодействий.

Настоящая работа посвящена исследованию этих вопросов. Естественно, мы не претендовали на полный ответ на вопросы, над которыми работает много лабораторий мира. Нашей задачей было получить некоторые новые системы и исследовать новые гены, что дало бы дополнительную информацию по данным проблемам.

Одна из генетических систем состояла в переносе энхансера из своего локуса в регуляторную зону соседнего. Оказалось, что при этом он сохранял специфичность своего действия, т.е. основную роль в правильном узнавании для данного конкретного случая играла специфичность взаимодействия белков. Другая система состяла в изучении перестроек в геноме дрозофилы, вызванных дупликациями геномных последовательностей между мобильными Р элементами. Полученные на ней данные подтвердили выше приведенный вывод для целого ряда энхансеров, но также показали, что он не является универсальным. Кроме того, оказалось, что инсуляторы не всегда действуют как пограничные элементы. Они могут подавлять экспрессию генов, находясь от них на больших расстояниях и не разделяя при этом энхансер и промотор. Побочным результатом работы явилось выяснение механизма образования химерных мобильных элементов в геноме дрозофилы, которые отвечают за возникновение супер-нестабильных мутаций.

Одним из кандтдатов на роль факторов, помогающих энхансер-промоторным взаимодействиям являются белки, называемые TAF (TATA-binding protein associated factors). В настоящее время описана целая серия этих белков, и некоторые из них помогают транскрипции, активируемой определенными энхансерами. Они могут проявлять и промоторную специфичность. Обычно TAF белки эволюционно консервативны. Для одного из TAF-белков человека, TAFn30, не было обнаружено гомологов у дрозофилы. Мы, однако, нашли у дрозофилы целых два гомолога этого TAF: dTAFnl6 и dTAFn24. По данным гибридизации in situ эти два TAF-белка имеют разную хромосомную локализацию, т.е. участвуют в транскрипции разных генов. Это указывает на их специфичность в отношении разных генов, их промоторов и/или энханееров.

Наконец, мы проклонировали ген е(у)2 дрозофилы (а также мыши и человека), участвующий по данным генетических экспериментов в организации дальних взаимодействий. Оказалось, что этот ген кодирует новый эволюционно консервативный белок, участвующий в организации транскрипции. Интересно, что он структурно и функционально взаимодействует еще с одним TAF-белком, TAFn40. Таким образом, в настоящей работе выявлен ряд новых белков, помогающих организации дальних взаимодействий в хромосомах дрозофилы.

Актуальность проблемы. Регуляция транскрипция у эухариотических организмов является одной из центральных проблем молекулярной генетики, поскольку она играет ключевую роль в таких процессах, как рост, развитие и дифференцировка, и также в их нарушениях при раковых и других заболеваниях. Хотя многие аспекты проблемы подробно изучены, остается много открытых вопросов. Среди них вопросы о том, каким образом осуществляются дальние взаимодействия между энхансерами и промоторами, играющие ключевую роль в контроле транскрипции.

Научная новизна и практическая ценность Все научные результаты, полученные в работе, являются оригинальными. В частности, сюда относятся следующие результаты: (¿) получена генетическая система с двойной супернестабильностью, на которой изучены дальние взаимодействия, проведен ее анализ и также (й) расшифрованы необходимые условия и механизм возникновения химерных мобильных элементов, вызывающих супер-нестабильные аллели; (ш) впервые показана способность инсулятора блокировать промотор, не отделенный им от энхансера; (iv) впервые проклонирован и охарактеризован ген е(у)2, кодирующий новый фактор транскрипции, присутствующий у всех эукариотов, кроме дрожжей; (у) обнаружены и проклонированы гены, кодирующие два новых TAF белка дрозофилы и охарактеризованы их продукты. Эти результаты имеют не только теоретическое, но также, возможно, и практическое значение, так как многие факторы, участвующие в регуляции транскрипции, влияют на превращение нормальной клетки в раковую и некоторые из них являются онкогенами или генами-супрессорами опухолей. Кроме того, понимание контроля транскрипции важно для работ по созданию трансгенных животных.

Апробация работы. Материалы диссертации были доложены на следующих симпозиумах и конференциях: Cold Spring Harbor Symp. Quant. Biol. "Mechanism of transcription" (Cold Spring Harbor, 1998), 39-ая конференция по исследованию дрозофилы (Washington 1998), Симпозиум "Gene therapy and molecular biology" (Crete 1999), Симпозиум "Current problems of molecular genetics and cell biology" (Москва 2000).

Публикации. По теме диссертации опубликовано 17 статей и 4 тезисов.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 1. Специфичность энхансер-промоторного взаимодействия

В первой части работы мы изучали две системы, на которых проявилась специфичность взаимодействия энхансеров и промоторов сложного комплекса AS-C, включающего локусы achaete и scute Drosophila melanogaster (разделы 1.1 и 1.2). В ходе этих опытов выяснилась также новая роль инсуляторов, связанная с дальними взаимодействиями в геноме (раздел 1.3). Кроме того, были установлены факторы, определяющие образование химерных мобильных элементов (раздел 1.4).

1.1 Взаимодействие с промоторами aehaete-scute комплекса (AS-C) одного из энхансеров этих генов, перемещенного в локус yellow.

В нашей лаборатории имелся большой набор мутаций в хорошо охарактеризованных локусах, вызванных геномными перестройками, которые, в свою очередь, индуцировали мобильные элементы. Некоторые из них были подвергнуты молекулярному анализу, и среди них найдены системы, которые давали информацию о механизме узнавания своего энхансера промотором.

Исходной служила линия /se0', несущая две мутации в соседних локусах yellow и scute. Первая была вызвана внедрением мобильного элемента МДГ-4 (gypsy) перед геном yellow. Находящийся в МДГ-4 инсулятор отделял энхансеры для экспрессии гена в теле и крыльях от промотора, в результате чего тело и крылья были желтые. Вторая мутация была вызвана внедрением МДГ-4 и другого элемента, jockey, между генами achaete и scute и рядом AS-C энхансеров, обеспечивающих появление щетинок в определенных частях тела (рис. 1). Инсулятор МДГ-4 подавлял появление соответствующих щетинок, отделяя энхансеры от промоторов. Интересно, что энхансер для образования передних ното-плевральных щетинок (11Н11Щ) находился непосредственно между МДГ-4 и jockey.

В этой системе происходили реверсии у2 мутации к дикому типу (у+), также сопровождавшиеся в некоторых случаях восстановлением ПНПЩ. Мы провели i)

V+1MC П:МДГ-4ДКН У +змс Su(Hw) Y

У*

МДГ-4

3L

Su(Hw)

JL se у+2МС jaeíSÍL. у30+9 jockey

SC°1

МДГ-4

ЭаПНП 'оскву

ЭнПНП

10 тпн jockey

РХ ВНР SH Р

S Н Gt-P i-ПН В л II i L i . yellow

ЭнИНП jockey HG РМ

XGO В X

ЩГ-4

ННР N Р HG РНВ ХР ЭнПНП^Я0

J ' " --1U-1,4 11. III I1,

ХцСЭнПНП ^Р <?н Р

З'-ДКП

Ъ* s'-mn

SH GHP н-rfl В

JJUÜL

2 3

Табл. 1. Влияние мутации е(у)Т' на

Рис.1. Схема (А) и физическая карта (Б) области уеНок-Ав-С в разных исследованных аллелях. (1)-/«" (2 )-у+мс*сш (3)-/М Обозначения: ДКП-длинный концевой повтор, $и(Н\у)-инсулятор (черный кружок), ЭнПНП-энхансер дляПНПЩ (прямоугольник). Рестриктазы: В-ВатШ, О-В^П, Н-ЯгиШП, N-№011, Р-ЛЯ, Я-Есот, Ъ-ЯаП, Х-ХЬа\, 0-Хко\.

Пробы для блот гибридизации обозначены линиями под картой. Стрелки -направление транскрипции. На карте 1 справа от штриховой линии показана инсерция в ЛЯ-С.

Генотип Образование ПНПЩ (%) + e(y)¿" sc+ fscD' yHMCscD1 y+mcscm y+2V f*«sc0' 100 (100) 1(2) 1(1) 0(1) 74(90) 83(92) 100(100) 0(0) 0(0) 0(0) 29(51) 20(40)

Первые цифры-самцы, в скобках-самки. детальный молекулярный анализ структуры четырех таких реверсий. Для этого использовали блот-гибрвдизацию по Саузерну с пробами из разных участков исследуемой области, клонирование области мутаций и частичное их сиквенирование. Две реверсии,у*шс и/*, в которых восстановление ПНПЩ не происходило, были вызваны только вырезанием МДГ-4 из локуса yellow за счет рекомбинации между длинными концевыми повторами МДГ-4.

Две другие реверсии, у*2МС и у2**9, для которых было характерным восстановление ПНПЩ, имели более сложную природу. Происходила деления либо области инсулятора МДГ-4, либо вообще большей части МДГ-4 и замена этих последовательностей jockey и отрезком локуса AS-C, расположенным между jockey и МДГ-4 (рис. 1). Как выше отмечалось, он включает энхансер для ПНПЩ. В области изменений не происходило.

Таким образом, ПНГОД-энхансер, помещенный перед геном yellow в его регуляторную зону, продолжал активировать свои промоторы. Это указывает на существенную роль, по крайней мере в данной системе, специфичности энхансера и промотора для нахождения ими друг друга, а также на отсутствие барьеров между двумя исследуемыми локусами, которые препятствовали бы энхансер-промоторному взаимодействию.

Мы проверили также, насколько необычное расположение ПНПЩ энхансера и промотора делает систему менее устойчивой к мутациям в генах, потенциально участвующих в организации энхансер-промоторных взаимодействий. Мутации в локусах е(у)1 и е(у)3 эффекта не имели, но зато мутация e(y)T¡ подавляла это взаимодействие: ПНПЩ появлялись существенно реже (табл. 1). У мух дикого типа мутация е(у)2"' не влияла на образование ПНПЩ. Таким образом, необычное положение энхансера делает систему менее надежной.

1.2. Взаимодействие энхансеров и промоторов AS-C при инверсиях и инсерциях, нарушающих их взаиморасположение.

Другая генетическая система для изучения специфичности взаимодействия энхансеров и промоторов в системе генов yellow - AS-С была получена в ходе изучения двойных супер-нестабильных мутаций, вызванных химерными мобильными элементами. Химерные элементы состоят из двух копий дефектного Р элемента, окружающих геномную последовательность разной длины, произшедшую из другой области хромосомы, иногда даже из нескольких разных областей. Описано много мутаций такого типа в разных локусах, причем все они характеризуются супер-нестабильностью, давая примерно в 1% переход к новым и опять-таки разнообразным фенотипам (Георгиев П. и др. 1992,1997). Механизм возникновения химерных элементов был в момент проведения работы неизвестным.

Система с двойными мутациями в локусах yellow и achaete-scute. Среди многочисленных аллелей, полученных в локусе yellow, мы выбрали для анализа двойную мутацию у2"*'scmesl, которая влияла на экспрессию локусов yellow и AS-Q. Эта мутация была получена в линии y*m. В ней локус yellow содержит инсерцию МДГ-4 в позиции -700 пн по отношению к точке старта транскрипции и инсерцию химерного элемента в позиции -69 пн. Последний представлен двумя копиями Р элемента ориентированными в одном и том же направлении, противоположном направлению гена yellow, и геномными последовательностями общей длиной 19,7 тпн, происходящими из трех разных областей X хромосомы. Обе копии Р элемента имеют идентичную структуру. Они содержат делению от 830 до 2430 пн и на ее месте вставку последовательности TAGCTACAAA. При встраивании химерного элемента произошла делеция последовательности гена yellow от -70 до -146 пн, включающей часть промотора yellow. Последний, однако, сохраняет свою полную активность благодаря компенсаторному эффекту активирующих регуляторных последовательностей Р элемента. Наконец, у+ фенотип зависит от наличия в геномной последовательности химерного элемента энхансера. Собственные энхансеры тепа yellow, активирующие его экспрессию в теле и крыльях, подавлены вследствие включения между ними и промотором инсулятора, находящегося в МДГ-4 (рис. 2).

При индукции гибридного Р-М дисгенеза в линии у т скрещиванием со стабильным продуцентом транспозазы Р элемента, линией Р{гу+Д2-3}99В, среди производных была получена двойная мутация в локусах yellow и Л&'-С, y?"sIscmesI. Ее фенотип - желтая окраска тела, крыльев, грудных и ножных щетинок (у-фенотип) и отсутствие ряда групп щетинок (sc-фенотип).

Природа двойной мутации у2™'scmesI была установлена нами путем блот-гибридазации по Саузерну, клонирования геномной ДНК в фаге X, построения рестриктной карты клонированной инсерции и ее частичного сиквенйрования. Оказалось, что вставка имеет сложную организацию (рис. 2). Начальная часть зоны гена yellow имеет ту же структуру, что и в аллеле/1™. В позиции -700ян расположен МДГ-4, далее в положении -69 пн находится вставка химерного мобильного элемента. По краям вставки расположены два одинаковых дефектных Р элемента, обозначенные как /'1 (дистальный) и Р2 (проксимальный) по отношению к промотору гена yellow. Далее к голове Р2 элемента прилегает третий, почти полноразмерный Р элемент, J°3, длиной 2,9 тпн. Р2 и РЗ ориентированы голова к голове. За РЗ расположена область геномных последовательностей, которая представляет собою инверсию размером около 40 тпн с точками разрыва в районах генов yellow и scute. Поэтому к 3 '-концу РЗ элемента прилегает область AS-C в позиции 24,9 тпн в координатах Campusano S. & Modolell J. (1992). На другом конце инверсии находится ген yellow, начиная с -69 пн и включая всю остальную часть локуса. Таким образом, новая мутация вызвана инверсией района длиной около 40 тпн, который содержит три гена, yellow, achaete и scute и межгенные сегменты. По другую сторону инверсии находится еще одна копия Р элемента, РА, размером 2,2 тпн, ориентированная противоположно РЗ (голова к голове).

Происхождение РЗ и РА выяснилось при анализе района AS-C у исходного у*т аллеля. Оказалось, что он содержит две копии Р элемента идентичные РЗ и РА в области 24,9 тин AS-C. Таким образм, переход у'"" y2nslscmes' вызван инверсией

РОССИЙСКАЯ ГОСУДАРСТВЕННАЯ БИБЛИОТЕКА yellow ас У ns sc

ГЕНОТИПЫ

ПО ЛНП Б ИВ ОЦ ПС ППА ПСА СК

Рис. 2. Геномная структура и фенотип аллелей у^зс"1 вуя"ы5Ся,е".

A, Б. Выдержанные в масштабе схемы области уе11<т-ЛЗ-С в исходном аляеле у™ис' (А) и его производном у1т15Сте"1 (Б). ХЭ-химерный элемент, Р-Р элементы, ГП-геномныая последовательность химерного элемента; цифрами обозначены энхансеры уе11оу/ (1-для тела и крыльев, 3-для щетинок), химерного элемента (2) и АЯ-С (4-гПередних и задних дорзо-центральных, 5-передних супра-аларных и задних пост-аларных, 6-передних пост-аларных, 7-ПНП и 8-скутеллярных щетинок), черный кpyжoк-su(Hw) инсулятор, стрелки указывают направление транскрипции.

B, Г. Структура краев инверсии в аллеляку*"*'$сж*! (В) и его производных у"*ее" (Г). ГП-геномные последовательности химерного элемента. Рестриктазы: В-ВатШ, Н-ЯЫШ, Ъ-Бай, Х-Хко1

Д. вс-фенотипы в отсутствие и в присутствии ж(2?V/) мутаций. ПО-передние орбитальные, ПНП-передние нотоплевральные, Б-бедренные, ПВ-пост-вертикальные, ОЦ-оцеллярные, ПС-пост-сатуральные, ППА-передние пост-аларные, ПСА-передние супра-аларные и СК-скутеллярные щетинки. Белый квадрат-дикий тип: данная щетинка присутствует всегда; четверть квадрата черная: щетинка отсутствует чаще, чем в 10%; половина квадрата черная: щетинка отсутствует более, чем в 50%; черный квадрат: щетинка отсутствует более, чем в 90% случаев.

ЛЕПИПППППП РРВПППППП

П С1 и л п п п п п п п п п п п п п п между двумя Р элементами, Р1 и РА. Полученный в результате этого у2 фенотип можно объяснить переносом гена на большое расстояние от энхансера химерного мобильного элемента. Поскольку вследствие инверсии большая часть энхаясеров AS-C остается по другую сторону от точки разрыва, оказываясь вне инверсии, то этим можно было бы объяснить умеренный sc-фенотип полученной мутации.

Однако неожиданно оказалось, что при введении в линию мутации, инактивирующей ген su(Hw), происходит почти полное восстановление sc+ фенотипа (рис. 2). Известно, что продукт гена su(Hw) необходим для действия инсулятора МДГ-4, который в данном геномном контексте не должен влиять на экспрессию AS-C, будучи расположенным в стороне от эйхансеров и промоторов. О механизме этого эффекта речь пойдет ниже (см. раздел 1.3).

Роль специфичности энхаясеров и/или промоторов в их взаимодействии. Здесь же следует отметить, что и в новом положении, будучи отделенными от своих энхансеров геном yellow, промоторы achaete и scute нормально активируются большинством AS-C энхансеров (рис. 2). Исключением является энхансер, контролирующий образование бедренных щетинок (БЩ), а также отчасти энхансеры для ПНПЩ и передних орбитальных щетинок (ПОЩ). Таким образом, Для большинства A S-C энхансеров скорее всего взаимодействие с промоторами определяется специфичностью связывающихся с ними белков.

Для проверки этого утверждения надо было установить, действительно ли экспрессия AS-C в условиях инверсии активируется своими энхансерами. С этой целью были получены и исследованы аллели, в которых благодаря второй инверсии происходило удаление энхансеров AS- C. В линии часто возникали ревертанты с фенотипом y+sc+ в результате реинверсии области yellow - AS-С. Они не отличались от исходной линии у"* и были обозначены как y*msc*s. Из линии y"""sc!: после активации дисгенеза получены линии с более выраженным sc фенотипом. В них выявлены инверсии между РА и другими Р элементами генома, в результате чего энхансеры гена scute удаляются из района AS-C и перестают действовать. В двух линиях с помощью гибридизации in situ вторая точка инверсии была обнаружена в районе 9А или 4D. В этих двух линиях, y*m'scebs/ и y*m4sceas4, индуцировали P-M дисгенез и отбирали мух с мутантным у-фенотипом (кандидаты на инверсию). Четыре производных линии сохранили экстремальный sc фенотип и приобрели у2"5 фенотип. У них действительно была выявлена инверсия области генов yellow и AS-C, как в выше описанных аллелях (рис. 3). Никакой супрессии мутантного sc фенотипа при введении мутаций по гену su(llw) в них не происходило. Следовательно, в изучаемой системе активация генов AS-C полностью зависит от их собственных энхансеров.

Конкуренция промоторов yellow и AS-C за некоторые AS-C энхансеры. В выше описанных экспериментах по действию мутаций гена su(Hw) на фенотип аллеля y^'sc"1"' было замечено, что супрессия генов AS-C не является полной: БЩ не восстанавливались вообще, а ПОЩ и ПНПЩ - только частично. Причины этого выяснились при анализе производных мутаций типа У''л:-"15, которые возникали наиболее часто В потомстве j/^'ic"1®5'и которые характеризовались менее выраженным мутантным sc фенотипом и полным подавлением .экспрессии локуса yellow (рис. 4).

Анализ 30 таких производных путем блот-гибридизации и ПЦР клонирования с сиквенированием показал, что в 29 случаях изменение фенотипа было связано с делецией Р4 элемента, а в одном случае с делецией 637 пн прилежащего к Р4 отрезка локуса yellow. Как было показано ранее, все наши линии содержат делецюо гена yellow от -146 до -70 пн, что ведет к инактивации промотора, но в присутствии Р элемента происходит компенсация и полное восстановление промоторной функции. Таким образом Р элемент и оставшийся участок гена yellow составляют два компонента, необходимых для работы промотора. Как мы видим, действительно, делеция любого из них полностью инактивирует транскрипцию гена (рис. 4).

Интересным оказалось то, что введение мутаций su(Hw)v/su(Hwf полностью супрессирует мутантный sc фенотип. Таким образом, остаточный sc фенотип, наблюдавшийся в предыдущих опытах, был связан с дополнительным ингибированием энхансера для БЩ и отчасти энхансеров для ПОЩ и ПНПЩ

МДГ-4

8 ИННХ

ИНВЕРСИЯ 1, 1 тпн (для инсерций) ИНВЕРСИЯ ^ ИНВЕРСИЯ

50

60. 70]

2ю11 еЪз11 у 5С

НХ пе 2т12 еЪэП Гт у $С НХ ' тя РР в ШН НХ хннхня э еав41 у

7 .УС

ГЕНОТИПЫ ПСАПНППВ Щ

5и(Н*>)2Ли(Н*>/ 5и(Ну»)2/$и(Н*>У ппп

ЕЬИ. ышлл аюжл

П П п и В-КиВЛ в кннх

5 ЯННХ Б ЯН т в лн

Рис. 3. Геномная структура и фенотип аллелей со вторыми инверсиями, удаляющими А8-С энхансеры.

A. Производные содержащие инверсию между РЪ-РЛ и отдаленным Р элементом.

Б. Производные аллелей, приведенных в (А), возникшие в результате инверсии в области АЗ-С.

Приведены подробные карты Р элементов, ограничивающих инверсии. Рестриктазы обозначены, как на рис. 2.

B. Фенотипы полученных аллелей и влияние на них мутации в гене т(Нм>).

Обозначения щетинок, - как на рис. 2, кроме Щ. Последний символ означает групп}' Щетинок-, передние орбитальные, бедренные, оцеллярные, пост-сатуральные, передние пост-аларные и скутеллярные. у2пз^стей1

1 тлн у2 ас1 уе11оц> ^ ^

1з16 т$16 У ^ДЕЛЕЦИЯ р4ч

1 ГТн—П I 1 I г с н я н к x н нхн я

ВЫРЕЗАНИЕ Р4 I

ВС сааатаасата/ атсттатттсатсатс оааатаасасау тв^аттгсатсато атаа / вйааааас/ ттатпч

ЯШ.

ГЕНОТИПЫ

ПО ПНП Б ПВ ОЦ ПС ППА ПСА СК

5и(Н*)3/5и(И»>Г £1 СП ! той/той р И ; п п п п п п п п ел п п п тос!/тос1 ппппппппп ппппппппп хи(Нн>)3/5и(В*)г той/той

ППППППППП ппппппппп

Рис. 4. Конкуренция промотора тепауе11ои> за АЯ-С энхансеры бедренных и некоторых других групп щетинок.

А. Карта аллелей производных у2"*',!^*''1 с у1 фенотипом. Жирной чертой дана деления 637 пн промоторауеИом, внизу - остаточные последовательности на месте делегированного Р4 элемента. Треугольники - точки, где расположены праймеры для проведения ПЦР-клонирования.

Б. Фенотипы приведенных аллелей и влияние мутаций в локусах хи(Нм>) и тоЛ(тй^4). Обозначения щетинок - как на рис. 2. промотором гена yellow, который отделял их от собственных промоторов. На другие AS-С энхансеры промотор yellow влияния не оказывал.

Промотор yellow подавляет активность соответствующих энхансеров также и в отсутствие инверсии. Необходимо лишь, чтобы он находился между этими AS-С энхансерами и промоторами. В одном из следующих разделов мы показываем, что в системе, содержащей только PI, РЗ я Р4 элементы, часто происходит дупликация гена yellow между -РЗ и РА. В результате возникают линии mnay2src'i где подавлено образование БЩ и отчасти ПОЩ (рис. 5). Таким образом, встраивание промотора гена yellow между AS-С энхансерами и их промоторами избирательно блокирует взаимодействие БЩ и частично ПОЩ энхансеров со своими промоторами. Делеции РА или локуса yellow восстанавливают sc+ фенотип.

Таким образом, общего правила не существует. В одних случаях (большинство AS-C энхансеров, в частности определяющих возникновение поствертикальных, оцеллярных, пост-сатуральных, передних пост-апарных, передних супра-аларных и оцеллярных щетинок) внедрение чужого промотора никак не сказывается на взаимодействии энхансера со своим промотором, в других (ПОЩ и ПНГОЦ энхансеры) - чужой промотор слабо, но все же конкурирует со своим промотором за энхансер, наконец, в третьих (БЩ энхансер) специфичность отсутствует и активируется ближайший промотор. Иными словами, во многих случаях, хотя и не во всех, специфичность энхансер-промоторного взаимодействия является главным фактором правильного узнавания.

1.3. Подавление активности не изолированных инсулятором энхансеров как еще один пример дальних взаимодействий

Как показано в разделе 1.2, введение в линию с мутацией y2"s'scmesl второй мутации, транс-гетерозиготы su(Hw)Vsu(Hw}2, янактивирующей белок su(Hw) и тем самым инсулятор МДГ-4, приводит к почти полной супрессии sc фенотипа (рис. 2). Следовательно, в изучаемом аллеле, ylmiscmesl, инсулятор МДГ-4, расположенный по другую по отношению к энхансерам сторону от промоторов achaete и scute, на расстоянии около 70-75 тпн от энхансеров этих генов, тем не менее оказывает на

GX

GX yellow ac sc H В /W ^ ■ G

1 ТПН

S ft "*«elG R

X H y2s34scls4

P3 pi.p2>. y2s34sc + s41 J JH yellow y2s34scls42Щ

S R. HXHB w y2s34sc + s43 T yellow R те f w у ( (

R H R S лг

R HXH S

ГЕНОТИПЫ ПО ПНП £ ГШ ОЦ ПС ПГ1А ПСА СК дПРПППППП su(Hwf/su(Hw) * ППИПППППП yt^sc*" y^sc™ y^sc^2

Г-1ПППППППП ППППППГ1ПП С1ПИППП-ППП

Рис. 5. Возникновение дупликации гена yellow между двумя Р элементами и влияние его промотора на экспрессию AS-C.

А. Структура дупликации yellow между РЗ и РА элементами и последующих делеций одного из Р элементов или последовательности yellow. Треугольники -точки, где расположены праймеры для проведения ПДР-клонирования. Обозначения рестриктаз как на рис. 2.

Б. Фенотипы приведенных аллелей и влияние мутаций в локусе su(Hw). Обозначения щетинок - как на рис. 2. них сильное ингибирующее действие. Это явно противоречит современным представлениям о действии инсуляторов.

Контрольные эксперименты. В разделе 1.2 показано (рис. 3), что AS-C промоторы в линииактивируются своими энхансерами.

Другая серия контрольных опытов была предпринята с целью доказательства роли инсулятора su(Hw), расположенного перед тепам yellow в подавлении транскрипции. Во-первых, была проведена блот гибридизация по Саузерну всей исследуемой области с помощью рекомбинантных X клонов, покрывающих всю эту область, использованных в качестве пробы. Никаких дополнительных фрагментов, кроме МДГ-4 перед геном yellow и химерного элемента по сравнению с ДНК дикого типа (Oregon) не было выявлено.

С помощью рентгеновскрго облучения была получена делеция МДГ-4 за счет рекомбинации между его длинными концевыми повторами. Фенотип полученных аллелей не отличался от такового yy^'sc™*1 в комбинации с su(Hw//su(Hwf мутациями (рис. 2). Следовательно, su(Hw) инсулятор, входящий в состав именно данной копии МДГ-4, отвечает за подавление транскрипции генов achaete и scute.

Необычное действие инсулятора могло зависеть от присутствия химерного элемента, включающего протяженную геномную последовательность. Для получения аллелей, лишенных химерного элемента, среди производных yT,Ms-e+I аллелей был отобран аллель с диким sc+ фенотипом и мутантным у2 фенотипом. Поскольку активация транскрипции yellow в исходной линии зависела от энхансера, входящего в состав химерного элемента, то можно было ожидать утрату последнего у нового мутанта. Действительно, молекулярный анализ показал, что у y'2'scis мутанта произошла делеция химерного элемента, включая геномные последовательности и Р2 элемент. В геноме сохранились Р\,РЪж РА элементы (рис. 6).

Далее в этой линии для получения инверсий индуцировали/ЧМ дйсгенез. Были получены y^sc"" аллели, по фенотипу не отличимые от ранее описанных y!rs'scm" мутаций. При их анализе с помощью блот-гибридизации выявлена ох сх

МДГ-4 в

У 5С

1 тпн уеИоу/ ас яс Н В «Л+. 9

X н вх I

I I э а нхнн к э

ИНВЕРСИЯ зс ас уейо-н/

2/1^2/ тпе$21 У 5С 2п$26 тех26 У 5С

ГЕНОТИПЫ той/той то&той

ПОГШП Б ПВОЦ ПСППАПСАСК

ИЙПППППП (Б) аипп^ппп ппппппппп

ППИПП£1£1ПП РИ1ППЫС1ПП

Рис. 6. Ингибирующее действие инсулятора на не-изолированные им энхансеры при инверсии в отсутствие химерного элемента.

А. Карта аллеля с утратой химерного элемента и двух его производых с инверсией. Б. Фенотипы приведенных аллелей и влияние мутаций в локусах зи(Ш>) и тоА(т(1%4). Обозначения щетинок - как на рис. 2. инверсия между Р1 и РЗ или Р4 элементами (рис. 6). Химерный элемент, естественно, отсутствовал. В два таких производных были введены мутации, инактивирующие локус 5и(1Ы)у/т(Нм:)'. Оказалось, что их-действие точно такое же, как и в случае у^'хс"""1 аллеля (рис. 6). Иными словами, химерный элемент не отвечает залгеобычное поведение инсулятора.

О механизме ингибнруюшего действия инсулятора. Мы также сравнили особенности прямого ингибирования инсулятором, выявленного в настоящей работе, с его классическим инсулирующим эффектом. Последний был ранее описан для локуса А8-С на примере мутации $сл/, где инсерция МДГ-4 изолирует ряд энхансеров ЛЯ-С от промотора (Георгиев П., 1996). Оказалось, что введение мутации тод.(тй%4)ы', которая повреждает второй ген, участвующий в инсуляши, и его белковый продукт тоё(пк^4), одинаково снижает как инсуляцию (мутация зсР\ так и прямое ингибирование (у^'хс™1' аллель) (рис. 7).

Введение различных частичных повреждений в ген ¡и(Нм>) также сказывается одинаково на обеих мутациях (рис. 7). Удаление любого из ацидных доменов в аллелях ¡и(Н\м/ или яи(Ны)А"ю оказывает слабое супрессирующее действие. Удаление двух ацидных доменов в ¡и(Нм)коАС> вызывает сильную супрессию обеих мутаций. Удаление домена лейциновых молний в аллеле .уи{Нм/)т} дает промежуточный уровень супрессии мутантного фенотипа. Вероятно, инсуляция и прямое ингибирование транскрипции имеют одинаковые механизмы.

Таким образом, при инверсии района уе1\ом> - АБ-С инсулятор МДГ-4, расположенный за 20-40 тпн от промоторов АБ-С и 40-75 тпн от АЗ-С энхансеров, начинает ингибировать их активность, несмотря на то, что он физически не разделяет энхансеры и промоторы (рис. 8). Это заставляет пересмотреть некоторые представления, связанные с механизмом действия инсуляторов.

Согласно одной из наиболее популярных гипотез, инсуляторы образуют границы между доменами ДНК в хромосоме. Регуляторные элементы могут взаимодействовать между собою только, если они располагаются в одном и том же

ГЕНОТИПЫ ПО ПНП Б ПВ ОЦ ПС ППА ПСА СК su(Hw//su(Hw)v mod/ mod su(Hw)2/su(Hw)"i mod/mod su(Hw)NaA]3/su(Hw)NaAD su(Hwy/su(Hwy su(Hw)me/su(Ew)&iaa su(Hw)t2ti/su(Hw)t2i3 titrnnnnnn гавппяппп яяипппппп

CI .61 И 61 ELEL

1,61

CI П П П П П

CI CI sn CI CI 5П

CI CI 61 п П CI

Рис. 7. Влияние различных мутаций в локусах su(Hw) и mod(mdg4) на AS-C экспрессию в аллеле y2m'scmes'. mod - мутация mod(mdg4),u'.

19.7 и, ЭКСПРЕССИЯ AS-С yellow JP геномная Р у ас sc Р AS-C su(Hwf su(Hw)~ enh послед. 11 ^ ' ^—П enh ++++ ++++ sc oc

J3JL огДшдитйI *я "ш ^-nltwaa

-H-+ +++

J3L

EZ5E

ZED ни

ИНСУЛЯТОР: область связывания «и(Н«')

Рис. 8. Схематическая иллюстрация основных конструкций, возникших в процессе мутагенеза и их влияния на иягибирование знхансеров инсулятором, не-изолированных им от промоторов. епЪ-энхансер, Ьи-инсулятор Р-Р элементы. Число + указывает на уровень экспрессии в отсутствие и в присутствии т(Нп) мутации; ++++ экспрессия в мухах дикого типа домене. Этот постулат позволяет объяснить, почему энхансер узнает свой промотор, даже если он расположен ближе к промотору другого гена.

Однако, полученные в данной работе результаты плохо согласуются с моделями действия инсуляторов, как жестких границ между доменами ДНК в хроматине. Действительно, в описанных аллелях нарушается одно из главных правил действия инсуляторов, на котором и базируется модель границы. Инсулятор не разобщает в данном случае энхансер и промотор, но активно блокирует энхансер, расположенный по другую сторону от промотора и на расстоянии до 70-75 тан от инсулятора.

Полученные результаты лучше согласуются с гипотезой "ловушки" (Geyer Р., 1997), согласно которой белки, собирающиеся на инсуляторе, взаимодействуют с белками, связанными с энхансерами, образуя комплекс, имитирующий энхансер-промоторный комплекс. Этот комплекс, однако, является непродуктивным, т.е. он не участвует в транскрипции. В большинстве случаев инсулятор действует только, если располагается между энхансером и промотором, но в специальных случаях, например, при перестройке, имевшей место в наших аллелях, он можёт начинать прямо подавлять не изолированный от промотора энхансер. При этом, конечно, существуют и другие, более сложные объяснения наблюдавшегося феномена.

1.4. Механизм появления химерных элементов, вызывающих супер-нестабильные мутации.

Полученная нами генетическая система двойных мутаций оказалось полезной еще в одном отношении, хотя и не связанном с основным направлением исследований, но важным в обще-генетическом плане, а именно она йозволила подойти к пониманию того, как возникают химерные элементы, отвечающие за супер-нестабильные мутации.

Дупликации геномных последовательностей между двумя Р элементами в линии y*"sscmal. После активации Р элемента, в потомстве аллеля y2"sl sc"'esl, наряду с другими мутациями, возникали с частотой 0,7x1 (Г3 мутации с частичной реверсией у-фенотипа (рис. 9). Был проведен молекулярный анализ 19-х таких производных,y^s^Qi 1-15),/"Vй (N 16 и17) иy^sc™ (N 18 и 19), включавший блот-гибридизацию по Саузерну, ПЦР наиболее важных участков, клонирование и сиквенирование амшшфицированного продукта. Мухи линий y+Ves и y*mscws имели нормальную окраску тела и крыльев, тогда как у y*'"sscmes она была промежуточной между диким типом и у1"1'seта!.

Согласно блот-гибридизации, во всех 19 изученных аллелях с частичной реверсией у-фенотипа была обнаружена дупликация последовательностей гена yellow, включая целиком его кодирующую зону (рис. 9). Дупликация выявляется между 5'-концами Р2чРЗ элементов. У 10 из 15 аллелей y^sc™* (N 1-10) размер дупликации составлял от 5 до 10 тпн, причем ее ориентация совпадала с направлением гена в линии дикого типа. У пяти других адпелей yi"mscmes (N11-15) выявлена дупликация двух копий гена yellow, т.е. между Р2 я РЗ находились две копии гена в ориентации хвост к хвосту. Их общий размер составлял более 10 тпн.

Аллели /"V5 (N16,17) содержали более длинную дупликацию, совпадавшую по направлению с геном yellow. Ее длина была свыше 14 тпн, и она простиралась до гена achaete. Наконец, у аллелей y*,msc"'a дуплицированный ген yellow имел противоположное направление (N 18,19).

Таким образом, в системе возникая новый химерный элемент, содержащий дуплицированный геномный локус yellow, обрамленный по краям двумя копиями Р элемента. Это происходило за счет дупликации последовательности, прилежащей к 5'-концу одиночного РА элемента в участок на границе спаренных голова к голове Р1 и РЗ элементов (рис. 9).

Структура концов дупликации. Структуру Р элементов определяли с помощью блот-гибридизации после обработки различными рестриктазами, а стыки между Р элементами и геном yellow изучали с помощью ПЦР-клонирования и прямого сиквенирования (рис. 9, табл. 2). Как отмечалось выше, Р элементы всегда находились на обоих концах дупликации. Р2 элемент, содержащий сайты рестрикции ffindIII и Xhol в большинстве случаев сохранялся неизмененным. Только в двух производных (N 8,17) происходило его замещение на Р элемент размером 2,2 тпн, идентичный по рестриктной карте РА. Структура 5'-конца Р2 yellow sc ас <~

Гг^тТ"!1

GH R H R

1-4 1 it I II

ХЙЙ ХНРЯР s

6, 7, y+nsscV5 (16) y+mscmes

8) y+Vs (17)

53 9) y+lmscmes (18)

P2

P4

I-ГГ

S PR

P4

ПГ S PR

P2 J

T-r

X H P2

X H

T H

P3

-L

I t I RP S P3

P3 n-г

RP S

P3

T-П I П-г

H XH P RP S

P3

1 П 1 П г H XH P RP S y+Ves (П-15)

P2 С

X P2 Г

X H

P3

I 1 I 41-r

H XH P RP S

P3

T-1 I II)-г

H XH P RP S

Рис. 9. Дупликации гена yellow и структура полученных дупликаций в аллеле y2ns'scma'.

Дупликации и трипликации yellow указаны стрелками (не в масштабе). Приведены карты Р элементов, выявленных по краям дупликаций.

Табл. 2. Места и нуклеотидные последовательности в точках стыковки между J" элементами и yellow и между двумя последовательностями yellow.

Аллели У Ц}>) Р UP) Последовательность на стыке РЪ-yellow

Vs (1) 7548 4744 1997 910 AAGCAAAAAA/TA/TAATTGTTTA

2) 7770 4966 2362 545 CAATTCCAAT/AAA/TTGAGAATCA

3) 7546 4742 2231 676 GTTAAGCAA/AAAA/TAAAAGTAAA

4) 7740 4936 1345 1562 GCACTTTTTT/AAAAA/TTAACAAAAA

5) 7716 4912 1 2907 CACAAGATCT/gtcatatsgatgett22atesat2/

GACTGGAC/CATGATGAAA y-d Цу) у-р m Последовательность на стыке y-d и у-р

Vе (11) 7617 4813 5990 3096 AGCGGAAAA/AA/AATAGGAGAA

У L (у) Последовательность на стыке РА элемента и yellow

V (1) 3895 1091 CAACAAATGTAAGAGTGG(taaeaatestccagtc)CATGATG

AAA

2) 6708 3904 CTTCACGTGTGATGAGCGATG(tccagtc)CATGATGAAA

3) 7582 4778 TTTTGAAGGTTAAGAGT(gtccatgtccaetc)CATGATGAAA

4) 6694 3890 CCATACCA0TTCACG(tcac22t2tccaetc)CATGAT(}AAA

Сокращения: у-локализация разрыва в хеш yellow согласно его последовательности (Geyer Р. 1986), Ь(у)-размер дуплицировавшего отрезка гена yellow, Р-номер нуклеотида Р элемента от 5'-конца, ЦР)-размер прилежащего к концу дупликации Р элемента, y-d означает дистальную (прилегающую к Р2 элементу), а у-р -проксимальную (прилегающую к РЗ) последовательность yellow при трипликация последней.

Заглавными буквами указаны последовательности Р элементов и гена yellow, прописными - вставок (филлеров). Наклонные линии ограничивают зоны гомологии, которые могут принадлежать любому из двух стыкующихся элементов. Подчеркнуты зоны коротких гомологий. Жирные буквы выделяют вставку (филлер), присутствовавший перед возникновением дупликации. элемента и тева yellow на месте их стыка всегда была точно такой же, как и структура стыка Р4 с геном yellow в исходной линии. Последний начинался с -69 пн.

В отличие от Р2, исходно полноразмерный РЗ элемент имел вариабильную структуру. В восьми y^sc"** и двух y*mscws производных происходила утрата 5'-концевых последовательностей разной длины. При этом сохранялась 3'-концевая часть РЗ. С помощью ПЦР-клонирования и прямого сиквенирования была изучена структура стыков у четырех аллелей (N 1-4), где дупликация имела наименьшие размеры. Во всех была выявлена полная копия гена yellow. Место стыка представлено короткой последовательностью, соответствующей гомологичному участку генауе/fovf и Р элемента. Длина такой гомологии составляла 2-5 пн.

У двух у ^nsscme'' аллелей (N 5,9) РЗ элемент сохранился полностью. Полный РЗ элемент также выявляется у всех y*'"sscmes аллелей, где изменено направление дупликации. 5'-конец РЗ и начало хеш yellow - такое же, как у РА в исходной линии, а 5'-конец Р2 делегирован у аллеля N19 и практически полностью сохранен у аллеля N18. Дупликация опять-таки захватывает целиком весь ген yellow.

Наконец, у пяти y""ssc""m производных (N11-15), где дупликация содержала две копии гена yellow, ориентированные хвост к хвосту, оба Р элемента (Р2 и РЗ), равно как и 5'-концы rem. yellow имели гу же структуру, что и в исходной линии. Размер каждой копии составлял от 5 до 10 тпн.

Частые дупликации более коротких последовательностей. В описанных опытах дупликация выявлялась только тогда, когда дуплицировался полноразмерный ген yellow и в результате менялся фенотип. Более короткие дупликации генетически не выявлялись. Чтобы выявить истинную частоту дупликаций независимо от их размера провели опыт, где поддерживали самцов у2т'W"®1'; Д2-3 Sb/+ в течение трех генераций скрещиванием с самками C(I)RM,yf. После этого было отобрано 30 самцов, сохранивших исходный фенотип. Их снова скрещивали с самками C(I)RM,yf, собирали самцов раздельно из потомства от каждого самца, выделяли из них ДНК и анализировали ее блот-гибридизацией по Саузерну, используя в качестве пробы НШШ-ВатШ фрагмент гена, yellow. В пяти случаях из

30 была выявлена дупликация, а в одном трипликация короткого отрезка гена yellow. В четырех из этих шести случаев дупликация произошла в точку между Р1 кРЗ. В двух других выявлялись одновременно и новый, и исходный фрагмент, т.е. дупликация, по-видимому, произошла между двумя другими Р элементами генома дрозофилы. Таким образом, несложные рассчеты показывают, чгго истинная частота дупликаций может быть примерно в пять раз выше, чем это выявляется генетически.

Дупликации в отсутствие химерного элемента. Следовало выяснить, не связано ли частое возникновение дупликаций с наличием в геноме уже пред-существующего химерного элемента. В потомстве y^'sc™"' был получен новый аллель, y?ssc*\ у которого произошла реинверсия последовательности между Р2 и Р4 и делеция Р2 и всех геномных последовательностей химерного элемента за счет рекомбинации между Р\ и Р2 (рис. 5). Таким образом, в исследуемой зоне присутствут одиночный РХ элемент перед генома/tow и спаренные голова к голове Р3 и РА элементы в локусе scute. Между последними встроилась дополнительная последовательность TCCAGTC. РЗ и Р4 не влияют на sc-фенотии, но внедрение между ними промотора гена yellow вызывает подавление образования некоторых типов щетинок. Это позволило отобрать мутации, предположительно вызванные дупликацией гена yellow между РЗ и РА.

В этой линии после активации Р элемента, были выявлены y:"*sc's мутации (частота 1,3x10"3), которые при последующем анализе с помощью блот-гибридизации по Саузерну оказались вызванными дупликациями rem yellow между РЗ и Р4 (табл. 2). При этом, полностью сохранялись как оба Р элемента, так и TCCAGTC последовательность, которая находилась у З'-конца дупликации. Таким образом, дупликации не зависят от присутствия химерного мобильного элемента.

Механизм возникновения супер-нестабильных химерных элементов. Основная задача этого раздела работы состояла в выяснении, каким образом могут возникать ранее описанные химерные элементы. Суммируя полученные результаты, можно сделать вывод, что присутствие в геноме пары Р элементов, ориентированных голова к голове, и расположенной не слишком далеко от них одиночной копии Р элемента необходимо и достаточно для того, чтобы в условиях гибридного дисгенеза с высокой частотой возникали структуры аналогичные ранее описанным химерным мобильным элементам.

Ранее было описано несколько случаев геномных дупликаций, вызванных Р элементами. Эти дупликации происходили около одиночного Р элемента и представляли собою исключительно редкие события (Tsubota S. & Huong D. 1991, Heslip T. et al, 1992). Между тем, частота дупликаций в точку на границе двух спаренных голова к голове Р элементов геномных последовательностей, прилежащих к одиночному Р элементу, составляет от 10"2 до 10"3, а при учете коротких дупликаций - еще больше, что является очень высокими величинами для событий такого рода.

Таким образом, в определенных линиях дрозофилы, где неподалеку от гена-мишени располагается пара ориентированных голова к голове Р элементов, а в другом месте той же хромосомы находится одиночный Р элемент в зоне, содержащей цис-регуляторные элементы, с большой вероятностью могут возникать супер-нестабильные мутации, описанные ранее. Они явятся результат.« дупликации, содержащей регуляторные последовательности генома в область гена-мишени, как это и происходило в случае наблюдавшихся супер-нестабильных аллелей. Иными словами, на основной вопрос, как происходит возникновение последних, был получен ответ.

Молекулярный механизм дупликаций вытекает из структуры стыков между Р элементами и дупликацией (рис. 10). Он может быть объяснен в терминах модели зависящего от синтеза ДНК отжига цепей (Nassif N. & Engels W., 1993). Предполагается, что разрыв в области концов спаренных Р элементов приводит к образованию одноцепочечных участков, включающих обращенный повтор Р элемента. Такие участки ищут гомологичные последовательности и внедряются в другие Р элементы, и с них, как с праймера, считываются прилегающие к одиночному Р элементу отрезки ДНК. Затем висящие концы соединяются по местам коротких гомологий между дупликацией и другим Р элементом и застраиваются. Второй Р элемент может при этом потерять часть своего 5'-конца.

Р2(РЗ)

Pi (Р4) л 11*.

Р2

-*---5>

-ssassssss

Р4

Р2 S- S РЗ

Ч»Т т.

-У! t ^

5" у

Р2

Л I Чи —>

Р4

Р4

ZZ

РЗ Рз Р4

5> тшятл

Р2 v И

-^OCOOOStfii X ■

Рис. 10. Вероятный механизм дупликации последовательности, расположенной рядом с одиночным Р элементом в место между двумя Р элементами, ориентированными голова к голове. Рассматривается 3 варианта: где терятся 5'-конец РЗ, (А); где происходит трипликация yellow (Б); и где существует короткая вставка между Р элементами, что ведет к сохранению обоих 5'-концов у последних (В). Объяснения - см. в тексте.

Р4

Если же оба свободных конца внедряются в геномные последовательности и считывают их, то может возникнуть тришшкация соответствующего отрезка или дупликация двух разных отрезков генома. При этом оба Р элемента сохраняют исходную структуру. Следует подчеркнуть, что все обсуждаемые структуры были обнаружены экспериментально.

Возможное эволюционное значение дупликаций, связанных с Р элементами. Присутствие упомянутых выше комбинаций в Р линиях не является редкостью. Дупликации ведут к появлению типичных химерных мобильных элементов. При этом возникают самые разнообразные генетические комбинации. Во-первых, между Р элементами могут внедряться разнообразные последовательности, соседствующие с одиночными Р элементами. Во-вторых, в условиях продолжающегося Р-М дисгенеза в супер-нестабильных аллелях происходят разнообразные изменения, связанные с обратимыми инверсиями геномной вставки, ее частичной делецией, удлиннением ее за счет конверсии, делеции Р элемента и других событий. В дальнейшем может происходить стабилизация новых конструкций за счет стабилизации линии или за счет делеции обоих Р элементов. Таким образом легко достигается чрезвычайное разнообразие регуляторных систем генов и, как результат, разнообразие фенотипов. Полезные генетические изменения могут далее закрепляться с помощью естественного отбора.

2. Гены и белки, участвующие в организации дальних взаимодействий в геноме

Во втором разделе представляемой работы мы попытались выявить новые гены и белки, которые могли бы участвовать в организации дальних взаимодействий между энхансерами и промоторами в геноме дрозофилы. Для этого мы исследовали две группы генов и их белковых продуктов, которые по косвенным данным выполняют такие функции. Первая группа - это белки ТА^н (см. Введение), входящие в состав комплекса ТИГО, которые в ряде случаев помогают реализации специфичности взаимодействия энхаясера и промотора. Вторая группа

- это белки е(у), которые способствуют дальним взаимодействиям согласно данным генетических опытов. Интересно, что в нашей работе, не вошедшей в диссертацию, было показано, что в одном случае эта две группы генов/белков перекрываются: ген е(у)1 кодирует хорошо изученный белок TAFu40, который как раз помогает некоторым энхансерам активировать промоторы.

2.1. Новые TAF белки у дрозофилы, гомологи TAFn30 человека

TFHD человека содержат около 12 белков TAFh, которые обладают высокой эволюционной консервативностью. Биохимическими методами в составе TFIID D. melanogaster выявлены только восемь белков ТАРд поэтому предполагалось, что некоторые TAFn человека (hTAFn55, hTAFn30 и hTAFnl 8) не имеют гомологов у дрозофилы В настоящей работе была сделана попытка обнаружить у дрозофилы гомологи TAFh30 человека (hTAFn30).

Семейство белков TAFu30 с эволюционно консервативным карбокси-коицевым доменом. В лаборатории Mechler В. (1999) был прокловирован локус congested-like tracheae D. melanogaster. При этом наряду с геном Со//, изученным в этой работе, были просюсвенированы и другие транскрибируемые последовательности, содержащиеся в окружающем районе. При анализе банка данных на гомологию с белком hTAFl(30 мы обнаружили, что два гена, находящиеся в данной области, имеют такую гомологию. Эти гены транскрибируются в противоположных направлениях, а их 5'-области частично перекрываются (рис. 11). Новые белки, кодируемые этими генами, гомологичны друг другу и TAFn30 как человека, так и других организмов (Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabdilis elegans и др.). Мы предположили, что оба белка дрозофилы являются членами семейства белков TAFn30 с эволюционно консервативным С-концевым доменом (рис. 12). Следует отметить, что только у D. melanogaster имеются два гомолога белка hTAFn30. У S: cerevisiae и С. elegans, геном которых секвенированы полностью, найдено по одному гомологу TAFf)30.

200 пн dtaf,l24

3" 5

Неизв. геи

1 стттАтса<кггсАтсслтстссалттсстсс<жат^^ il TTCCTCCTCCrCGGXATGCACTrCW^CTtK^TrACTGAAATTTOTTXTCrOCCTtX^ra 121 tctatatotctctatgrttatattotaatcgatgacwaccgtaagaagaatcgatafica 131 ctqgcaflcaacaatacggaataat^gataactagcatctcccatcactacctcttxact

241 а ГО1 naA1411jfATTGTACACVlTrTrCGATCGTQG6CTCCAATTTCGGAATTATTTAC

HVGSSPGIIY

301 сл«и1СА<отсахггс<ххсАлссл<л^тсаАСААТС hmsaosasshco'ssgaooog

161 GATCGGGATAGGACCA^ACCA^rriCGOTCTCAGCGACr^CXTGTCSCACCT^GAACAT drdrttissklsb?ms0leo

421 tatactccattgattccccatgcjgtcacctcgcactatctcaacatgggaggctttcag ytiLIPOAVTSHYlNSOGye

481 TCSGACGACAAGCOCMU. I'lVJGC lUATCJ^CTAGCCggCCJlGAAaTACATCTCCGAC SDOXHIVKLI SLAAQICIMSD

541 atcatcgacgatgcactgcagcactccaaggcccgcacccatatgcaaagcaccaataca г i в в а ь 0 h5karthhqttmt

Рис. 11. Обнаружение гомологов hTAFn30 у дрозофилы.

А. Карта транскриптов в клонированном районе гена Colt, содержащая dTAFn16 и dTAFu24. Черные блоки -кодирующие отрезки. Б, В. Нуклеотидная последовательность кДНК, кодирующих dTAF„16 и dTAFi]24, соответственно. Стрелки указывают положение интронов. Подчеркнуты пептиды, использованные для получения антител.

601 CCGGGAGGATCGAAGGCCAAjSGACCSCAAGTTCACCTTGACCATGGAGQATCTGCAGCCG р g g s к а кпакртьтмгвьдр

661 GCri'rUOCCGACTACGOtATPAA?grTASGAAAgTGGACTATACiCACTAGAl'AATGOCA ALADTeXSVBKVOrse »

721 ISttTTGTACTAOmrrrrCTOiTTXtoAATAATaTATCnAAMAAAA

1 ATATACACGCCAGCTGAGATAACAAATTTCTGGAAATAAACAArrAAAAAOTGGAAAACA

SI ATGGCT^CGATGGCGAGGACATCAGTGTTACACCCGCAGAATCGSTAACATCGGCCACG KA3DGSDISVTPAESVTSAT

121 GACACCGM3GA)SGAG£lATATAGAC7CACCACTAATGCAGTCCGAAC7SCATtCCGACGAG DTEEE0ID3PLM53SLH3DE iai «лссллссссУ1Сстза*аа*с<гггсстстаА^

BQPDVSEVPtTTESSiXOKL

241 ATAAAGCAGCrGGAGGACTACTCGCCCACCATACCAAACGCCCTCACCATGCACATCTTG I X^Q LSDYSPTIPDALTStHIt

AAAACCKCTCCo'i X 1 4 iC^L^""-/*" * S^V*1 S A

361 CaCAACriCATCTCGGATATTGCCAACGACGCACTGCAGCACTGCAAGACGCGCACCACG 9кр1801а»ОАЬаИСКТЯТТ

421 aacatccagcactccaficggacacagttccagcaaggacaagamsaaccccaaggacagg siQHSSOHsssnaxx в p * D R

481 GXAOTACACGCTGCOlTTjGAGGACCTGGrGCCGGCrCTrGCGGACCACGGCATCACCATG jvhaahedlvpalaohsit*

S41 CSC^ASCCGCACTAC'l'l'Ctj'rrl'AGATTrAGTrAAGGTCTAAM*r*'ri'l>AATTOGGCACaC R1CPQX?V" soi ааататлсстаотггсттсаасттстааааа О hfcaf30 dmtaf24 ЙМ&р^ ceta£30 QDDTH^IH§g»gf ovtaf30 g!s|rd|vNd| dmtaflS sIbIsdI afctaf30 sctaf2S sptaf25 162 юз ^ 122

87

64 jllll 120

ISLSpI^VpiUiKliLGli^^ 139

------TASqsS 184

-QHSSGHSSSKD 133

--------LGQT 142

--------b^QT 107

-MQTTNTPG 112 -APWKD 86 sctaf25 vffiXftKDSyEYSRlSsSVAVSNANNSQARARQLLQGQQQPGVQQISQQQH 170 spta£25 x||vfQSii5TS|xirGSSNA----------SSTTFGAQNFG&GGbSGIG 17 9 htaf30 1|Ш dmtaf24 IS cetaf30 ovtaf30 t|d|il®m2qaEmKG— dmta£16 attaf30 htaf30 RSKS|-i dmtaf24 gHpfj-f cetaf30 |р§т1-ртovta£30 K^TK-ETdmta£16 GSKS|j-ffif attaf30 sctaf25 QQNe|tTAS; sptaf25 SS|RRGpG

IT- 218 !fv- 167 JHT- 176 Ррн- 141 "IsQ- 146 ЙЫ) 121 iFYR- 206 FgR- 215

Рис. 12. Эволюционная консервативность С-концевых областей dTAFnl6 и dTAF„24.

Приведены аминокислотные последовательности С-концевых областей гомологичных TAF белков человека (МаШ), дрозофилы (dmtaf24 и dmtafl6), С elegans (cetaf30), О. volvulus (ovtaf30), A. thaliana (attaBO), S. cerevisiae (scta£25) и S. pombe (sptaf25). Выделены те позиции, где присутствует не менее трех одинаковых аминокислот. Справа - номер последней в ряду аминокислоты.

Идентифшированные белки в соответствии с их подвижностью в полиакриламидном геле, содержащем додецилсульфат, названы (ЗТАРц16 (146 аминокислотных остатков, 16,1 Ша) и сГГАРц24 (167 аминокислотных остатков, 18,4 кОа). Такое несоответствие между мол. массой и подвижностью иногда встречается у ТАР белков). На уровне аминокислотной последовательности С-концевые домены с1ТАРн16 и <5ТАРц24 имеют 75% сходства друг с другом, и 77% и 75% сходства с С-концевым доменом ЬТАРцЗО, соответственно.

Интересно, что <П"АРц16 и с!ТАРп24 менее сходны друг с другом (48% идентичности), чем с ЬТАРцЗО (54% идентичных аминокислотных остатков у «ЗТАВДб и ЫАР'нЗО; и 48% - у <ГГАРи24 и ЬТАРцЗО). Видно также, что сП'АЕ^б обладает большим сходством с ТАРцЗО, чем <1ТАР]]24. Эти различия в первичной структуре позволяют предположить, что с1ТА1-'г(16 и <1ТАРц24 вьшолняют разные функции.

ТАРц16 и аТАР„24 связаны с ТРГГО, а «1ТАГи24 - также и с <1ССШ-НАТ. Прежде всего был проведен Вестерн блот анализ ядерных и цитоплазматических экстрактов эмбрионов и суммарных белков культуры клеток Шнейдера дрозофилы. Проводили иммуноокрашивание очищенными антителами к <1ТАРИ16 и к сГГАРц24. (1ТАРц16 и вТАРц24 выявляются и в ранних эмбрионах и в культуре клеток. Интересно, что они были обнаружены как в ядерных, так и в цитоплазматических экстрактах эмбрионов (рис. 13). Локализация белков в цитоплазме подтверждена анализом нммуноокрашенных эмбрионов с использованием конфокальной микроскопии. Полученные результаты позволяют предположить, что <ГГАРц16 и <1ТАРн24 обладают функциями, связанными не только с регуляцией транскрипций в ядре. Такое разнообразие функций белков ТАР описано и для некоторых других членов этой группы.

Для того, чтобы выяснить, имеется ли структурная связь выявленных сПАРц с комплексом ТР1Ю, мы анализировали иммунопреципитаты, полученные из ядерного экстракта эмбрионов с помощью антител к <1ТАРн16, с!ТАРц24 и ТВР. Оказалось, что иммунопреципитация с антителами к ТВР истощала весь сГГАРц24 и около 50% с1ТАРц16 (рис. 13). Необходимо отметить, что основные белки сГГАРц также взаимодействовали с антителами к dTBP. Антитела к dTAFnl 6 и dTAFn24 коиммунопрецепитировали как dTBP, так и другие компоненты комплекса TFIID: dTAF;j230, dTAFnl 10, dTAFl(80 и dTAFn40. Использование в контрольной иммунопреципитации только протеин А-сефарозы, не вьивило ни dTBP, ни белков dTAFH. Полученные результаты показывают, что два новых dTAFn связаны с dTBP и с комплексом dTFIID в целом. Коиммуно-прещгаитация dTAFn 16 и dTAFn24 не означает, что они входят в состав одних и тех же комплексов TFIID. Нельзя исключить, что их кажущееся взаимодействие обусловлено димеризацией самих комплексов TFIID.

Недавно hTAFjpO был обнаружен также в составе комплексов с ацетил трансферазой гистонов GCN5 (TAFh-GCN5-HAT), не содержащих ТВР (Тога L., 1999). Поэтому мы проверили, не будет ли антисыворотка против dTAFnl6 или dTAFn24 тоже коиммунопреципитировать GCN5-HAT дрозофилы. Используя антитела против GCN5-HAT, которые перекрестно взаимодействуют с белком дрозофилы, мы показали, что антитела к dTAFn24, но не к dTAFn 16 или к dTBP, коиммунопреципитируют dGCN5 (рис. 13). Это означает, что dTAFn24 присутствует как в TFIID, так и в комплексах, содержащих GCN5-HAT дрозофилы. Таким образом, впервые показано, что клетки дрозофилы содержат комплекс TAF„-GCN5-HAT.

Поскольку с GCN5-HAT связан только dTAFn24, можно предположить, что белки dTAFul6 и dTAFn24 выполняют различные функции. По-видимому, у дрозофилы так же, как и в клетках млекопитающих, существуют различные функциональные комплексы, в состав которых входят различные белки TAFudTAFnl 6 и dTAFu24 имеют различные функции. Далее были проведены опыты по иммуноокрашиванию и гибридизации in situ на эмбрионах Drosophila melanogoster. Оказалось, что dTAFnl6 и dTAFn24 активно синтезируются (гибридизация in situ) и накапливаются (иммуноокрашивание) в эмбриогенезе, причем уровень синтеза dTAFn24 обычно выше, чем dTAFn 16. В позднем эмбриогенезе эти белки имеют частично перекрывающуюся тканевую специфичность. Последний факт позволяет предположить, что они выполняют г t г. сн

0 •<}• C\i

1 Г со а ш яэ кэцэ

U. LL

Ь- h h

6 a a ип

-a

OJ u. u. а. < < m i— i— I— i < i ess a s. IБ м

26x u. cc z b- w inr и CO

19

--: TAFn24 — «♦•— TAF||16

ЙЯоЬг г^ии ТАР»230

•—ТАЯпНО ' - ««—

--— <+— ТА^ао

ТВР

- - —. ТАРц24 —. — V. ТАЯцЧб

Рис. 13. Присутствие йТАРцК» и ¿ТАРц24 в клеточных фракциях в составе различных комплексов.

А. Вестерн блот анализ ядерных экстрактов (ЯЭ) двух типов (ТКАХ и Э^) из эмбрионов, цельного экстракта из клеток культуры Шнайдера (КЭ) и цитоплазматического эмбрионального экстракта (ЦЭ).

Б. Опыты по ко-иммунопрецшштации. Сверху приведены антитела, с помощью которых вели иммунопреципитацию. СН-супернатант, ИП-иммунопреципитат. Справа приведены белки дрозофилы, с помощью антител к которым проводили тестирование при Вестерн блот анализе полученных фракций. dTAFu 16 fTAFH24

Рис. 14. Локализация dTAFnl6 и dTAF([24 в дистальной области Х-хромосомы дрозофилы.

Проводили иммуно-окрашивание политенных хромосом личинок дрозофилы дикой линии Oregon R. Обозначены области, содержащие исследуемые белки. различные функции, и по крайней мер? некоторые клетки обходятся без dTAFnlé или без dTAFi,24.

Если транскрипционная селективность осуществляется на уровне dTAFn-содержащих мультибелковых комплексов, можно предположить, что различные члены семейства ТАРцЗО взаимодействуют с различными промоторами. Для проверки этого предположения были проведены опыты по иммуноокрашиванию политенных хромосом слюнных желез личинок дрозофилы. Оказалось, что dTAFiilô и dTAFn24 локализованы во многих участках хромосом. Однако каждый из белков связывается с уникальным набором локусов. Примером может служить их локализация в дистальном районе Х-хромосомы дикой линии Drosophila (рис. 14). Выявлены районы, с которыми взаимодействуют антитела как к dTAFnlé, так и к dTAFu24 (ЗА и ЗВ). Однако с некоторыми районами реагируют только антитела к dTAFH16 (ID, 2В и ЗС) или только антитела к dTAFH24 (1В, 1С, 2С и 2D) (рис. 14). Таким образом, белки dTAFuIô и dTAF»24 обладают пересекающимися, но не идентичными функциями, и в клетках дрозофилы присутствуют функционально различные TAFn-содержащие комплексы.

Важно отметить, что число участков локализации dTAFnlô и dTAFn24 на политенных хромосомах примерно в 10 раз меньше, чем участков локализации dTAFij40, одного из основных компонентов TFIID. По-видимому, dTAFnlô и dTAF»24 входят лишь в некую субпопуляцию комплексов TFIID.

Возможная роль dTAFnl6 и dTAFn24 в организации энхансер-промоториых взаимодействий. Полученные данные, согласно которым два гомолога дрозофилы входят в состав TFIID комплексов и одновременно имеют разную локализацию в политенных хромосомах и относительную тканевую специфичность, позволяет высказать предположение, что они могут участвовать в определении специфичности взаимодействия энхансеров и промоторов. Такая функция по-видимому характерна для белков типа TAF. На примере TAFn40 было показано, что он специфически взаимодействует in vitro с определенными белками активаторами, например, VP16. В то же время кодирующий его ген е(у)1 способен к кооперации с геном zeste в поддержании взаимодействия энхансера и промотора генов yellow и white. Выявляется и специфичность TAF«40 к определенному классу промоторов, лишенных ТАТА-боксов (данные наших работ не вошедших в диссертацию).

Исходя из этого, результаты о специфичности локализации dTAFu16 и dTAFn24 могут рассматриваться как свидетельство в пользу их роли в организации взаимодействия определенных энхансеров и промоторов.

2.2. Новый широко распространенный ядерный белок е(у)2

Как отмечалось выше, Георгиевым П. было открыто три гена, enhancers of yellow, е(у)1, е(у)2 и е(у)3, продукты которых являлись кандидатами на роль факторов, участвующих в организации дальних взаимодействий в геноме между энхансерами и промоторами. На это указывали генетические опыты с генами yellow, white, scute и cut. Интересно, что в наших опытах (раздел 1.1) мутация гена е(у)2 приводила к ослаблению энхансер-промоторного взаимодействия между ПНПЩ энхансером и промоторами AS-С. Мы выбрали для клонирования и исследования ген е(у)2. Два других гена, е(у)1 и е(у)3 также были клонированы и изучены Солдатовым А. и др. (1999,2001).

Структура гена е(у)2 н структура белка е(у)2. Для клонирования гена было использовано проведенное ранее точное генетическое картирование мутации e(y)2al, вызванной мобильным генетическим элементом Сталкером. Она была локализована в области 10С2-С4 X хромосомы, в которой располагается также ген для большой субъединицы РНК полимеразы, клон которого и был использован для начала "прогулки" по геному линии, содержащей мутацию e(y)2ul. Первый же найденный клон содержал копию Сталкера. За геномную последовательность этого клона из дикой линии получен искомый клон, содержащий три единицы транскрипции. Только для одной из них получено снижение содержания мРНК у мутантной линии (рис. 15). Предположительно она должна была соответствовать искомому гену.

Область гена была вырезана из клона и встроена в вектор CaSpeR3. Полученный кострукт P{w\e(y)2*} использован для трансформации ранних эмбрионов дрозофилы линии У трех независимых трансформантов произошла полная реверсия мутантного фенотипа к дикому, что подтвердило природу клонированного гена. Кроме геномной копии е(у)2, была клонирована и кДНК.

Далее было проведено определение нуклеотидной последовательности геномной и кДНК копий гена. Различий между ними не оказалось, т.е. ген е(у)2 не содержит нитронов и представлен одним экзоном (рис. 15). При Норзерн блот-гибридизации выявляется один полиаденилированный транскрипт размером 580 нуклеотидов.

При анализе нуклеотидной последовательности открывается одна открытая рамка считывания, которая может кодировать белок длиной в 101 аминокислоту (рис. 15). Последовательность белка е(у)2 отсутствовала в банке данных и не содержала каких-либо гомологий с другими белками. Таким образом, - это новый белок.

Белок е(у)2 - широко представленный ядерный белок. Пояи(А)+РШС была выделена из D. melanogaster на разных стадиях развития. При бяот-шбридизации е(у)2 мРНК выявляется во всех препаратах, причем содержание ее, хотя и вариирует, является высоким на всех стадиях развития (рис. 16).

Далее была изучена локализация белка е(у)2. Для этого был получен в Е. coli рекомбинантный белок е(у)2, содержащий олигогистидин на С-конце. Он был очищен на никелевой колонке и использован для получения поликлональнх антител. Последние, в свою очередь, очищали на колонке, содержащей рекомбинантный белок е(у)2, и далее использовали для Вестерн блот анализа и для иммуно-окрашивания.

При блот анализе тотального белка клеток культуры D. melanogaster выявляется одна полоса, реагирующая с антителами против е(у)2. Ее подвижность соответствует ожидаемой мол. массе белка. При фракционировании гомогената клеток на ядерную и цитоплазматическую фракции е(у)2 белок выявляется в ядерной фракции и не обнаруживается в цитоплазматической (рис. 17). Далее ядра клеток последовательно экстрагировали растворами NaCl повышающейся концентрации и анализировали экстракты на присутствие белка е(у)2. Оказалось, что максимальное количество белка е(у)2 экстрагируется 0,35 М МаС1, т.е. е(у)2 довольно прочно связан с ядерными структурами, вероятно с хроматином.

Следующая серия опытов была посвящена цитологическому выявлению е(у)2 с помощью иммуноокрашивания гистологических срезов или давленых препаратов политенных хромосом (рис. 17). На срезах через тело взрослой дрозофилы видно, что антителами к е(у)2 окрашиваются все адра, тогда как цитоплазма клеток не окрашивается. То же самое видно у 60-минугного эмбриона дрозофилы.

Наконец, при исследовании политенных хромосом слюнных желез личинок дрозофилы белок е(у)2 открывается в составе хромосом. Он виден по крайней мере примерно в 200 дисках политенных хромосом. Следовательно, е(у)2 белок действительно связан с хромосомами (хроматином), причем со многими его областями. Интересно отметать, что во всех областях политенных хромосом, где находятся гены, в транскрипции которых е(у)2 согласно предыдущим данным принимает участие (1 А, ЗА и 7В), он обнаруживается при нммуно-окрашивании (рис. 17).

На основании опытов по блот анализу ядерных экстрактов клеток культуры были проведены приблизительные рассчеты количественного содержания е(у)2. Оказалось, что на одно ядро приходится примерно 1,2хЮ4 молекул е(у)2, т.е. одна молекула примерно на 50 нуклеосом. Можно сделать вывод, что белок е(у)2 является богато представленным обязательным ядерным белком, входящим в состав хроматина.

Белок е(у)2 эволюционно консервативен. При проведении блот гибридизации по Саузерну с пробой гена е(у)2 в ДНК дрозофилы выявляется только одна полоса, т.е. ген представлен лишь одной копией. При анализе геномной ДНК млекопитающих, человека и мыши, выявляются слабые гибридизационные полосы, указывающие на существование гомологичного гена. Более того, при Вестерн блот анализе в ядерных экстрактах кеток НеЬа человека выявляется полоса, имеющая ту же подвижность, что и белок е(у)2 дрозофилы,

З'-ДКП

1 тпн м с5

5 л

V о

Ъ Ъ х —» в

1 ■ I

2.2 тпн 1.9 тпн В atttggtaatatattttcatttctttaaagttgattaatgtcegtatctaaaaactagct acaaagtagccagactgtttgecatgaccactgtaccaacatcacaacacaacaaaacaa aaacacagctcaaaaagatagatgcagcgaagaaaagcaaaaaaacagacgctgcgaaat cgacaaggactcgaaaaaggaaacttggtaatttgcaagacttagatacgcgacacaagg

М8ТЗСАУ£1дТТУХ,ТСПКЗКХ 20

АТ6АСС:аСТТС€СССССАСТТСАТСАСТАСАС0СТССТААССССССАССБХТССАА6АТС 60

К Ь Ь Ь СЗКЬТЕСввИОЕУНЬМ 40

ААССАТТТССТСТССАССС2ССТТАСССААТСТСССТССССС6АССАееГ6С6ТСТеДТ6 120

СЯН11.МЕКеТНЫЗРТУЕС1.1 60

ТСССССААСАТССТСАТебАбААССССАССААСААСАССТТСАСССТАбАССАбСТбАТС 180

АЕУТРКАКТ1.УРРАУККЕ1.1. 80

ССССАаСТААСАСССААСССАСбСАСССТССТСССССАТССССТСАААААСОАОСТбСТТ 270

М К X И Т I Ь Т Е I Е Е Е Р О Е Р Е О Е 100 АТОААСАТАСССАССАТТСТСАСССАААТТСАССАббААСССЕАТСАСССАСАСбАССАА 300 э - -01

TCCTAActttaactcagcgtcattggatttgtatattaataaagtttatttgtacgattt

Рис. 15. Клонирование гена е(у)2.

A. Область инсерции мобильного элемента Сталкера, отвечающего за мутацию е(у)2°'. Стрелками обозначены 3 транскрипта Чсрга пол ними - отрезок ДНК. использованный для трансформации мутантных дрозофил и спасения дикого фенотипа. Сайты рестрикции: Х-ХЬа\, Ъ-ВатН1. П

Б. Норзерн блот гибридизация с пробами из трех транскриптов на РНК самцов дикого типа и мутантов.

B. Отрезок геномной последовательности дрозофилы, содержащей ген е(у)2 (выделен заглавными буквами). Аминокислотная последовательность белка е(у)2 дана жирными буквами. Подчеркнут сигнал полиаденилирования. е(у)2 гт2

1.4 1.0 0.8 0.8 0.9 О.б 0.7 0.4 0.3 0.5

Рис. 16. е(у)2 мРНК присутствует на всех стадиях развития дрозофилы.

Норзерн блот гибридизация с пробой е(у)2 мРНК из взрослых самок (§), самцов {с поздней (Р|), средней (Рт), и ранней куколки (Ре), поздней (1Д) и ранней (ЬЗе) третьей стадии личинки, второй (Ь2) и первой стадии личинки (1Л) и эмбрионов дрозофилы (Е). Цифры внизу - отнощение интенсивности сигнала с пробой е(у)2 сигналу с пробой к гся2.

Ш Я Ц Р

13кБ фо I

Пр акГЧ. Ч, ч л * ' Ъ

Рис. 17. Белок е(у)2 - ядерный белок, локализованный в хроматине.

A. Вестерн бдот анализ экстракта из культуры клеток Шнайдера (Ш), ядерной фракции (Я) и цитоплазматической фракции (Ц) на присутствие белка е(у)2. Рекомбинантный е(у)2 - (Р).

Б. Иммуноокрашивание антителами к е(у)2 среза через абдоминальную область дрозофилы. Обозначения: фол-фолликулярный эпителий, тр-трофоциты, жт-клетки жирового тела.

B. Иммуноокрашивание антителами к е(у)2 препарата политенных хромосом слюнных желез личинок дрозофилы. активно связывающая антитела к белку е(у)2 дрозофилы (см. рис. 18). Таким образом, можно было ожидать присутствие сходного белка в ядрах млекопитающих.

Прежде чем клонировать ген мыши мы проверили EST банк. Оказалось, что он содержит гомологичные последовательности, принадлежащие самьш разным видам, от человека до растений (риса) и простейших (рис. 18). Интересно, что EST бьшя лолуены из разных тканей человека: кости, мозга, сердца, почек и других. Аналогично EST мыши получены из неоплодотворенных яйцеклеток, эмбрионов, почек, печени, мышц и других. Таким образом, экспрессия гена, как и у дрозофилы, происходит практически повсеместно. Интересно, что ген человека содержит ряд интронов, а его 5'-область обогащена CpG последовательностями, что характерно для экспрессируемых во всех тканях генов "домашнего хозяйства" (рис. 18). Нет гомолога е(у)2 у дрожжей.

Нуклеотидные последовательности EST банка обычно содержат ошибки. Мы сконструировали полные последовательности для е(у)2 гомолога человека, крысы и мыши. Для ее проверки был получен с помощью ПЦР клонирования и просиквенирован ген мыши. Оказалось, что открытая рамка считывания гена мыши и человека различается лишь 6 нуклеотидными заменами, тогда как белок мыши и человека не имеет ни одной замены, а по длине они не отличаются от е(у)2 дрозофилы (рис. 18). Белок рыбы D. rerium тоже очень похож на белок человека. Человеческий и дрозофилийый гомологи содержат 43% идентичных и 21% ' похожих аминокислот, которые разбросаны но равным районам.

2.3. Ядерный белок е(у)2 Drosophila melanogaster участвует в контроле транскрипции

Природа мутации е(у)Т' Единственная пока полученная мутация гена, е(у)Т', вызвана инсерцией Сталкера за 167 пн перед стартом транскрипции. Направление транскрипции Сталкера и гена е(у)2 совпадают. Такая инсерция Сталкера не влияет на размеры транскрипта. Однако уровень транскрипции снижается, что приводит к снижению концентрации е(у)2 мРНК в три-четыре раза.

Усредненная послед. КЕАгмаадхяокьгатеткЕВхвххмкьшсет^Еыанся!^

Рис. 18. Широкое распространение и эволюционная консервативность е(у)2.

A. Аминокислотная последовательность белка е(у)2 и его гомологов из разных видов: человека и мыши (Но), Xenopus laevis (Хе), рыбы Danio rerio(Zh\ Halocynthia roretzi (Ha), Strongylocentrotus purpuratus (St), Zea mays (Ze), Glycine max (Gl), - Schistosoma mansoni (Sc), дрозофилы (Dr), Dictyostelium discoideum (Di) и Brugia malayi (Br). Обозначены идентичные и сходные аминокислоты.

Б. Кросс-реакция антител к е(у)2 дрозофилы с гомологом человека. HeLa-белковый экстракт из клеток HeLa, Sch-из клеток Шнайдера, R-рекомбинантный е(у)2. сс-е(у)2-осаждение антителами к е(у)2, PI - пре-имунной сывороткой.

B. Геномная структура гомолога человека, полученная из последовательности хромосомы 8. Цифрами обозначены экзоны, вертикальными черточками-CpG. Видны CpG-островки.

Таким образом, мутация е(у)2"' не меняет структуру белка е(у)2 и представляет собою относительно слабую гипоморфную мутацию.

Тем не менее, она влияет на мофологаю мух: укороченное тело, маленькие глаза, измененные крылья. Кроме того, сильно подавляется транскрипция ряда генов, при условии, что она перед этим была слегка нарушена за счет встраивания мобильного элемента (в случае генов yellow и scute), частичной делеции энхансера (ген cut) или ингибирования другого регуляторного элемента (ген white). Учитывая такие последствия простого снижения концентрации белка е(у)2, а также связь выявленного белка с хроматином, можно было предположить giro участие в регуляции транскрипции. Для проверки этого предположения проводились следующие эксперименты.

Белок е(у)2 присутствует в транскрипционном экстракте в виде высоко-молекулярного комплекса. Прежде всего проводились опыты по выявлению белка е(у)2 в эмбриональных экстрактах D. melanogaster, используемых для сборки хроматина и для транскрипции (Becker Р. и др., 1997). Первый представляет собою фактически цитоплазматические белки ранних эмбрионов, когда число ядер очень незначительно. Вестерн блот анализ показал, что такой экстракт (DREX) не содержит белка е(у)2. Второй (TRAX) представляет собою ядерный экстракт более поздних эмбрионов, и он обеспечивает транскрипцию in vitro. Мы обнаружили, что TRAX содержит в своем составе белок е(у)2 (рис. 19).

Было проведено фракционирование TRAX путем гель фильтрации через Superose-6. Вестерн блот анализ фракций показал (рис. 20), что основная часть белка е(у)2 присутствует в составе одного дискретного пика с подвижностью, соответствующей мол. массе 700 kD, что намного превышает мол. массу свободного е(у)2. Следовательно, белок е(у)2 входит в состав мультимерного белкового комплекса (рис. 19).

Белок е(у)2 связывается с хроматином, но не со свободной ДНК. Следующий вопрос состоял в том, связывается ли белок е(у)2 со свободной ДНК или с хроматином. Для анализа использовывали 7,75 тпн плазмиду, содержащую hsp26 миниген, иммобилизованную на парамагнитных частицах. Хроматин цэ яэ

670К, 440Й

151617 18 19 20 21 22 23 24 25 26 27 28 29 30 3132 33 34 35 36 * . .<^1,110 ц ^ Л сГГВР сГГАР|[40

--- ~ е(у)2 В

Рис. 19. Характеристика белка е(у)2 в ядерном экстракте эмбрионов дрозофилы.

А. Вестерн блот анализ цитоплазматического (Ц)

С5 и ядерного (Я) экстрактов из эмбрионов

К дрозофилы с антителами к е(у)2.

С. е. Г) 2 Б. Фракционирование эмбрионального ядерного 4? + экстракта ТЯАХ гель-фильтрацией на Суперозе 6.

ЬС 1С Ш 1С Сверху даны номера фракций. В каждой фракции проводили определение содержания белков сГГАРп230, сП'АРп! 10, с1ТВР, (1ТАРц40 и е(у)2 с Щн» помощью соответствующих антител. Положение маркеров молекулярной массы указано стрелками. В. Взаимодействие ДНК (7,75 тпн миниген И$р26), закрепленной на парамагнитных частицах, с белком е(у)2. Иммобилизованную ДНК (1,5 мкг) использовали как свободную ДНК или хроматин (после инкубации с цитоплазматическим экстрактом из 0-90 мин. экстрактов ОЯЕХ). После этого частицы инкубировали с ядерным экстрактом 'ШАХ и определяли связавшийся е(у)2. Б+Хр+ЯЭ - инкубация хроматина с ядерным экстрактом, Б+Хр - то же без инкубации, Б+ЯЭ - инкубация чистых частиц с ядерным экстрактом, Б+ДНК+ЯЭ -инкубация бус со свободной ДНК с ядерным экстрактом. собирали с помощью инкубации в DREX и очищали промыванием частиц, отделяя их от раствора в магнитном поле.

Далее частицы со свободной ДНК и с хроматином инкубировали в экстракте TRAX, который, как показано выше, содержит белок е(у)2. После промывки бус 0,1 М KCl определяли связывание е(у)2 с помощью Вестерн блот анализа. Оказалось, что е(у)2 эффективно связывается с хроматином, но не со свободной ДНК. В случае хроматина выявляется четкая полоса е(у)2. В случае свободной ДНК видна слабо выраженная полося е(у)2, но полоса с точно такой же интенсивностью выявляется и при инкубации с TRAX магнитных бус, вообще не содержащих ДНК (рис. 19).

Белок е(у)2 активирует транскрипцию на хроматиновой матрице в бесклеточной системе из клеток человека. Попытка выявить влияние добавления экзогенного е(у)2 на транскрипцию с использованием TRAX не дали положительных результатов. Это, однако, могло быть связано с Тем, что TRAX уже содержит достаточное для полной активности количество е(у)2. Поэтому следующие опыты велись на бесклеточной системе транскрипции из клеток HeLa.

Хромата новую матрицу собирали на суперспирализованной (17M)5ß2G ДНК, содержащей пять сайтов связывания GAL4 перед ß2 промотором RAR мыши. Эта регуляторная последовательность соединена с ß-глобиновым геном курицы. В параллельных опытах использовывали как матрицу ту же свободную ДНК. В качестве внутреннего контроля служила ДНК pGl, содержащая последовательность ß-глобинового гена.

Активная транскрипция происходит только в присутствии активатора GAL4-VP16. Если он не добавлен, то белок е(у)2 никак не влияет на . транскрипцию. Однако в присутствии активатора добавление рекомбинантного е(у)2 вызывает умеренную, но достоверную, четырех-, пяти-кратную стимуляцию транскрипции на матрице хроматина. Интересно, что на матрице свободной ДНК активации транскрипции не происходит (рис. 20).

Далее мы проверили, не является ли эффект е(у)2 результатом нарушения под его влиянием структуры хроматина. Проводили переваривание микрококковой

МАТРИЦА ХРОМАТИНА МАТРИЦА ДНК

GAL-VP1S — е{у)2

62G -*• (179 н) pG1 -*■ **

60 н)

- + + + + + - +

ЧРЯвЦг ЩЩЩШ

5 10 20 5 10 20 : + Г

Рис. 20. Активация транскрипция на матрице хроматина белком е(у)2.

А. Транскрипцию вели на матрице (17M)5(i2G (P2G) в составе хроматина или свободной ДНК в бесклеточном экстракте из клеток HeLa. В качестве контроля использовали ДНК pGl, не содержащую сайта связывания GAL-4-VP16.

Добавлялся примерно 2-х или 10-ти кратный избыток е(у)2 (по отношению к эндогенному белку). Для анализа транскрипта использован метод обработки S1 нуклеазой после депротеинизации в составе гибрида с тест-фрагментом ДНК. Б. Сохранение нормальной структуры хроматина при добавлении 10-ти кратного избытка белка е(у)2. Хроматин обрабатывали микрококковой нуклеазой в отсутствие и в присутствии е(у)2. Затем проводили SDS PAGE и гибридизацию с областью проксимального (J2G промотора. Видно, что нуклеосомный повтор не меняется.

Табл. 3. Взаимодействие мутаций в генах е(у)1 и е(у)2

Генотип Выживаемость е(у)1ш 100% е(у)2 92%

У2: е&)2"' е(У)1"' 0%

У; е(у)2и1 е(у)1и'; Р{е(у)1+}-\-5/+ 22-83%

У; е(у)2и1е(у)Г'; Р{Ае(У)1}-\-1/+ 0%

У; е№"е(у)Г'; Р{Ае<у)1}-2/Р{Ае(у)1}-2 0% нуклеазой хроматина матрицы (17М)5р2G. Как структура тотального хроматина, выявляемая с помощью окрашивания этидиум бромидом, так и длина нуклеосомного повтора в области проксимального промотора (от -40 to +5 пн) (рис. 20) не изменялись в присутствии е(у)2. Существенно тахже, что е(у)2 не влиял на транскрипцию в отсутствие активатора или на хроматине, лишенном сайта связывания GAL4.

Таким образом, добавление в транскрипционную систему белка е(у)2 вызывает умеренный рост транскрипции. Отсутствие более выраженного эффекта может зависеть от присутствия в экстракте эндогенного е(у)2 человека. Полученный результат согласуется с предположением, что е(у)2 является одним из факторов контроля транскрипции.

Генетические данные о взаимодействии белков е(у)2 и TAFii40. Чтобы получить дополнительную информацию о возможной роли белка е(у)2 в транскрипции, были проведены генетические опыты по взаимодействию его с известным транскрипционным фактором TAFu40, кодируемым геном е(у)1. Комбинация Мутации е(у)2и1 с мутацией е(у)1"' в гене е(у)1 является летальной. Как и е(у)2"\ мутация е(у)1и1 является сравнительно слабой: она ведет к сйижению транскрипции гена и замене поседних 25 аминокислот TAFn40 на 18 аминокислот, кодируемых последовательностью Сталкера. Мутантный фенотип, вызванный е(у)1"', может быть возвращен к дикому типу трансформацией с помощью конструкции P{w~,e(y)lr), экспрессирующей нормальный TAF(|40, и конструкции P{w+,Ae(y)]}, которая осуществляет синтез TAFi[40 с измененным С-концом. Следовательно, нормальный отрицательно заряженный С-конец белка не нужен для его функционирования, по крайней мере, в большинстве случаев. К тому же выводу пришли авторы, изучавшие функционирование TAFh40 in vitro.

Мы исследовали вопрос, участвует ли С-конец TAFh40 в функциональном взаимодействий с белком е(у)2. Для этого получали линии, где комбинацию мутаций е(у)1"!е(у)2а! совмещали с одной или двумя дозами выше указанных конструкций, продуцирующих нормальный или мутантный ТАРц40 (табл. 3). Оказалось, что конструкция P{w+,e(y)l+} восстанавливает жизнеспосбность мух.

С другой стороны, даже две дозы конструкции P{w*, Ае(у)1} не оказывают на нее никакого эффекта - все мухи погибают на эмбриональной стадии развития.

Таким образом, на фоне низкой концентрации белка е(у)2 мутантный TAF¡[40, лишенный нормального С-конца, не способен выполнять свои функции в поддержании транскрипции. Это наблюдение является сильным свидетельством в пользу функционального взаимодействия бедков е(у)2 и е(у)1/ТАБц40 в организации транскрипции и одновременно первым указанием на функциональную значимость С-конца TAFn40, полученным к тому же на системе in vivo.

Биохимические данные о взаимодействии е{у)2 и TAFn40. Для прямой проверки положения о взаимодействии е(у)2 и TAFn40, не только функциональном, но и структурном, ставили следующие эксперименты. Проводили ко-иммуно-преципитацию белков ядерного экстракта из эмбрионов дрозофилы с помощью антител к е(у)2 или к различным субъединицам комплексов, содержащих TAFh. TFIID и другие комплексы, содержащие TAFu, осаждали с помощью антител к dTBP или к dTAF|j24, одного из двух, обнаруженных в настоящей работе гомологов hTAFn30. Прецшштировавшие белки исследовали с помощью Western блот анализа.

Антитела к е(у)2 ко-иммунопреципитируют TAFu40 и ряд других TAFu белков, как например, TAFn230,TAFi,l10 и TAFn24, а также ТВР (TATA-binding protein), основной сборочный компонент TFIID (рис. 21). В то же время, антитела к ТВР или TAFU24 ко-преципитируют е(у)2. В контроле, при использовании пре-иммунной сыворотки или при использовании антител к GCN5, который связывается с TAFn24, но не с ТВР, получены негативные результаты, т.е. ко-иммунопреципитация была специфичной. Следовательно, белок е(у)2 размером 13 kDa взаимодействует с комплексами, содержащими ТВР или различные TAFu белки. Существенно, что иммуно-преципитация антителами к е(у)2 удаляет из экстракта более 90% е(у)2 и только слегка снижает содержание в нем ТВР и различных TAFu белков (рис. 22). С другой стороны, количество е(у)2, которое соосаждается с ТВР и TAFn24 тоже значительно ниже стехиометрического.

Следовательно, лишь относительно небольшая фракция е(у)2 может входить в состав комплекса TFIID.

Далее мы сравнили распределение е(у)2 с распределением различных компонентов TFIID комплекса при фракционировании гель-фильтрацией на Суперозе-6 (см. рис. 19). Каждая из фракций окрашивалась с помощью антител к разным белкам. Видно, что содержащий е(у)2 комплекс по подвижности отличается от комплексов, содержащих компоненты TFIID (ТВР, TAFnl 10, TAFn230) (фракции 16-24). Дискретный пик е(у)2 лишь слегка перекрывается с последними.

Более значительно перекрывание пика е(у)2 и ТАРц40. Чтобы.проверить специфичность образования комплекса е(у)2 и TAFji40, мы провели иммуно-преципитацию материала фракции 24 хпоата, содержащей максимальное количество е(у)2 и фракции 20, почти не содержащей е(у)2. Антитела к е(у)2 не осаждают ни е(у)2, ни TAFn40 из фракции 20, что подтверждает отсутствие неспецифической преципитации. С другой стороны, антитела к е(у)2 осаждают почти весь е(у)2 и около половины "ГЛРц40 из фракции 24. Также антитела к TAFn40 осаждают почти весь ТАРц40 и значительное количество е(у)2 в этой фракции. Таким образом, фракция 24 обогащена взаимодействующими между собой е(у)2 и TAF|[40. Это взаимодействие является довольно сильным: TAF«40 вьмвляется в е(у)2-иммунопреципитате из ядерного экстракта даже после промывания буффером, содержащим 1 М NaCl (рис. 21). Тестирование е(у)2-иммуно-преципитата из фракции 24 антителами к ТВР, TAFU110 and ТАРц230 дало отрицательный результат.

О возможной биологической роли белка е(у)2. Как уже отмечалось белок е(у)2 играет важную роль в транскрипции целого ряда генов. Простое снижение его концентрации делает транскрипцию целого ряда генов чувствительной ко многим другим генетическим изменениям, не говоря уже о происходящих при этом морфологических изменениях мух. Предыдущие опыты позволили предположить участие е(у)2 в организация энхансер-промоторных взаимодействий. Этот белок сн

1-5Гсм

0. «г ! ПОЙ ■ ип

•<*■ л м ч в а & ® « 1

Р?

ОТАЯ^ЗО сГГА^ИО сПАЕ.40

-е(у)2

-е(у)2

1«СН сла^О

-в. лф*»>- „—е(у)2

Рис. 21. Физическое взаимодействие е(у)2 с ТАРц40 и другими транскрипционными факторами.

A. Ко-иммунопреципитация белков эмбрионального ядерного экстракта дрозофилы. Сверху обозначены антитела, которые использовали для иммунопреципитации. Справа обозначены антитела, которые использовали для анализа тотального экстракта (ТЭ), супернатанта после иммунопреципитации (СН) и иммунопреципитата (ИП).

Б. Ко-иммунопреципитация белков, взятых из фракций 20 и 24, полученных при гель-филирации на Суперозе (рис. 19). Фракция 24 -пик распределения е(у)2, а фракция 20 содержит незначительное количество последнего.

B. Устойчивость комплекса е(у)2-ТАРц40 к обработке 1 М ЫаС1. Контроль - преципитация преимунной сывороткой. присутствует в больших количествах в ядрах всех клеток разных организмов и связан с хроматином.

Генетические данные указывали на функциональную связь между генами е(у)2 и е(у)ШАРц40. Последний, согласно ряду данных помогает специфическому взаимодействию некоторых энхансеров, с промоторами. Наши опыты показали, что летальность, вызванная комбинацией мутаций е(у)2и1 и е(у)1"', не подавляется даже при высоком уровне синтеза ТАРц40, лишенного С-конца, тогда как все другие последствия мутации of е(у)1"1 при этом устраняется. Можно предположить наличие общих функций у С-конца ТАР[[40 и белка е(у)2, например, они могут способствовать доступности хроматина транскрипционным факторам. Биохимические данные показывают на существование отличного от ТИГО мультимерного белкового комплекса, содержащего как е(у)2, так и ТАРц40. Возможно, именно он участвует в организации энхансер-промоторных контактов. Известно, что ТАРц40 входит не только в состав ТПЮ, но и других комплексов, например, содержащих гистон ацетил-трансферазу. Вопрос, входит ли е(у)2 в состав последнего или в состав еще неизвестного комплекса, пока остается открытым.

Тем не менее, нельзя исключить и присутствие е(у)2 в составе ТР1ГО. Действительно, небольшая часть е(у)2 соосаждается с частью ТВР, ТАРц230 и ТАР„110, т.е. компонентами ТИГО. Некоторое расхождение между результатами иммунопреципитации из экстрактов и гель-фильтрации может зависеть от того, что связь е(у)2 с комплексам, содержащими ТВР слабая, и в ходе гель-фильтрации идет постепенная диссоциация е(у)2. Действительно, следовые количества е(у)2 можно обнаружить во всех фракциях после переэкспозиции. Такая возможная слабая связь е(у)2 с ТР1ГО может объяснить, почему е(у)2 не был замечен ранее и почему добавление рекомбинантного е(у)2 усиливает в несколько раз транскрипцию экстрактов, содержащих эндогенный е(у)2.

То, что е(у)2 активирует транскрипцию только на хроматине, но не на свободной ДНК, тоже указывает на его возможную роль в облегчении доступа к цис-регуляторным элементам, включенным в нуклеосомы. При этом активируется только транскрипция, активируемая энхансером, что подтверждает роль е(у)2 именно во взаимодействии промотора с энхансером.

Из приведенных данных следует, что механизм участия белков е(у)2 и описанных выше с!ТАРн16 и сГГАР([24 в организации дальних взаимодействий различается. Это не препятствует их кооперации. Например, можно предположить, что ТАР белки способствуют связыванию белков, сидящих на энхансере и промоторе, а е(у)2 делает возможным их взаимодействие. выводы

1. Для узнавания большинства энхансеров комплекса achqete-scute {AS-C) их промоторами основное значение имеет специфичность взаимодействия, а не положение дру i относительно друга: при переносе энхансеров в локус>'е//он>при транспозициях или инверсиях не происходит нарушения активации транскрипции. Лишь для небольшого числа энхансеров имеет значение близость « промотору.

2. Показано, что su(Hw) инсулятор при определенных геномных перестройках может подавлять активность энхансеров, не отделенных инсулятором от промоторов и расположенных на расстоянии в несколько десятков тысяч пар оснований от инсулятора. Этот факт меняет представления об инсуляторе как физической границе между элементами транскрипции.

3. Установлены условия, при которых В геноме Дрозофилы могут возникать химерные мобильные элементы, индуцирующие супер-1 нестабильные мутации. Для этого необходимо присутствие пары Р элементов, ориентированных голова к голове, и одиночного Р элемента. Прилегающие к 5'-концу последнего геномные последовательности дунлицируются й внедряются между спаренными Р элементами, вероятно, с помощью зависящего от синтеза ДНК отжига цепей.

4. Выявлены, проклонированы и изучены два дрозофилиных гомолога белка ТАУцЗО человека, dTAFnJ6 и dTAFu24. Два гомолога, хотя и входят оба в состав TFIID, но связываются с разными генами, вероятно, влияя на энхансер-промоторное взаимодействие. Кроме того, только dTAFn24 входит в комплекс с гистои-ацетилазой.

5. Проклонирован и изучен ген е(у)2, участвующий в энхаисер-нромоторном взаимодействии. Он кодирует ядерный белок размером в 101 аминокислоту, обладающий высокой эволюционной консервативностью. Белок е(у)2 связывается с хроматином И активирует транскрипцию на матрице хроматина. Показано функциональное и структурное взаимодействие е(у)2 с TAFn40, продуктом гена е(у)1, также участвующим в энхансер-промоторном взаимодействии.

Таким образом, в настоящей работе выявлена роль специфичности энхансеров и промоторов для их взаимодействия, описано новое явление дальних неканонических взаимодействий между инсулятором и энхансерами, проклонироваио три гена, участвующих в организации энхансер-промоторных взаимодействий, и изучены свойства и некоторые функции их белковых продуктов. Дополнительным итогом является выяснение механизма образование химерных мобильных элементов.

Список работ, опубликованных по теме диссертации

Статьи в международных журналах:

1. Georgieva S, Nabirochkina Е, Dilworth FJ, EickhofFH, Becker P, Tora L, Georgiev P, Soldatov A. The novel transcription factor e(y)2 interacts with ТАРц40 and potentiates transcription activation on chromatin templates. Mol. Cell. Biol. 2001,15:5223-5231.

2. Georgieva S, Kirshner DB, Jagla T, Nabirochkina E, Hanke S, Schenkel H, de Lorenzo C, Sinha P, Jagla K, Mechler B, Tora L. Two novel Drosophila TAFns have homology with human ТАРц30 and are differentially regulated during development Mol. Cell. Biol. 2000, 20:1639-1648.

3. Soldatov A, Nabirochkina E, Georgieva S, Belenkaja T, Georgiev P. TAFu40 protein is encoded by the e(y)l gene: biological consequences of mutations. Mol. Cell. Biol. 1999,19:3769-3778.

4. Golovnin A, Gause M, Georgieva S, Gxacheva E, Georgiev P. Su(Hw) insulator can disrupt enhancer-promoter interactions when located more than 20 kilobases away from the Drosophila achaete-scute complex. Mol. Cell. Biol. 1999,19:3443-3456:

5. Gause M, Georgieva S, Georgiev P. Phenotypic reversion of the gypsy-induced mutation scDI of Drosophila melanogaster by implicative transposition of a sc enhancer to the yellow gene and by mutations in the enhancer of yellow and zeste loci. Mol. Gen-Genet. 1996,253:370-376.

Статьи в российских журналах:

6. Георгиева СГ, Набирочкина ЕН, Пустовойтов MB, Краснов АН, Солдатов АВ. Молекулярная характеристика нового эволюционно консервативного белка е(у)2. Генетика, 2001, 37:18-23.

7. Георгиева СГ, Набирочкина ЕН, Ладыгина НГ, Краснов АН, Солдатов АВ. Ядерный белок е(у)2 Drosophila melanogaster участвует в контроле транскрипции. Генетика. 2001, 37:24-28.

8. Головнин АК, Георгиева СГ, Георгиев ПГ. Механизм возникновения химерных мобильных элементов, вызывающих супернестабильные мутации у Drosophila melanogaster. Докл. АН, 2000, 370:420-424.

9. Георгиева СГ, Набирочкина ЕН, Георгиев ПГ, Солдатов АВ. Ген enhancer of yellow J (e(y)l) Drosophila melanogaster кодирует белок TAFjj40. Докл. АН 2000, 375:401-403.

10. Георгиева СГ, Набирочкина ЕН, Георгиев ПГ, СолдатовАВ. Новый широко распространенный ядерный белок, участвующий в регуляции транскрипции, осуществляемой РНК полимеразой П. Докл. АН 2000,375:540-543.

11. Набирочкина ЕН, Солдатов АВ, Георгиева СГ, Два гомолога человеческого TAFn30 у Drosophila melanogaster имеют различающиеся функции. Докл. АН. 2000, 375:690-692.

12. Набирочкина ЕН, Соддатов АВ, Георгиева СГ. Молекулярная характеристика двух новых гомологов TAFu30 человека у Drosophila melanogaster. Мол, биол., 2000,34:783-787.

13. Георгиева СГ, Набирочкина ЕН, Георгиев ПГ, Шварц ЮБ, Солдатов АВ. Исследование гена e(y)l/TAFn40 у Drosophila melanogaster in vivo. Мол, биол., 2000, 34:788-794.

14. Бирюкова ИВ, Беленькая ПО, Солдатов АВ, Набирочкина ЕН, Георгиева СГ, Георгиев ПГ. Новый механизм мутагенеза, индуцированными мобильными элементами: образование химерных белков-ингибиторов транскрипции. Докл. АН, 1999,366:273-276.

15. Головнин АК, Георгиева СГ, Гаузе МГ, Георгиев ПГ. В определенных условиях инсулятор может подавлять активность неизолированных энхансеров. Докл. АН. 1999,366:420-424.

16. Гаузе МГ, Георгиева СГ. Энхансер гена scute может активировать промотор, находясь в другом локусе. Докл. АН. 1998, 358:119-121.

17. Георгиева СГ, Гаузе МГ. Белковые продукты генов zeste, е(у)1 и е(у)3 могут влиять на процесс инсуляции. Докл. АН. 1998,358:260-262.

18. Georgieva S, Nabirochkina Е, ЯЩШрг A. The епЩ^кг.ч of yellow, е(у)1, е(у)2 and е(у)3. Role of newly described functionally related genes in transcription control. Symp. "Current Problems of Molecular Genetics and Cell Biology". Moscow, 2000:28.

19. Georgieva S, Becker P, Tora L, Georgiev P, Soldatov A. The nature of e(y)l and e(y)2 genes involved in the control of long-range interactions between enhancers and promoters. Symp. "Gene Therapy and Molecular Biology". Heraklion, Crete, 1999:138139

20. Georgieva S, Solodatov A, Nabirochkina E, Georgiev P. Studies on the role of e(y) genes in transcription control. Cold Spring Harbor Symp. Quant. Biol. "Mechanism of transcription". Cold Spring Harbor, 1998:55.

21. Georgiev P, Soldatov A, Belenkaya T, Nabirochkina E, Biryukova I, Georgieva S. P element insertion at the polyhomeotic gene leads to formation of a novel chimeric protein, that negatively regulates thс yellow expression in the P element induced у alleles of Drosophila jnelanogaster. 39й1 Annual Drosophila Conference. Washington, 1998:778C.

• •


Автореферат
200 руб.
Диссертация
500 руб.
Артикул: 135769