Биогибридная система на основе Lactobacillus acidophilus и наночастиц диоксида титана с ранозаживляющими и антибактериальными свойствами тема диссертации и автореферата по ВАК РФ 00.00.00, кандидат наук Локтева Алина Владимировна

  • Локтева Алина Владимировна
  • кандидат науккандидат наук
  • 2025, «Национальный исследовательский университет ИТМО»
  • Специальность ВАК РФ00.00.00
  • Количество страниц 198
Локтева Алина Владимировна. Биогибридная система на основе Lactobacillus acidophilus и наночастиц диоксида титана с ранозаживляющими и антибактериальными свойствами: дис. кандидат наук: 00.00.00 - Другие cпециальности. «Национальный исследовательский университет ИТМО». 2025. 198 с.

Оглавление диссертации кандидат наук Локтева Алина Владимировна

РЕФЕРАТ

SYNOPSIS

ВВЕДЕНИЕ

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Биогибридные системы и материалы

1.2. Перспективы применения Lactobacillus sp. в антибактериальных и ранозаживляющих подходах

1.3. Применение окислительного стресса как стимулирующего фактора для

создания БГС с Lactobacillus sp

1.4. Микро- и наночастицы в контексте взаимодействия с бактериями 75 ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Синтетические процедуры

2.2. Методы характеризации полученных образцов

2.3. In vitro исследования

2.4. In vivo методы исследования

2.5. Обработка данных

ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

3.1. Установления механизмов влияния окислительного стресса на жизнеспособность и экспрессию бактериоцинов L. acidophilus

3.2. Исследование влияния БГС на жизнеспособность кожных патогенов и HSF

клеточной линии

3.3. Разработка материала на основе биогибридной системы для in vivo

исследования

3.4. Исследование ранозаживляющих свойств материала на основе БГС

ЗАКЛЮЧЕНИЕ

СПИСОК СОКРАЩЕНИЙ

СПИСОК ЛИТЕРАТУРЫ

ПРИЛОЖЕНИЕ. ТЕКСТЫ ПУБЛИКАЦИЙ

РЕФЕРАТ

ОБЩАЯ ХАРАКТКРИСТИКА ДИССЕРТАЦИИ

Актуальность темы.

Влияние стресса на живые организмы характеризуется двумя явлениями -эустресс и дистресс. Эустресс возникает при малых дозах или малой продолжительности воздействия стресс факторов и в итоге может приводить к адаптации организма и повышать в общем его метаболическую активность. Дистресс - это влияние больших доз или продолжительного воздействие стресс фактора, что может приводить к метаболическим нарушениям и снижению жизнеспособности организма. Возникновение эустресса и дистресса обуславливается способностью организма приспосабливаться за счёт имеющихся метаболических механизмов защиты от определённых стресс факторов, что описывает отличающуюся способность адаптации разных организмов к одинаковым стресс факторам.

Описываемые явления также относятся и к исследованиям влияния наночастиц (НЧ) оксидов металлов в отношение снижения жизнеспособности бактерий. Одним из основных механизмов токсичности НЧ оксидов металлов является синтез ими молекул активных форм кислорода (АФК), которые формируют реакцию окислительного стресса. Несмотря на эустресс, большая часть исследований о влияние НЧ оксидов металлов сконцентрирована на вызываемой ими реакции дистресса и общей токсичности НЧ. Тем не менее в некоторых исследованиях, в контексте токсичности НЧ TiO2 в отношение Lactobacillus sp. появляются обратные результаты, которые указывают на способность НЧ повышать жизнеспособность бактерий и также появляются исследования в контексте использования Lactobacillus sp. в качестве пробиотиков с антиоксидантной защитой, но механизмы подобных взаимодействий изучены недостаточно. Подобные противоречивые результаты в контексте исследования влияния НЧ TiO2 на бактерий рода Lactobacillus sp. описываются в первую очередь низкой цитотоксичностью НЧ и их активностью в отношение синтеза АФК, которая зависит от множества факторов: формы, размера, площади поверхности и типа

строения кристаллической решётки, - и метаболических механизмов защиты и регуляции для нейтрализации АФК у Lactobacillus sp.

В данной работе предложена новая концепция регуляция метаболической активности штамма Lactobacillus acidophilus ATCC 4356 за счёт доза-зависимого окислительного стресса, вызванного НЧ ТЮг анатазной кристаллической формы. Основная гипотеза исследования заключается в использовании эффекта окислительного стресса, индуцированного НЧ ТЮг, для усиления метаболической активности лактобактерий в отношение усиления их антибактериальной и ранозаживляющей биологической активности.

В отличие от традиционных подходов, где наночастицы оксидов металлов рассматриваются исключительно как токсичные агенты, в данной работе продемонстрирован их потенциал как модулятора клеточного стресса, способного регулировать синтез биологически активных соединений у пробиотических бактерий, и апробировано потенциальное практическое применение на моделях in vivo.

Рекомендованный список диссертаций по специальности «Другие cпециальности», 00.00.00 шифр ВАК

Введение диссертации (часть автореферата) на тему «Биогибридная система на основе Lactobacillus acidophilus и наночастиц диоксида титана с ранозаживляющими и антибактериальными свойствами»

Цель работы.

Установление метаболических процессов у L. acidophilus ATCC 4356 под действием наночастиц TiO2 и разработка биогибридной системы на их основе с антибактериальными и ранозаживляющими свойствами.

Задачи работы.

1. Изучить влияние НЧ TiO2 в анатазной форме на рост и индукцию окислительного стресса за счёт определения динамики H2O2 и экспрессии генов;

2. Изучить влияние НЧ TiO2 в анатазной форме на экспрессию

антибактериальных соединений L. acidophilus под действием контролируемого окислительного стресса;

3. Исследовать антибактериальную активность биогибридной системы на основе L. acidophilus и НЧ TiO2 на патогенных штаммах с

антибиотикорезистентностью и цитотоксичность на эпителиальных клеточных линиях;

4. Исследовать физико-химические свойства, биосовместимость и ранозаживляющую активность материала на основе биогибридной системы и поли(Н-изопропилакриламид) in vivo на модели заживления ожоговой раны на крысах.

Научная новизна работы.

В данном исследовании проводится установления влияния окислительного стресса, индуцированного НЧ TiO2, на молекулярные механизмы реагирования L. acidophilus в отношение параметров роста, формирование окислительного стресса и анализ его влияния на регуляцию синтеза бактериоцинов. Полученные данные позволили впервые обнаружить взаимосвязи в метаболической активности между генами окислительного стресса и бактериоцинов в зависимости от дозы НЧ. Также был проведён анализ полученной биогибридной системы (БГС) в отношение предполагаемого применения данных механизмов в медицине для антибактериальной терапии и заживления ожоговых ран.

Объектом исследования являлась способность регулировать биологическую активность L. acidophilus в отношение антибактериального и ранозаживляющего действия за счёт влияния окислительного стресса, вызванного НЧ TiO2.

Предметом исследования являлось установление молекулярных механизмов реагирования L. acidophilus на НЧ TiO2 - определение влияния НЧ TiO2 на индукцию окислительного стресса и влияния окислительного стресса на регуляцию синтеза бактериоцинов у L. acidophilus. На основе полученных данных создание биогибридной системы и исследование её активности в отношение жизнеспособности антибиотикорезистентных патогенов, эпителиальных клеточных линиях человека и ранозаживляющей активности на in vivo заживления ожоговых ран у крыс.

Теоретическая и практическая значимость работы.

Впервые выявлена гормезисная реакция у L. acidophilus в ответ на АФК, производимые НЧ TiO2 в концентрации 15 мкг/мл. 250 мкг/мл НЧ TiO2 были определены как лимитирующая гормезис концентрация, совместно с 15 мкг/мл они обеспечивали влияние на метаболические пути синтеза перекиси водорода,

увеличивали экспрессию бактериоцинов и активность L. acidophilus в отношение жизнеспособности антибиотикорезистентных патогенов in vitro. Также биогибридная система показала повышенную биологическую активность в in vivo модели ранозаживление. Представленная концепция может быть применена не только к подходам заживления ран, но и к широкому спектру заболеваний, связанных с патогенными бактериями и воспалительными процессами. Также полученные результаты могут быть применимы в области биоинженерии и биотехнологии, в том числе для увеличения продукции бактериоцинов.

Методы исследования.

Для индукции окислительного стресса у L. acidophilus были синтезированы золь-гель методом НЧ TiO2 анатазной кристаллической фазы, которые способны синтезировать молекулы АФК без влияния УФ излучения, что позволяло регулировать реакцию окислительного стресса за счёт изменения концентрации НЧ и пролонгировать его продолжительность. Данные НЧ были комплексно охарактеризованы с использованием физико-химических методов, включая анализ морфологических и структурных параметров. В качестве живого объекта была выбрана L. acidophilus, которая является эталонным штаммом для изучения синтеза перекиси водорода в ответ на АФК среди штаммов LaсtobacШus sp. Для изучения влияния окислительного стресса на L. acidophilus проводилось исследование влияния НЧ TiO2 на количество бактерий методом высева на КОЕ и продукцию перекиси водорода как маркера окислительного стресса с применением флуоресцентных красителей. Индукция окислительного стресса и его влияние на антибактериальную активность L. acidophilus определялась методом обратной транскрипции с последующей полимеразной цепной реакцией (ОТ-ПЦР) в отношение уровня экспрессии ключевых генов, ассоциированных с индукцией окислительного стресса, нейтрализацией АФК и синтезом бактериоцинов. Собранная биогибридная система была исследована на антибактериальную активность в модели совместного культивирования с патогенами, ассоциированными с контаминацией раневой поверхности, и цитотоксичность на клеточной линии HSF (Human Skin Fibroblast). Количество бактерий в методе

совместного культивирования определялось с помощью разведения их из смеси путём высева на селективные питательные среды для подсчёта КОЕ, а цитотоксичность с использованием красителей резазурина и йодида пропидия. Для изучения ранозаживляющей активности БГС был разработан биогибридный материал (БГМ) на ее основе в структуре биосовместимого гидрогеля поли(Н-изопропилакриламид) (PNIPAM) для создания более плотной и регулируемой среды и ограничения контакта бактерий и НЧ с раневой поверхность. Данный этап работы включал описание физико-химических параметров БГМ, исследования впитываемости и пропускание водяного пара, биосовместимости на примере в-гемолиза in vitro. Ранозаживляющую активность in vivo исследовали на животных моделях с использованием термического ожога, нанесённого в межлопаточную область. Материалы наносились 1 раз в сутки в течение всех дней исследования. Воспроизводимость экспериментов и точность определяемых параметров подтверждается на основе результатов статистической обработки.

Положения, выносимые на защиту.

1. НЧ TiO2 анатазной формы размером 20-40 нм могут регулировать метаболические процессы L. acidophilus за счёт влияния окислительного стресса, индуцированного разными концентрациями НЧ TiO2, которое было выражено в пролонгировании и увеличении синтеза перекиси водорода, индукцией экспрессии генов окислительного стресса, что приводило к увеличению жизнеспособности L. acidophilus до 2 раз и увеличению экспрессии генов бактериоцинов. Полученные данные подтверждают, что подобные эффекты могут быть использованы в создание биогибридной системы с антибактериальными и ранозаживляющим эффектом;

2. Изменение метаболической активности L. acidophilus в составе биогибридной системы за счёт влияния окислительного стресса, индуцированного НЧ TiO2, позволяет увеличить их антибактериальную активность, что выражается в снижении КОЕ Staphylococcus aureus ATCC 29213 и Escherichia coli К12 на 83 и 76% в модели со-культивирования и увеличении площади ингибирования до 1,7 и 2,3 раз методом лунок, соответственно;

3. Биологические свойства биогибридной системы не обуславливают снижение жизнеспособности HSF (Human skin fibroblast) клеточной линии и проявляют ранозаживляющую активность, уменьшая площадь раны на 21 день исследования в 3-5 раз больше по сравнению с другими контрольными группами. Полученные данные указывают на возможность применения полученного биогибридной системы в терапии эрозивно-язвенных повреждений кожи.

Достоверность научных достижений и апробация работы.

Исследование в рамках представленной диссертационной работы проводилось в Университете ИТМО и Ивановской государственной медицинской академии (ИвГМА). Протоколы проводимых экспериментов были утверждены локальным этическим комитетом ИвГМА, которая имеет аккредитацию на проведение in vivo экспериментов от Минздрава РФ по приказу № 43232. Результаты всех экспериментов были получены с использованием современного оборудования и общепринятых биологических моделей. Достоверность полученных результатов подтверждается представленными первичными данными с описанием статистической обработки.

По теме диссертации опубликовано 5 печатных работ в рецензируемых журналах, рекомендованных ВАК и Минобрнауки РФ для опубликования основных научных результатов для соискателей кандидатской степени.

Результаты, представленные в диссертации, были частично опубликованы в ранее представленной магистерской диссертации автора работы, также на основе представленных результатов был выигран конкурс грантов Комитета по науке и высшей школы (КНВШ) Санкт-Петербурга.

Личный вклад автора.

Все описанные результаты, за исключение содержания крыс и, частично, характеризации материалов, были проведены автором лично или с его участием. Обработка данных полностью выполнена автором.

Структура и объём диссертации.

Диссертация состоит из введения, трёх глав: обзора литературы, материалы и методы, результаты исследования; заключение и список литературы, сокращений

и приложение с опубликованными научными работами. Диссертация изложена на 198 страницах, включает 9 таблиц, 46 рисунков. Список литературы включает 135 источников.

Текст диссертации изложен в соответствие с общими требованиями к оформлению, утверждёнными в ГОСТ Р 7.0.11.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Во введение обосновывается актуальность темы диссертации, поставлены цель и сформулированные задачи для её выполнения, научная новизна, обозначены и раскрыты научная и практическая значимости работы и достоверность полученных данных. Приведены научные положения, выносимые на защиту и данные об апробации полученных данных в формате публикации научных докладов и статей.

Первая глава диссертации отражает комплексный обзор применения биогибридных систем в биомедицине для антибактериальной и ранозаживляющей терапии. Описываются биогибридные системы и материалы, включая принципы их создания, методы инкапсулирования бактерий в материал, применение для ранозаживления и основные подходы для управления метаболизмом бактерий в материале и области их применения в биомедицине и биотехнологии. Также рассматривается биологическая активность бактерий рода Lactobacillus sp. для применения в антибактериальной и ранозаживляющей терапии, механизмы защиты от окислительного стресса. Описываются антибактериальные механизмы микро- и наночастиц, зависимость данного параметра от физико-химических параметров частиц и использование микро- и макрочастиц как соединений, способных влиять на механизмы регуляции биологической активности бактерий рода Lactobacillus sp. за счёт механизмов индукции окислительного стресса.

Вторая глава включает описание экспериментальных методов, используемых для выполнения диссертационной работы. Синтетические процедуры получения НЧ TiO2, PNIPAM и их характеризация, включая размер частиц, гидродинамический диаметр, z-потенциал, размер пор, исследование абсорбционной способности и прохождения водяного пара через БГМ.

Эксперименты in vitro, включающие исследование влияния на жизнеспособность НЧ TiO2 на L.acidophilus, S. aureus, E. coli методом посева на KOE и HSF клеточной линии методом инкубации с резазурином и проточной цитометрией с использованием йодида пропидия, определение продукции перекиси водорода с использованием флюоресцентного красителя 6-Карбокси-H2DCFDA, выделения РНК и ОТ-ПЦР для определения экспрессии генов, связанных с защитой от окислительного стресса и синтезом бактериоцинов у L.acidophilus, методы со-культивирования для определения антибактериальной активности БГС в отношение роста патогенов и токсичности на HSF клеточную линию методами посева на КОЕ и проточной цитометрии с йодидом пропидия, соответственно, а также исследование ß-гемолиза образцом БГМ. In vivo исследование заживления ожоговых ран с фиксацией площади ран в течение 21 дня.

В третьей главе описывается установления влияния различных концентраций НЧ TiO2 на регуляцию биологической активности за счёт индукции окислительного стресса, вызванного у L. acidophilus для антибактериального применения и обработки ран. В первую очередь производилась характеризация НЧ TiO2 с описанием их физико-химических свойств, также исследовалось влияние НЧ TiO2 в концентрациях от 7,5 до 1000 мкг/мл на жизнеспособность лактобактерий, регуляцию синтеза перекиси водорода и экспрессии генов окислительного стресса, бактериоцинов и метаболическую связь между ними. Далее биогибридная система на основе L. acidophilus и НЧ TiO2 в концентрациях 15, 250 и 1000 мкг/мл исследовались на способность ингибировать рост кожных патогенов S. aureus и E. coli и влияние на жизнеспособность HSF клеточной линии. После проводится характеризации PNIPAM по физико-химическим параметрам, сборка БГМ на основе БГС и исследование его абсорбционной способности, способности к пропусканию водяного пара и биосовместимости. Далее оптимизированную комбинацию БГС в составе БГМ исследовали на модели in vivo заживления ожоговых ран у крыс в течение 21 дня.

Первая часть главы посвящена изучению регуляции метаболизма L. acidophilus за счёт влияния окислительного стресса, индуцированного НЧ TiO2, где продемонстрированы эустресс в отношение жизнеспособности и влияние на экспрессию бактериоцинов в зависимости от концентрации НЧ.

Физико-химические свойства синтезированных НЧ TiO2 описывались исходя из полученных данных о размере, зета-потенциале, площади поверхности, диаметру и объёму пор (Таблица 1).

Таблица 1. Характеризация наночастиц TiO2 с применением DLS, XRD, BET площади поверхности и BJH объёма и диаметра пор.

Зета-потенциал (mV) Средний размер наночастиц DLS (Dh) (нм) Средний размер наночастиц XRD (Scherrer) (нм) BET площадь поверхности (м2/г)а) BJH объём пор (см3/г)а) BJH диаметр пор (А)а)

TiO2 +25,1 28 12 174 0.01 32

а) температура дегазации 120 °С, время дегазации 8 ч. А

Также проводились эксперименты для определения кристаллической фазы НЧ ТЮ2, гидродинамического радиуса и процесса адсорбции/десорбции жидкого

азота (Рисунок 1).

® ® ©-

20 30 ЛО SO 60 10 20 30 JO 60 0,2 0.4 0.6 0,8 1

2© (Си Ко) С) Hydrodyriamic, nm Relative Pressure. P/Po

Рисунок 1. PXRD-шаблоны подготовленных НЧ ТЮ2 (А), распределение гидродинамического радиуса (Rh) стабильного ТЮ2 в воде методом динамического рассеяния света (Б), изотермы процессов адсорбции/десорбции жидкого N2 из ТЮ2

(В).

Полученные результаты свидетельствуют об успешном синтезе НЧ TiO2 анатазной формы, поскольку только анатазная форма TiO2 может спонтанно генерировать молекулы АФК без прямого влияния ультрафиолетового излучения. После сушки коллоидного раствора TiO2 при 120° образовывалась мезопористая структура, что увеличивает площадь поверхности, которая может быть вовлечена в синтез молекул АФК. Это послужило их дальнейшему применению как предположительного фактора окислительного стресса для регуляции метаболизма L. acidophilus.

Для подтверждения гипотезы об индукции НЧ TiO2 окислительного стресса исследовалось влияние синтезированных НЧ в конечных концентрациях от 7,5 до 1000 мкг/мл на жизнеспособность L. acidophilus в питательной среде МРС (Рисунок 2А). Было выявлено, что добавление TiO2 НЧ в концентрации 15 мкг/мл влияет на рост L. acidophilus, увеличивая количество колониеобразующих единиц (КОЕ) с 1,04±0,06х108 КОЕ/мл до 2,03±0,27х108 КОЕ/мл, что свидетельствует об увеличении количества бактерии в 2 раза (Рисунок 2Б). Концентрация НЧ TiO2 250 мкг/мл не показала существенной разницы по сравнению с контролем. Полученные данные указывают на эустресс и индукцию гормезиса - эффекта стимуляции роста при малых концентрациях, для образования которого пиковой концентрацией является 15 мкг/мл; 250 мкг/мл лимитирует данный эффект, что выражается в КОЕ, равному контролю без статистических различий. Статистически значимое ингибирование было достигнуто при концентрации 1000 мкг/мл НЧ в среде. Для дальнейшего исследования были отобраны указанные конечные концентрации НЧ TiO2

Далее исследовалось влияние НЧ TiO2 15, 250 и 1000 мкг/мл на синтез H2O2 L. acidophilus при помощи метода с использованием флуоресцентного красителя 6-Карбокси-HDCFDA, способного определять гидроксил радикалы и перекись водорода в биологической системе. У L. acidophilus без НЧ наблюдался рост H2O2 до 4 часа культивирования. Данный эффект описывает их способность преобразовывать O2 в H2O2 и объясняет увеличение количества перекиси водорода.

После происходило линейное уменьшение количества H2O2 до двух раз от пикового значения 40*103 a.u. до 20*103 a.u, что характеризуется уменьшением концентрации кислорода в среде. При культивировании с НЧ TiO2 в концентрациях 15 и 250 мкг/мл после добавления их и инкубации с красителем в течение 40 минут (0 точка) была показана разница в количестве H2O2 до 12 раз от 2 до 24*103 a.u. в сравнение с контролем, что является доказательством индукции окислительного стресса. Далее до 2 часа культивирования происходил рост количества H2O2, которое достигало 30-35*103 a.u. До окончания эксперимента количество H2O2 оставалось на одной уровне, статистическая разница не наблюдалась отдельно в группе и между образцами с первого часа культивирования, что свидетельствует о стабильном и продолжительном синтезе H2O2 в течение 24 ч (Рисунок 2В) под воздействием 15 и 250 мкг/мл НЧ, разница с контрольным значением в данной точке достигала 2 раз. Концентрация 1000 мкг/мл НЧ TiO2 ингибировала метаболизм L. acidophilus, поскольку интенсивность флуоресценции снижалась со второго часа культивирования и на 24 ч достигла 10*103 a.u, что в 2 раза отличалось от контрольного значения.

КвН1рОлЬ 7.5 IS 30 GO 120 250 SBO 10С0 +15 МКГ/МЛ TlOz + 1000 МКГ/МЛ "ПОа

"ПОа, мкг/мл

Рисунок 2. Исследование влияние НЧ TiO2 на жизнеспособность L. acidophilus и количество перекиси водорода как продукта молекулярных механизмов реагирования на окислительный стресс. Предполагаемый механизм индуцирования пролонгированного окислительного стресса (А), исследование влияния НЧ TiO2 на жизнеспособность лактобактерий (Б) и синтез перекиси

водорода (В). Эксперименты проводились в трёх биологических повторностях, достоверность показана с помощью Краскела-Уоллиса с апостериорным анализом по Тьюки-Крамера.

Далее, на основе данных о регуляции синтеза перекиси водорода как маркера окислительного стресса, исследовалась экспрессия генов, ответственных за стресс ответ и их влияние на синтез бактериоцинов у L. acidophilus в динамике на 30, 60, 120 и 180 минутах под воздействием 15 и 250 мкг/мл НЧ TiO2. Разница с контролем экспрессии генов определялась методом 2-aaCt.

Рисунок 3. Исследование экспрессии генов, ассоциированных с защитой от влияния АФК (синий), нейтрализации АФК молекул (зелёный) у L. acidophilus при концентрации 15 мкг/мл, красная линия - значение экспрессии контроля. Достоверность показана с помощью ANOVA с апостериорным анализом по Тьюки.

Было показано, что НЧ TiO2 в концентрации 15 мкг/мл повышают экспрессию генов нейтрализации и защиты от АФК у всех генов на 60 минуте до 2 раз для trxA-2, trxB-1 и spxB и от 2 до 8 раз у для trxA-1 и 3, trxB-2, msrA, ygiN-1 и 2 и tpx на 120 минуте исследования. Динамика trxA-2 и trxB-1 была противоположна на 60 и 120 минутах измерений, что может указывать на последовательность включения данных изоформ при влиянии окислительного стресса (Рисунок 3).

При культивировании L. acidophilus с НЧ TiO2 в конечной концентрации 250 мкг/мл, в сравнение с 15 мкг/мл, наблюдалось увеличение количества генов с повышенной экспрессией в отношение защиты и нейтрализации АФК в сравнение с контролем (Рисунок 4). На 60 минуте в 2-5 раз для trxA-2, trxB-1 и spxB и на 120 минуте в 2-3 раза для trxA-1 и 3, trxB-2, msrA, ygiN-1 и 2, на 180 до 3 раз для tpx и в сравнение с 15 мкг/мл экспрессия была повышена у всех генов, ответственных как за защиту, так и за нейтрализацию АФК, что также указывает на повышенный окислительный стресс в общем.

Рисунок 4. Исследование экспрессии генов, ассоциированных с защитой от влияния АФК (синий), нейтрализации АФК молекул (зелёный) у L. acidophilus при концентрации 250 мкг/мл, красная линия - значение экспрессии контроля. Достоверность показана с помощью ANOVA с апостериорным анализом по Тьюки.

При добавлении 15 мкг/мл НЧ TiO2 через 30 минут экспрессия бактериоцинов была ниже контрольного значения и осталась повышенной только у Энтероцин X в, Хелветицин J (Рисунок 5). Через 60 минут экспрессия всех генов снизилась и стала ниже значений контроля. Через 120 минут после начала культивирования экспрессия всех бактериоцинов значительно возросла от 2 до 6 раз выше в сравнение с контролем, но на 180 минуте сравнялись со значениями в контрольной группе. Данная динамика коррелирует с данными об окислительном стрессе, особенно с генами trxA-1 и 3, trxB-2 на 120 минуте и в общем с пируватоксидазной и хинолмонооксигеназной активностью, что указывает на возможную связь между экспрессией бактериоцинов и генов окислительного стресса.

Бактериоцин Ис Энтероцин X р Хельветицин J

Продолжительность эксперимента, мин. Продолжительность эксперимента, мин. Продолжительность эксперимента, мин.

Рисунок 5. Исследование экспрессии генов, ассоциированных с синтезом бактериоцинов у L. acidophilus при концентрации 15 мкг/мл, красная линия -значение экспрессии контроля. Достоверность показана с помощью ANOVA с апостериорным анализом по Тьюки.

При культивировании L. acidophilus с 250 мкг/мл НЧ TiO2 (Рисунок 6) динамика синтеза бактериоцинов и их повышение сходится с предыдущим экспериментом при культивировании с 15 мкг/мл НЧ TiO2, но значительная разница наблюдается на 30 и 180 минутах культивирования, где экспрессия повышена. Аналогичное явление наблюдается и при исследовании окислительного стресса.

Рисунок 6. Исследование экспрессии генов, ассоциированных с синтезом бактериоцинов у L. acidophilus при концентрации 250 мкг/мл, красная линия -

значение экспрессии контроля. Достоверность показана с помощью ANOVA с апостериорным анализом по Тьюки.

Корреляционный анализ экспрессии генов, связанных с ответом на окислительный стресс (Рисунок 7А, Б), выявил характерные паттерны взаимосвязей между генами защиты и нейтрализации АФК и бактериоцинами. Положительные корреляции были установлены для тиоредоксина-1, тиоредоксина-3, тиоредоксин-дисульфид редуктазы-2 и метионинсульфоксид-редуктазы с большинством изученных бактериоцинов при добавлении НЧ ТЮ2 в концентрации 15 мкг/мл. В то же время тиоредоксин-2, тиоредоксин-дисульфид редуктаза-1 и пируватоксигеназа демонстрировали отрицательные корреляции с экспрессией бактериоцинов, что приводило к снижению экспрессии ниже контроля на 60 минуте эксперимента. Под влиянием НЧ ТЮ2 250 мкг/мл данные взаимосвязи подтверждались, в некоторых случаях влияние становилось сильнее, как пример коэффициент корреляция динамики тиоредоксина-1 увеличился в отношение всех исследуемых бактериоцинов, тиоредоксин-дисульфидредуктазы-2 в отношение Бактериоцина 11с, Энтеролизина А, LSEI 2386 и Ацидоцина, в случае с хинолмонооксигеназой-1 наблюдалось увеличение данного показателя практически для всех бактериоцинов, кроме Энтеролизина А, т.к. коэффициент корреляции в данном случае из-за увеличения окислительного стресса снизился с 0,7 до 0,1, что указывает на отсутствия между ними связи.

Рисунок 7. Исследование корреляции экспрессии генов, ассоциированных с защитой от влияния АФК и синтезом бактериоцинов у L. acidophilus при концентрациях 15 мкг/мл (А) и 250 мкг/мл (Б) НЧ TiO2 по Спирмену.

Полученные результаты характеризовали концентрации НЧ TiO2 15 и 250 мкг/мл как подходящие для регуляции метаболической активности L. acidophilus, т.к. одна их них характеризовала явление эустресса, гормезиса и увеличивала количество бактерий до двух раз, также данные концентрации приводили к повышенному синтезу перекиси водорода в течение 24 часов, что характеризовало индукцию окислительного стресса, и оказывало влияние окислительного стресса на регуляцию экспрессии исследуемых бактериоцинов от 2 до 6 раз. Индукция экспрессии генов окислительного стресса и синтеза бактериоцинов преобладала при добавлении 250 мкг/мл НЧ.

Во второй части главы исследовалась жизнеспособность кожных патогенов и HSF клеточной линии под влиянием БГС, которая состояла из L. acidophilus и НЧ TiO2 в концентрациях 15, 250 и 1000 мкг/мл.

В отношение влияния на жизнеспособность патогенных бактерий с антибиотикорезистентностью (Рисунок 8А) E. coli НЧ TiO2 проявляли статистически значимую ингибирующую активность, снижая КОЕ до 57,5% для 1000 мкг/мл от КОЕ контроля (Рисунок 8Б). S. aureus показал также чувствительность к НЧ TiO2. При максимальной концентрации НЧ TiO2 КОЕ значительно снизилось до 71,9% при концентрации НЧ 1000 мкг/мл (Рисунок 8В).

Исследование влияния на жизнеспособность под воздействием БГС в модели совместного культивирования показало повышенную биологическую БГС с НЧ TiO2 на количество L. acidophilus, а в отношение антибактериальной активности в сторону снижения количества патогенных бактерий. L. acidophilus, E. coli и S. aureus культивировали одновременно в отдельных пробирках, что служило контролем. Эксперименты по совместному культивированию патогенов и лактобактерии без НЧ TiO2 показали ингибирующую активность без существенных различий для E. coli и S. aureus (Рисунок 8Б, В). В исследуемых образцах при

увеличении концентрации TiO2 НЧ от 15 до 1000 мкг/мл количество L. acidophilus увеличивалось на 61,7% от контрольного значения КОЕ/мл при 250 мкг/мл НЧ TiO2 в совместном культивировании с E. coli и на 47,5% с S. aureus. Количество патогенов уменьшалось с увеличением концентрации НЧ TiO2 в БГС и достигло снижение выживаемости на 74,9% для E. coli и 83,1% для S. aureus. Также не было зафиксировано статистически значимой разницы ингибирования количества патогенов при культивировании с БГС, содержащей 250 и 1000 мкг/мл НЧ.

I

ТОКСИЧНОСТЬ ТЮг

Похожие диссертационные работы по специальности «Другие cпециальности», 00.00.00 шифр ВАК

Список литературы диссертационного исследования кандидат наук Локтева Алина Владимировна, 2025 год

СПИСОК ЛИТЕРАТУРЫ

1. Multifunctional biohybrid magnetite microrobots for imaging-guided therapy / X. Yan, Q. Zhou, M. Vincent [et al.] // Science Robotics. - 2017. - Vol. 2. -№ 12.

2. Bacteria clustering by polymers induces the expression of quorum-sensing-controlled phenotypes / L. T. Lui, X. Xue, C. Sui [et al.] // Nature Chemistry. - 2013. -Vol. 5. - № 12. - P. 1058-1065.

3. Solar-Powered Organic Semiconductor-Bacteria Biohybrids for CO 2 Reduction into Acetic Acid / P. Gai, W. Yu, H. Zhao [et al.] // Angewandte Chemie International Edition. - 2020. - Vol. 59. - № 18. - P. 7224-7229.

4. Biofilm-Inspired Encapsulation of Probiotics for the Treatment of Complex Infections / Z. Li, A. M. Behrens, N. Ginat [et al.] // Advanced Materials. - 2018. -Vol. 30. - № 51.

5. 3D-printed hierarchical pillar array electrodes for high-performance semi-artificial photosynthesis / X. Chen, J. M. Lawrence, L. T. Wey [et al.] // Nature Materials. - 2022. - Vol. 21. - № 7. - P. 811-818.

6. Dörr, T. Editorial: Bacterial Cell Wall Structure and Dynamics / T. Dörr, P. J. Moynihan, C. Mayer // Frontiers in Microbiology. - 2019. - Vol. 10.

7. Fisher, J. F. Constructing and deconstructing the bacterial cell wall / J. F. Fisher, S. Mobashery // Protein Science. - 2020. - Vol. 29. - № 3. - P. 629-646.

8. Covalent Binding of Nanoliposomes to the Surface of Magnetotactic Bacteria for the Synthesis of Self-Propelled Therapeutic Agents / S. Taherkhani, M. Mohammadi, J. Daoud [et al.] // ACS Nano. - 2014. - Vol. 8. - № 5. - P. 5049-5060.

9. Nanoscale Bacteria-Enabled Autonomous Drug Delivery System (NanoBEADS) Enhances Intratumoral Transport of Nanomedicine / S. Suh, A. Jo, M. A. Traore [et al.] // Advanced Science. - 2019. - Vol. 6. - № 3.

10. Polydopamine Nanoparticle-Mediated Dopaminergic Immunoregulation in Colitis / J. Li, W. Hou, S. Lin [et al.] // Advanced Science. - 2022. - Vol. 9. - № 1.

11. Self-Mineralized Photothermal Bacteria Hybridizing with Mitochondria-Targeted Metal-Organic Frameworks for Augmenting Photothermal Tumor Therapy / Q. Chen, X. Liu, J. Fan [et al.] // Advanced Functional Materials. - 2020. - Vol. 30. - № 14.

12. Engineered E. coli Nissle 1917 for the delivery of matrix-tethered therapeutic domains to the gut / P. Praveschotinunt, A. M. Duraj-Thatte, I. Gelfat [et al.] // Nature Communications. - 2019. - Vol. 10. - № 1. - P. 5580.

13. Engineering Bacteria-Activated Multifunctionalized Hydrogel for Promoting Diabetic Wound Healing / Y. Lu, H. Li, J. Wang [et al.] // Advanced Functional Materials. - 2021. - Vol. 31. - № 48.

14. Vascular Endothelial Growth Factor and Angiogenesis / A. Hoeben, B. Landuyt, M. S. Highley [et al.] // Pharmacological Reviews. - 2004. - Vol. 56. - № 4. -P. 549-580.

15. Injectable Poloxamer Hydrogels for Local Cancer Therapy / A. C. Marques, P. C. Costa, S. Velho, M. H. Amaral // Gels. - 2023. - Vol. 9. - № 7. - P. 593.

16. Characterization and protective effect against ultraviolet radiation of a novel exopolysaccharide from Bacillus marcorestinctum QDR3-1 / F. Li, X. Hu, L. Qin [et al.] // International Journal of Biological Macromolecules. - 2022. - Vol. 221. - P. 13731383.

17. Lactobacillus acidophilus : Characterization of the Species and Application in Food Production / N. Anjum, S. Maqsood, T. Masud [et al.] // Critical Reviews in Food Science and Nutrition. - 2014. - Vol. 54. - № 9. - P. 1241-1251.

18. Resetting microbiota by Lactobacillus reuteri inhibits T reg deficiency-induced autoimmunity via adenosine A2A receptors / B. He, T. K. Hoang, T. Wang [et al.] // Journal of Experimental Medicine. - 2017. - Vol. 214. - № 1. - P. 107-123.

19. Probiotic L. reuteri Treatment Prevents Bone Loss in a Menopausal Ovariectomized Mouse Model / R. A. Britton, R. Irwin, D. Quach [et al.] // Journal of Cellular Physiology. - 2014. - Vol. 229. - № 11. - P. 1822-1830.

20. Enoch, S. Basic science of wound healing / S. Enoch, D. J. Leaper // Surgery (Oxford). - 2008. - Vol. 26. - № 2. - P. 31-37.

21. Eming, S. A. Wound repair and regeneration: Mechanisms, signaling, and translation / S. A. Eming, P. Martin, M. Tomic-Canic // Science Translational Medicine.

- 2014. - Vol. 6. - № 265.

22. Eming, S. A. Metabolic orchestration of the wound healing response / S. A. Eming, P. J. Murray, E. J. Pearce // Cell Metabolism. - 2021. - Vol. 33. - № 9. - P. 17261743.

23. Lee, C. S. Anti-inflammatory and Anti-osteoporotic Potential of Lactobacillus plantarum A41 and L. fermentum SRK414 as Probiotics / C. S. Lee, S. H. Kim // Probiotics and Antimicrobial Proteins. - 2020. - Vol. 12. - № 2. - P. 623-634.

24. Anti-inflammatory and immunomodulatory efficacy of indigenous probiotic Lactobacillus plantarum Lp91 in colitis mouse model / R. K. Duary, M. A. Bhausaheb, V. K. Batish, S. Grover // Molecular Biology Reports. - 2012. - Vol. 39. - № 4. - P. 47654775.

25. Lactobacillus plantarum ZS2058 and Lactobacillus rhamnosus GG Use Different Mechanisms to Prevent Salmonella Infection in vivo / J. Liu, Z. Gu, F. Song [et al.] // Frontiers in Microbiology. - 2019. - Vol. 10.

26. Wound bed preparation: a systematic approach to wound management / G. S. Schultz, R. G. Sibbald, V. Falanga [et al.] // Wound Repair and Regeneration. - 2003. -Vol. 11. - № s1.

27. Cross, K. J. Growth factors in wound healing / K. J. Cross, T. A. Mustoe // Surgical Clinics of North America. - 2003. - Vol. 83. - № 3. - P. 531-545.

28. Okonkwo, U. Diabetes and Wound Angiogenesis / U. Okonkwo, L. DiPietro // International Journal of Molecular Sciences. - 2017. - Vol. 18. - № 7. - P. 1419.

29. Bacteriocins of lactic acid bacteria: extending the family / P. Alvarez-Sieiro, M. Montalbán-López, D. Mu, O. P. Kuipers // Applied Microbiology and Biotechnology.

- 2016. - Vol. 100. - № 7. - P. 2939-2951.

30. Classification of Bacteriocins from Lactic Acid Bacteria and Their Mode of Action / N. S. Castrejón-Jiménez, I. A. Castrejón-Jiménez, T. O. Rojas-Campos [et al.] // Antimicrobial Peptides from Lactic Acid Bacteria. - Singapore : Springer Nature Singapore, 2024. - P. 33-65.

31. Autoregulation of Lantibiotic Bovicin HJ50 Biosynthesis by the BovK-BovR Two-Component Signal Transduction System in Streptococcus bovis HJ50 / J. Ni, K. Teng, G. Liu [et al.] // Applied and Environmental Microbiology. - 2011. - Vol. 77. -№ 2. - P. 407-415.

32. Current Knowledge of the Mode of Action and Immunity Mechanisms of LAB-Bacteriocins / A. Pérez-Ramos, D. Madi-Moussa, F. Coucheney, D. Drider // Microorganisms. - 2021. - Vol. 9. - № 10. - P. 2107.

33. The circular bacteriocin, carnocyclin A, forms anion-selective channels in lipid bilayers / X. Gong, L. A. Martin-Visscher, D. Nahirney [et al.] // Biochimica et Biophysica Acta (BBA) - Biomembranes. - 2009. - Vol. 1788. - № 9. - P. 1797-1803.

34. The Circular Bacteriocins Gassericin A and Circularin A / Y. Kawai, R. Kemperman, J. Kok, T. Saito // Current Protein & Peptide Science. - 2004. - Vol. 5. -№ 5. - P. 393-398.

35. Zhu, L. Structural Basis of the Immunity Mechanisms of Pediocin-like Bacteriocins / L. Zhu, J. Zeng, J. Wang // Applied and Environmental Microbiology. -2022. - Vol. 88. - № 13.

36. Complementary and Overlapping Selectivity of the Two-Peptide Bacteriocins Plantaricin EF and JK / G. N. Moll, E. van den Akker, H. H. Hauge [et al.] // Journal of Bacteriology. - 1999. - Vol. 181. - № 16. - P. 4848-4852.

37. Peptide-Lipid Huge Toroidal Pore, a New Antimicrobial Mechanism Mediated by a Lactococcal Bacteriocin, Lacticin Q / F. Yoneyama, Y. Imura, K. Ohno [et al.] // Antimicrobial Agents and Chemotherapy. - 2009. - Vol. 53. - № 8. - P. 3211-3217.

38. Specific Interaction of the Unmodified Bacteriocin Lactococcin 972 with the Cell Wall Precursor Lipid II / B. Martínez, T. Böttiger, T. Schneider [et al.] // Applied and Environmental Microbiology. - 2008. - Vol. 74. - № 15. - P. 4666-4670.

39. Nilsen, T. Enterolysin A, a Cell Wall-Degrading Bacteriocin from Enterococcus faecalis LMG 2333 / T. Nilsen, I. F. Nes, H. Holo // Applied and Environmental Microbiology. - 2003. - Vol. 69. - № 5. - P. 2975-2984.

40. Müller, E. Caseicin, a bacteriocin fromLactobacillus casei / E. Müller, F. Radler // Folia Microbiologica. - 1993. - Vol. 38. - № 6. - P. 441-446.

41. Structure, organization, and expression of the lct gene for lacticin 481, a novel lantibiotic produced by Lactococcus lactis / J. C. Piard, O. P. Kuipers, H. S. Rollema [et al.] // Journal of Biological Chemistry. - 1993. - Vol. 268. - № 22. -P. 16361-16368.

42. Nukacin ISK-1, a Bacteriostatic Lantibiotic / S. M. Asaduzzaman, J. Nagao, H. Iida [et al.] // Antimicrobial Agents and Chemotherapy. - 2009. - Vol. 53. - № 8. -P. 3595-3598.

43. Pal, G. Inhibitory effect of plantaricin peptides (Pln E/F and J/K) against Escherichia coli / G. Pal, S. Srivastava // World Journal of Microbiology and Biotechnology. - 2014. - Vol. 30. - № 11. - P. 2829-2837.

44. A class III bacteriocin with broad-spectrum antibacterial activity from Lactobacillus acidophilus NX2-6 and its preservation in milk and cheese / F. Meng, X. Zhu, H. Zhao [et al.] // Food Control. - 2021. - Vol. 121. - P. 107597.

45. Markkanen, E. Not breathing is not an option: How to deal with oxidative DNA damage / E. Markkanen // DNA Repair. - 2017. - Vol. 59. - P. 82-105.

46. Zhao, X. Reactive oxygen species and the bacterial response to lethal stress / X. Zhao, K. Drlica // Current Opinion in Microbiology. - 2014. - Vol. 21. - P. 1-6.

47. Reactive oxygen: A novel antimicrobial mechanism for targeting biofilm-associated infection / M. S. Dryden, J. Cooke, R. J. Salib [et al.] // Journal of Global Antimicrobial Resistance. - 2017. - Vol. 8. - P. 186-191.

48. RONS and Oxidative Stress: An Overview of Basic Concepts / A. K. Aranda-Rivera, A. Cruz-Gregorio, Y. L. Arancibia-Hernández [et al.] // Oxygen. - 2022. - Vol. 2. - № 4. - P. 437-478.

49. Real-time mapping of a hydrogen peroxide concentration profile across a polymicrobial bacterial biofilm using scanning electrochemical microscopy / X. Liu, M. M. Ramsey, X. Chen [et al.] // Proceedings of the National Academy of Sciences. -2011. - Vol. 108. - № 7. - P. 2668-2673.

50. Babior, B. M. Phagocytes and oxidative stress / B. M. Babior // The American Journal of Medicine. - 2000. - Vol. 109. - № 1. - P. 33-44.

51. Manke, A. Mechanisms of Nanoparticle-Induced Oxidative Stress and Toxicity / A. Manke, L. Wang, Y. Rojanasakul // BioMed Research International. - 2013.

- Vol. 2013. - P. 1-15.

52. Strategies to enhance stress tolerance in lactic acid bacteria across diverse stress conditions / A. S. Derunets, A. I. Selimzyanova, S. V. Rykov [et al.] // World Journal of Microbiology and Biotechnology. - 2024. - Vol. 40. - № 4. - P. 126.

53. Aerobic Respiration Metabolism in Lactic Acid Bacteria and Uses in Biotechnology / M. B. Pedersen, P. Gaudu, D. Lechardeur [et al.] // Annual Review of Food Science and Technology. - 2012. - Vol. 3. - № 1. - P. 37-58.

54. Oxygen dependent lactate utilization by Lactobacillus plantarum / M. G. Murphy, L. O'Connor, D. Walsh, S. Condon // Archives of Microbiology. - 1985. -Vol. 141. - № 1. - P. 75-79.

55. High-Level Expression of Heme-Dependent Catalase Gene katA from Lactobacillus Sakei Protects Lactobacillus Rhamnosus from Oxidative Stress / H. An, H. Zhou, Y. Huang [et al.] // Molecular Biotechnology. - 2010. - Vol. 45. - № 2. - P. 155160.

56. Development of high cell density Limosilactobacillus reuteri KUB-AC5 for cell factory using oxidative stress reduction approach / N. Watthanasakphuban, P. Srila, P. Pinmanee [et al.] // Microbial Cell Factories. - 2023. - Vol. 22. - № 1. - P. 86.

57. Imlay, J. A. Where in the world do bacteria experience oxidative stress? / J. A. Imlay // Environmental Microbiology. - 2019. - Vol. 21. - № 2. - P. 521-530.

58. Metal-Based Nanoparticles: Antibacterial Mechanisms and Biomedical Application / D. Franco, G. Calabrese, S. P. P. Guglielmino, S. Conoci // Microorganisms.

- 2022. - Vol. 10. - № 9. - P. 1778.

59. Halkai, K. R. Biosynthesis, Characterization and Antibacterial Efficacy of Silver Nanoparticles Derived from Endophytic Fungi against P. gingivalis / K. R. Halkai // JOURNAL OF CLINICAL AND DIAGNOSTIC RESEARCH. - 2017.

60. Antimicrobial Gold Nanoclusters / K. Zheng, M. I. Setyawati, D. T. Leong, J. Xie // ACS Nano. - 2017. - Vol. 11. - № 7. - P. 6904-6910.

61. Salah, I. Copper as an antimicrobial agent: recent advances / I. Salah, I. P. Parkin, E. Allan // RSC Advances. - 2021. - Vol. 11. - № 30. - P. 18179-18186.

62. Antibacterial Activity of Silver and Gold Particles Formed on Titania Thin Films / M. Sriubas, K. Bockute, P. Palevicius [et al.] // Nanomaterials. - 2022. - Vol. 12.

- № 7. - P. 1190.

63. Injectable hyaluronic acid-based antibacterial hydrogel adorned with biogenically synthesized AgNPs-decorated multi-walled carbon nanotubes / P. Makvandi, M. Ashrafizadeh, M. Ghomi [et al.] // Progress in Biomaterials. - 2021. - Vol. 10. - № 1.

- P. 77-89.

64. In vivo antibacterial and silver-releasing properties of novel thermal sprayed silver-containing hydroxyapatite coating / T. Shimazaki, H. Miyamoto, Y. Ando [et al.] // Journal of Biomedical Materials Research Part B: Applied Biomaterials. - 2010. -Vol. 92B. - № 2. - P. 386-389.

65. S. Harikumar, P. Antibacterial Activity of Copper Nanoparticles and Copper Nanocomposites against Escherichia Coli Bacteria / P. S. Harikumar // International Journal of Sciences. - 2016. - Vol. 2. - № 02. - P. 83-90.

66. One-pot synthesis of monodisperse silver-lignin particles: Enhanced antibacterial agents against antibiotic-resistant bacteria / S.-M. You, D.-G. Kang, J.-H. Choi [et al.] // International Journal of Biological Macromolecules. - 2024. - Vol. 281. -P. 136552.

67. Evaluation of mesoporous CrB particles synthesized via sol-gel method as potential antibacterial interior paint nano-additive / B. Co§kuner Filiz, Y. Basaran Elalmis, M. Altikatoglu Yapaoz, A. Kanturk Figen // Journal of Sol-Gel Science and Technology.

- 2025. - Vol. 113. - № 3. - P. 655-669.

68. Enhanced antibacterial effect of natural tannin stabilized silver nano particles against human pathogens: A target toward FtsZ proteins / I. Biswas, D. Mitra, S. Das [et al.] // Journal of Trace Elements and Minerals. - 2024. - Vol. 10. - P. 100200.

69. A simple and low-cost strategy to develop antibacterial composite film of nanocellulose and stilbite zeolite particles / M. T. Yifira, D. Belete, K. N. Mekonnen [et al.] // Scientific Reports. - 2025. - Vol. 15. - № 1. - P. 32946.

70. Mechano-Bactericidal Surfaces: Mechanisms, Nanofabrication, and Prospects for Food Applications / Y. Cheng, X. Ma, T. Franklin [et al.] // Annual Review of Food Science and Technology. - 2023. - Vol. 14. - № 1. - P. 449-472.

71. Mechano-bactericidal actions of nanostructured surfaces / D. P. Linklater, V. A. Baulin, S. Juodkazis [et al.] // Nature Reviews Microbiology. - 2021. - Vol. 19. -№ 1. - P. 8-22.

72. Mechano-bactericidal anisotropic particles for oral biofilm treatment / L. E. Protasiuk, N. S. Serov, A. V. Lokteva [et al.] // Journal of Materials Chemistry B. - 2022.

- Vol. 10. - № 25. - P. 4867-4877.

73. Langmuir-Blodgett-Mediated Formation of Antibacterial Microneedles for Long-Term Transdermal Drug Delivery / Z. Lu, S. Du, J. Li [et al.] // Advanced Materials.

- 2023. - Vol. 35. - № 38.

74. Fabrication of chitosan-gelatin films incorporated with thymol-loaded alginate microparticles for controlled drug delivery, antibacterial activity and wound healing: In-vitro and in-vivo studies / A. R. Ahmady, K. Razmjooee, S. Saber-Samandari, D. Toghraie // International Journal of Biological Macromolecules. - 2022. - Vol. 223. -P. 567-582.

75. One-pot synthesis of template-free hollow anisotropic CaCO 3 structures: towards inorganic shape-mimicking drug delivery systems / N. Serov, D. Darmoroz, A. Lokteva [et al.] // Chemical Communications. - 2020. - Vol. 56. - № 80. - P. 1196911972.

76. Exploring Oxidative Stress Mechanisms of Nanoparticles Using Zebrafish (Danio rerio): Toxicological and Pharmaceutical Insights / D. Batir-Marin, M. Boev, O. Cioanca [et al.] // Antioxidants. - 2025. - Vol. 14. - № 4. - P. 489.

77. Metal-Based Nanoparticles and Their Relevant Consequences on Cytotoxicity Cascade and Induced Oxidative Stress / Y. Min, G. G. D. Suminda, Y. Heo [et al.] // Antioxidants. - 2023. - Vol. 12. - № 3. - P. 703.

78. Daré, R. G. Nanoparticles with Antioxidant Activity / R. G. Daré, S. O. S. Lautenschlager // Antioxidants. - 2025. - Vol. 14. - № 2. - P. 221.

79. Understanding the interplay between pH and charges for theranostic nanomaterials / V. Ow, Q. Lin, J. H. M. Wong [et al.] // Nanoscale. - 2025. - Vol. 17. -№ 12. - P. 6960-6980.

80. Erofeeva, E. A. Environmental hormesis: From cell to ecosystem / E. A. Erofeeva // Current Opinion in Environmental Science & Health. - 2022. - Vol. 29. -P. 100378.

81. Pullulan Nanoparticles as Prebiotics Enhance the Antibacterial Properties of Lactobacillus plantarum Through the Induction of Mild Stress in Probiotics / L. Hong, W.-S. Kim, S.-M. Lee [et al.] // Frontiers in Microbiology. - 2019. - Vol. 10.

82. Enrichment of zinc in Lactobacillus plantarum DNZ-4: Impact on its characteristics, metabolites and antioxidant activity / Y. Meng, Z. Liang, M. Yi [et al.] // LWT. - 2022. - Vol. 153. - P. 112462.

83. Positive and Negative Effects of Metal Oxide Nanoparticles on Antibiotic Resistance Genes Transfer / G. D. Otinov, A. V. Lokteva, A. D. Petrova [et al.] // Antibiotics. - 2020. - Vol. 9. - № 11. - P. 742.

84. Zotta, T. Aerobic metabolism in the genus Lactobacillus : impact on stress response and potential applications in the food industry / T. Zotta, E. Parente, A. Ricciardi // Journal of Applied Microbiology. - 2017. - Vol. 122. - № 4. - P. 857-869.

85. Size matters - The phototoxicity of TiO2 nanomaterials / A. J. Wyrwoll, P. Lautenschläger, A. Bach [et al.] // Environmental Pollution. - 2016. - Vol. 208. - P. 859867.

86. On Oxygen Activation at Rutile- and Anatase-TiO 2 / M. Buchalska, M. Kobielusz, A. Matuszek [et al.] // ACS Catalysis. - 2015. - Vol. 5. - № 12. - P. 74247431.

87. Li, X. Soft-Template Synthesis of Mesoporous Anatase TiO2 Nanospheres and Its Enhanced Photoactivity / X. Li, M. Zou, Y. Wang // Molecules. - 2017. - Vol. 22. - № 11. - P. 1943.

88. Effect of UV Irradiation and TiO2-Photocatalysis on Airborne Bacteria and Viruses: An Overview / N. Bono, F. Ponti, C. Punta, G. Candiani // Materials. - 2021. -Vol. 14. - № 5. - P. 1075.

89. Hydrogel Thin Film with Swelling-Induced Wrinkling Patterns for High-Throughput Generation of Multicellular Spheroids / Z. Zhao, J. Gu, Y. Zhao [et al.] // Biomacromolecules. - 2014. - Vol. 15. - № 9. - P. 3306-3312.

90. Effect of acid stress on protein expression and phosphorylation in Lactobacillus rhamnosus GG / J. Koponen, K. Laakso, K. Koskenniemi [et al.] // Journal of Proteomics. - 2012. - Vol. 75. - № 4. - P. 1357-1374.

91. H 2 O 2 Production in Species of the Lactobacillus acidophilus Group: a Central Role for a Novel NADH-Dependent Flavin Reductase / R. Hertzberger, J. Arents, H. L. Dekker [et al.] // Applied and Environmental Microbiology. - 2014. - Vol. 80. -№ 7. - P. 2229-2239.

92. An unexpected interaction between a H2O2 molecule and anatase Ti02(101) surface / L. Wang, Q. Wang, F. Ren, Y. Wang // Applied Surface Science. - 2019. -Vol. 493. - P. 926-932.

93. Antimicrobial properties of Lactobacillus cell-free supernatants against multidrug-resistant urogenital pathogens / M. Scillato, A. Spitale, G. Mongelli [et al.] // MicrobiologyOpen. - 2021. - Vol. 10. - № 2.

94. Transcriptional Analysis and Identification of a Peptidoglycan Hydrolase (PGH) and a Ribosomal Protein with Antimicrobial Activity Produced by Lactiplantibacillus paraplantarum / J. J. Hurtado-Rios, U. Carrasco-Navarro, J. C. Almanza-Pérez [et al.] // International Journal of Molecular Sciences. - 2024. - Vol. 25. - № 23. - P. 12650.

95. Evaluation of the probes 2',7'-dichlorofluorescin diacetate, luminol, and lucigenin as indicators of reactive species formation / O. Myhre, J. M. Andersen, H. Aarnes, F. Fonnum // Biochemical Pharmacology. - 2003. - Vol. 65. - № 10. - P. 15751582.

96. Atack, J. M. Contribution of the stereospecific methionine sulphoxide reductases MsrA and MsrB to oxidative and nitrosative stress resistance in the food-borne pathogen Campylobacter jejuni / J. M. Atack, D. J. Kelly // Microbiology. - 2008. -Vol. 154. - № 8. - P. 2219-2230.

97. Bryukhanov, A. L. Antioxidant Properties of Lactic Acid Bacteria / A. L. Bryukhanov, A. I. Klimko, A. I. Netrusov // Microbiology. - 2022. - Vol. 91. - № 5. -P. 463-478.

98. Thioredoxin reductase is a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1 / L. M. Serrano, D. Molenaar, M. Wels [et al.] // Microbial Cell Factories. - 2007. - Vol. 6. - № 1. - P. 29.

99. Adams, M. A. Structural and Biochemical Evidence for an Enzymatic Quinone Redox Cycle in Escherichia coli / M. A. Adams, Z. Jia // Journal of Biological Chemistry. - 2005. - Vol. 280. - № 9. - P. 8358-8363.

100. Identification of a pathway for electron uptake in Shewanella oneidensis / A. R. Rowe, F. Salimijazi, L. Trutschel [et al.] // Communications Biology. - 2021. -Vol. 4. - № 1. - P. 957.

101. Comparative Genomic, Transcriptomic, and Proteomic Analysis of the Limosilactobacillus fermentum U-21 Strain Promising for the Creation of a Pharmabiotic / E. U. Poluektova, D. A. Mavletova, M. V. Odorskaya [et al.] // Russian Journal of Genetics. - 2022. - Vol. 58. - № 9. - P. 1079-1090.

102. Biomarkers and Utility of the Antioxidant Potential of Probiotic Lactobacilli and Bifidobacteria as Representatives of the Human Gut Microbiota / O. V. Averina, E. U. Poluektova, M. V. Marsova, V. N. Danilenko // Biomedicines. - 2021. - Vol. 9. - № 10. - P. 1340.

103. Feng, T. Oxidative stress tolerance and antioxidant capacity of lactic acid bacteria as probiotic: a systematic review / T. Feng, J. Wang // Gut Microbes. - 2020. -Vol. 12. - № 1. - P. 1801944.

104. Factors Contributing to Hydrogen Peroxide Resistance in Streptococcus pneumoniae Include Pyruvate Oxidase (SpxB) and Avoidance of the Toxic Effects of the Fenton Reaction / C. D. Pericone, S. Park, J. A. Imlay, J. N. Weiser // Journal of Bacteriology. - 2003. - Vol. 185. - № 23. - P. 6815-6825.

105. Liu, L. Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus

mutans / L. Liu, H. Tong, X. Dong // Applied and Environmental Microbiology. - 2012.

- Vol. 78. - № 7. - P. 2120-2127.

106. Arnér, E. S. J. Physiological functions of thioredoxin and thioredoxin reductase / E. S. J. Arnér, A. Holmgren // European Journal of Biochemistry. - 2000. -Vol. 267. - № 20. - P. 6102-6109.

107. Galviz, Y. The biological concept of stress revisited: relations of stress and memory of plants as a matter of space-time / Y. Galviz, G. M. Souza, U. Lüttge // Theoretical and Experimental Plant Physiology. - 2022. - Vol. 34. - № 2. - P. 239-264.

108. Peptide and amino acid metabolism is controlled by an OmpR-family response regulator in Lactobacillus casei / C. Alcántara, C. Bauerl, A. Revilla-Guarinos [et al.] // Molecular Microbiology. - 2016. - Vol. 100. - № 1. - P. 25-41.

109. Burn wound infections microbiome and novel approaches using therapeutic microorganisms in burn wound infection control / J. Maitz, J. Merlino, S. Rizzo [et al.] // Advanced Drug Delivery Reviews. - 2023. - Vol. 196. - P. 114769.

110. TiO 2 Photocatalysis Damages Lipids and Proteins in Escherichia coli / G. Carré, E. Hamon, S. Ennahar [et al.] // Applied and Environmental Microbiology. - 2014.

- Vol. 80. - № 8. - P. 2573-2581.

111. Guan, Y. PNIPAM microgels for biomedical applications: from dispersed particles to 3D assemblies / Y. Guan, Y. Zhang // Soft Matter. - 2011. - Vol. 7. - № 14. -P. 6375.

112. Topical Probiotics: More Than a Skin Deep / M. Habeebuddin, R. K. Karnati, P. N. Shiroorkar [et al.] // Pharmaceutics. - 2022. - Vol. 14. - № 3. - P. 557.

113. Increasing lactose concentration is a strategy to improve the proliferation of Lactobacillus helveticus in milk / J. Zang, T. Wang, D. Piotr [et al.] // Food Science & Nutrition. - 2021. - Vol. 9. - № 2. - P. 1050-1060.

114. Analysis of functional properties of Lactobacillus acidophilus / R. Zhao, J. Sun, H. Mo, Y. Zhu // World Journal of Microbiology and Biotechnology. - 2007. -Vol. 23. - № 2. - P. 195-200.

115. Prebiotic effect of galacto-oligosaccharides on the skin microbiota and determination of their diffusion properties / A. Petrov, M. Corovic, A. Milivojevic [et al.] // International Journal of Cosmetic Science. - 2022. - Vol. 44. - № 3. - P. 309-319.

116. The Impacts of Acidophilic Lactic Acid Bacteria on Food and Human Health: A Review of the Current Knowledge / M. A. Icer, S. Özbay, D. Agagündüz [et al.] // Foods. - 2023. - Vol. 12. - № 15. - P. 2965.

117. Biocompatibility Evaluation of TiO2, Fe3O4, and TiO2/Fe3O4 Nanomaterials: Insights into Potential Toxic Effects in Erythrocytes and HepG2 Cells / L. Paramo, A. Jimenez-Chavez, I. E. Medina-Ramirez [et al.] // Nanomaterials. - 2023. -Vol. 13. - № 21. - P. 2824.

118. Toxicology and safety research of poly( N -isopropylacrylamide)-based thermosensitive nanogels / H. Li, H. Sun, Y. Liu [et al.] // Environmental Science: Nano.

- 2023. - Vol. 10. - № 12. - P. 3357-3365.

119. The external microenvironment of healing skin wounds / C. R. Kruse, K. Nuutila, C. C. Y. Lee [et al.] // Wound Repair and Regeneration. - 2015. - Vol. 23. - № 4.

- P. 456-464.

120. Hydrogen Peroxide: A Potential Wound Therapeutic Target / G. Zhu, Q. Wang, S. Lu, Y. Niu // Medical Principles and Practice. - 2017. - Vol. 26. - № 4. - P. 301308.

121. Mechanisms regulating wound healing: Functional changes in biology mediated by lactate and histone lactylation / H. Wu, W. Liang, M. Han [et al.] // Journal of Cellular Physiology. - 2023. - Vol. 238. - № 10. - P. 2243-2252.

122. Lactic acid induces transcriptional repression of macrophage inflammatory response via histone acetylation / W. Shi, T. J. Cassmann, A. V. Bhagwate [et al.] // Cell Reports. - 2024. - Vol. 43. - № 2. - P. 113746.

123. Synergistically enhanced selective intracellular uptake of anticancer drug carrier comprising folic acid-conjugated hydrogels containing magnetite nanoparticles / H. Kim, A. Jo, S. Baek [et al.] // Scientific Reports. - 2017. - Vol. 7. - № 1. - P. 41090.

124. Biohybrid Living Material with Antibacterial and Regenerating Properties Based on Probiotic Bacteria Stress Metabolism Modulation / A. V. Lokteva, K. O. Baskakova, E. R. Gandalipov [et al.] // Macromolecular Bioscience. - 2025. - P. e00452.

125. The concurrent use of probiotic microorganism and collagen hydrogel/scaffold enhances burn wound healing: An in vivo evaluation / A. Oryan, M. Jalili, A. Kamali, B. Nikahval // Burns. - 2018. - Vol. 44. - № 7. - P. 1775-1786.

126. Improved infectious burn wound healing by applying lyophilized particles containing probiotics and prebiotics / F. Hassaninejad Farahani, F. Moraffah, N. Samadi [et al.] // International Journal of Pharmaceutics. - 2023. - Vol. 636. - P. 122800.

127. Novel composite double-layered dressing with improved mechanical properties and wound recovery for thermosensitive drug, Lactobacillus brevis / H. Yu, J. S. Kim, D. W. Kim [et al.] // Composites Part B: Engineering. - 2021. - Vol. 225. -P. 109276.

128. Probiotic active gel promotes diabetic wound healing through continuous local glucose consumption and antioxidant / Y. Wang, L. Shi, J. Lu [et al.] // Journal of Nanobiotechnology. - 2025. - Vol. 23. - № 1. - P. 62.

129. A one-two punch of inflammation and oxidative stress promotes revascularization for diabetic foot ulcers / L. Chen, Y. Li, X. Zhang [et al.] // Materials Today Bio. - 2025. - Vol. 31. - P. 101548.

130. Highly active probiotic hydrogels matrixed on bacterial EPS accelerate wound healing via maintaining stable skin microbiota and reducing inflammation / H. Xu, Y. Li, J. Song [et al.] // Bioactive Materials. - 2024. - Vol. 35. - P. 31-44.

131. Culture-Delivery Live Probiotics Dressing for Accelerated Infected Wound Healing / Y. Sun, M. Liu, X. Tang [et al.] // ACS Applied Materials & Interfaces. - 2023. - Vol. 15. - № 46. - P. 53283-53296.

132. Injectable and Self-Healing Probiotics-Loaded Hydrogel for Promoting Superbacteria-Infected Wound Healing / L. Mei, D. Zhang, H. Shao [et al.] // ACS Applied Materials & Interfaces. - 2022. - Vol. 14. - № 18. - P. 20538-20550.

133. Engineered Probiotic Bio-Heterojunction with Robust Antibiofilm Modality via "Eating" Extracellular Polymeric Substances for Wound Regeneration / M. Qin, X. Zhang, H. Ding [et al.] // Advanced Materials. - 2024. - Vol. 36. - № 35.

134. Living Bacterial Hydrogels for Accelerated Infected Wound Healing / Z. Ming, L. Han, M. Bao [et al.] // Advanced Science. - 2021. - Vol. 8. - № 24.

135. Coaxial electrospun nanofiber accelerates infected wound healing via engineered probiotic biofilm / B. Huang, F. Xiao, Z. Chen [et al.] // International Journal of Biological Macromolecules. - 2024. - Vol. 279. - P. 135100.

ПРИЛОЖЕНИЕ. ТЕКСТЫ ПУБЛИКАЦИЙ

ШГЛВДВД АшотАмт^Лвириг Chemin 2025, И JJ, .Va pp. 1SÛI-1311С P.'sfiodeJUfaAóc lui.. 2625.

Induction of Oxidative Hormeas by TiO> >~n nop articles Enhances Antibacterial Activity of L а с fob aciîî us acid opto tías

A. V. LokmV V. TruslilisJ? О. V Ivankova*, niiíl E. I. Kosbel"

ù Cer\ter for Molecular and Biological TeclmoSogies, IThlO Z'niversit}^ St. Petersburg, Î9Î002 Russia 'e-mail: îoktei'aà itmo.ru; *'e-mail: koshelct itmo.ru

Eeceried J\oe 25.102.V iruhJ My 1.2&25; accepted Jnh14, 2025

Abikict—Objective: The aun of this study was te- investigate the potential induction of o:tiiati\Te bannesLS ir ргоЪзойс LacTobacillu: acidophilus by meta] oiticle nanqpaitLcles. Spec Lai attention was groen to- the effectof iüaELt type: ofnanoparticle: to trigger oitidatroe h «meas. шЗщсюаЬэйш&м :jniLesi: and tbe autibactenal activity oftheьклшagainstnÉileobc-iestLntpathogees. Me-cliod": Tb¿L study employed :oL-gel :nd precipitation methods to LiTitheiiie ташиз meta L oxide nanop articles. iriñch were characterized iba.' the:r pbyhe llllc a ] |ii|h(Íh :jid tested for their effects on Lactobacillus acidophilus growth ТЪе interaction between TiO, дциЫи and Ьдi;treix.11мШ ТЧ1 :■ anjhrzed и:ш2 EDM and hydrogen peroxide assays. while gene e:íp]e::ion related to o^dative Яге:: and bacteiiocin production was- quantified by qRX-PCR- demon :trating enhanced antibacterial activity via oxidative horuiesL:. Result: rmd Di rcu :: ion ¡ Ke:earct ou tbe toxic effect: of metí] oxide nancparticle: (MPs) ha: primarily focused on tbeir negative impact ou bacteiial growth and metabolism. which aie well- doc urne nted. This study de: с tibe: a pos Шуе mdnence of MPs despite piedonrnart data about toxicity and confirms thatTiO-. MPs stimulate minorase ofbacteiiocinsyntbeas "лтаdioxidative hoimesi: induction. Tbe described effectuas reached by TiOn NPs at 15 jjgiuL and r^ulted in a twofold incrsa:e in bacterial cell count1. Oxidative tormesis induction was connnned by enhanced гепе expression as:ociated with зерап mechanisms and reactive origen ^pecLe: neutralization :y stent. Linkage of CKÎdative honiiesis and antibacterial properties was ihtmnby S bacte-Lioan gene: ехрте::юп increasing up to 6 tune:. Thi: data determined see statistic ally significant increase m tbe inhibition zone: of E. coli and S. aureus by 1.5 and 2.6 tones. íe:pectively. Conclutions: The obtained results provide a new approach to manipulating che antibacterial metabolism vfLactobacillus :p. for applications in both biotechnology and cbe development of bLotybrid systems for personah zed antibacterial theiapy

KjejTiordí i hotruesis. bacteriocins. oxidative stras:, rwmnpjrtirli"^ Ijxctobaalhis jp_

DOI: 10.1134/S106B1®025602666

INTRODUCTION

Antibacterial properties of nanoparticles (NPs) are well-known and described. Tte main toxicity mechanism liei in the abiJit}- of adsorption of signaling molecules, cell wall pe^neabilization. and amino and nucleic acid structure destruction -via oxidation by reactive oxy Ben species (E.OS) such as superoxides (Oj). hydiosyl radicals (OH"), and hydrogen peroxide (HjjOj) [1-6]. TTie interest in such studies is described by the use of MPs in food and phannaceutical industries [7-9]. but prospects of MPs in an antibacterial therapy [5,10]. In the last decade a small number of articles about MPs' positive influence on growth and metabolism of separated bacterial species and miirobiota composition

has appeared [11-13]. which differs from accumulated general toxicity data.

The positive influence of toxic agents can be described by the hormesis phenomenon. Hormesis is expressed by an increase in the biochemical parameters of a living organism under moderate doses of stress [14]. We assume that metal oxide MPs can induce this phenomenon in probiotic bacteria. This assumption is based on two factors: the abilitv of KPs to synthesize ROS and the protection mechanisms of bacteria of the genus LaaohaciRuz. zp. from oxygen Or and OH-1.villi their conversion into HjO, molecules. This can otcur due to the electrostatic binding of NPs to the bacterial cell wall providing a tighter contact and activation of redox-sensitive proteins and ABC transporters that can

1B01

Table 1. Study of physico-chemical parameters of synthetized metal oxide NPs in hydrodynamic diameter, zeta-potential, SB and pore size

Sample Hydrodynamic diameter, nm Zeta-potential, mV SBET' m2/g Pore size, nm

ZnO 480 ± 70 +21.3 ± 0.5 35 4

AlOOH 140 ± 20 +40.0 ± 1.4 220 4.1

CuO 530 ± 40 +8.7 ± 0.3 57 3.9

TiO2 20 ± 10 +25.1 ± 1.0 174 7

Fe3O4 70 ± 20 +28.0 ± 1.3 113 9

lead to an increase in the expression of enzyme systems and associated electron carriers. In particular, the pyruvate dehydrogenase complex with NADH+, that is able to convert ROS molecules and oxygen into hydrogen peroxide in Lactobacillus sp. [15]. In contrast to aerobic and facultative anaerobic bacteria, Lactobacillus sp. is able to grow and maintain metabolic activity at micromolar concentrations of hydrogen peroxide produced from oxygen and ROS. These molecules are neutralized in the periplasmic space, allowing its simplified emission as hydrogen peroxide into the environment, thereby minimizing damage to intracellular proteins, enzymes and DNA. Furthermore, in comparison with other bacteria, Lactobacillus sp. uses manganese instead of iron as a metal in cofactors, which increases their oxidation-reduction potential in antioxidant complexes [16].

Based on the described mechanisms of protection against ROS in Lactobacillus sp., it was suggested that metal oxide NPs and ROS in moderate doses can stimulate the oxidative hormesis reaction and lead to increased expression of bacteriocins due to the influence of the stress factor, as shown in other study [17]. L. acidophilus ATCC 4356 as a model strain for studying hydrogen peroxide synthesis in Lactobacillus sp. was selected. In the study metal oxide NPs such as zinc(II) oxide (ZnO), iron(II, III) oxide (Fe3O4), titanium(IV) oxide (TiO2), aluminum hydroxide oxide (AlOOH), and copper(II) oxide (CuO) at concentrations from 15 to 1000 ^g/mL were chosen as an oxidative hormesis trigger. The noticed NPs palette was chosen due to assumed selective toxicity based on research where CuO, ZnO, and Fe3O4 had the most growth inhibitory activity in comparison with TiO2, that characterized their general difference in capability to produce ROS [18] and highlighted TiO2 NPs as a soft modulation compound for oxidative hormesis triggering. The results show selective induction of hormesis by metal oxide NPs, where TiO2 had less toxicity compared to other NPs. Oxidative hormesis induced by TiO2 affected

both oxidative stress and direct and inverse feedback on bacteriocin synthesis, leading to an increase in their expression. Revealed mechanisms cause an increase of L. acidophilus antibacterial properties against antibiotic-resistant pathogen strains.

RESULTS AND DISCUSSIONS

Metal Oxide NPs Influence on L. acidophilus Growth

At first, the ability of NPs to induce oxidative hormesis was studied. For this purpose, NPs were synthesized by the sol-gel method for increasing their stability in solution and with differences in physicochemical parameters (Table 1). Based on the obtained data, CuO NPs exhibited the lowest stability in solution due to the low zeta potential, which can lead to their precipitation. Zeta potential from +20 and above characterized the ability of particles to adsorb on the cell wall due to electrostatic interaction, which increased their cytotoxicity via their capability to disrupt the structure of the cell wall. Additionally, a large difference in the ratio of the hydrodynamic diameter and surface area (SBET) characterized the morphology of these particles as needle-like in CuO and ZnO NPs, which could explain their high cytotoxicity due to bacterial cell wall permeabilization. The ratio of low hydrodynamic radius, large surface area, and pore size might also characterize high toxicity due to the high chemically active surface for the formation of ROS molecules, such as obtained TiO2 and Fe3O4 NPs.

The NPs were cultured in the MRS broth with L. acidophilus for 24 h in static conditions at 37°C. As a result, the most antibacterial effect, with a reduction of bacterial quantity below 25% at a minimum concentration of 15 ^g/mL, was demonstrated by Fe3O4 and CuO NPs (Fig. 1). In contrast, TiO2, ZnO, and AlOOH NPs led to an increase in the bacterial count at the same concentration, but TiO2 NPs had the greatest positive effect on growth,

Fig. 1. Study of L. acidophilus quantity change depending on NPs concentration comparable to the control after 24 h of cultivation.

increasing the value in twofold, when the minimum inhibitory concentration was reached with 1000 ^g/mL.

The described difference in toxicity, despite the supposed negative activity of TiO2 NPs in relation to bacterial growth, may be characterized by the difference in the type of synthesized ROS molecules and the influence of L. acidophilus metabolites on their structure

and chemical activity. For example, the bacterial toxicity of CuO is characterized by a wide range of synthesized ROS, including superoxide molecules, hydroxyl radicals, hydrogen peroxide, and the ability to release Cu2+ ions under acidic conditions, which can freely penetrate the cell wall and lead to the oxidation of nucleic and amino acids [19, 20]. ZnO and Fe3O4 NPs are also capable of synthesizing superoxide molecules, hydroxyl radicals and hydrogen peroxide [21, 22], which explains their high toxicity. The low toxicity of AlOOH and TiO2 is explained by the small amount of ROS in the form of superoxides and hydroxyl radicals, and the generally low chemical activity for the synthesis of ROS in comparison with CuO [23-25].

Based on the obtained data, TiO2 NPs at 15 ^g/mL were selected to study oxidative hormesis induction owing to its stimulating effect.

TiO2NPs Interaction with L. acidophilus

To determine the direct interaction of TiO2 NPs with L. acidophilus and the occurrence of oxidative stress as a factor of hormesis, the determination of NPs adsorption on the surface of the bacterial cell wall and synthesis dynamics of hydrogen peroxide as a product of ROS molecules neutralization was involved.

In the adsorption study by the EDX method TiO2 NPs adsorbtion on the cell walls of L. acidophilus at

Fig. 2. Determination of interaction TiO2 NPs with L. acidophilus by EDX mass fraction analysis of bacterial cell wall (a) and hydrogen peroxide measurement as marker of ROS neutralization (b).

Fig. 3. Changes in the relative transcription levels of genes involved in the oxidative stress response in L. acidophilus following exposure to TiO2 NPs (15 ^g/mL) at different time points (0, 30, 60, 120, and 180 min). The red line is a level of control sample expression.

15 ^g/mL was shown. Their mass fraction in relation to other X-ray-detected elements by electron microscopy was 11.0 ± 1.9% and increased with ascending of concentration to 22.3 ± 1.7% at 1000 ^g/mL NPs (Fig. 2a). The obtained data, as expected, indicated an electrostatic interaction between the studied NPs and L. acidophilus, suggesting direct contact during ROS formation. Furthermore, adding TiO2 NPs at 15 ^g/mL to L. acidophilus resulted in a detectable difference in hydrogen peroxide concentration over a 3-h period compared to the control sample. The amount of hydrogen peroxide increased linearly during the experiment in both samples. By the end of the experiment, the average difference was 11.8 mmol/mL (Fig. 2b).

The obtained data suggests a putative effect of TiO2 NPs on oxidative hormesis formation in L. acidophilus. Therefore, to evaluate the influence of TiO2 NPs on oxidative stress development and its role in triggering bacteriocin production, the study of expression of genes associated with the oxidative stress response and bacteriocin synthesis was obligatory.

Oxidative Stress and Bacteriocin Gene Expression

To investigate the potential role of oxidative stress in triggering responses and its effect on bacteriocin synthesis, the expression of genes related to antioxidant defense and bacteriocin production was analyzed. Genomic analysis ofL. acidophilus ATCC 4356 revealed the presence of genes potentially involved in oxidative stress response mechanisms (Table 2).

For the analysis of gene expression related to oxidative stress and bacteriocin synthesis, quantitative PCR was performed using selected primers (Table 3).

Upon exposure to TiO2 NPs at 15 ^g/mL, a dynamic cellular response to oxidative stress was observed (Fig. 3). As early as 30 min, a moderate upregulation of genes involved in cellular defense against ROS was detected: trxA-1 (1.93 ± 0.19), trxA-3 (1.15 ± 0.14), msrA (1.42 ± 0.29), and trxB-2 (1.16 ± 0.06), indicating the activation of a thioredoxin-dependent antioxidant system. At 60 min, an acute response peak was recorded, with expression levels of trxA-2 rising to 2.24 ± 0.33, trxB-1 to 2.10 ± 0.11, and spxB to 2.46 ± 0.19. Concurrently,

Table 2. Annotated genes involved in oxidative stress mechanisms in L. acidophilus

Product (gene) Gene_ID Function References

Thioredoxin-dependent peroxiredoxin 93289845 Catalyzes the reduction of H2O2 and organic peroxides [26, 27]

(tpx) (EC 1.11.1.24) to water and alcohol using the thioredoxin system. Gene expression is upregulated in the presence of superoxide and redox-active compounds, indicating the enzyme's involvement in the cellular response to superoxide stress

Thioredoxin-1 (trxA-1) 93289354 Involved in the reduction of disulfide bonds in [28, 29]

Thioredoxin-2 (trxA-2) 93290479 proteins, provides antioxidant protection to the cell,

Thioredoxin-3 (trxA-3) 93290962 maintains proteins and enzymes in a reduced state, and participates in nucleic acid synthesis

Thioredoxin-disulfide reductase-1 93290193 Reduces oxidized thioredoxin using NADPH, thereby [29]

(trxB-1) (EC 1.8.1.9) maintaining thioredoxin activity and contributing to

Thioredoxin-disulfide reductase-2 93290965 oxidative stress resistance

(trxB-2) (EC 1.8.1.9)

OsmC family peroxiredoxin (yhfA) 93289497 Catalyzes the reduction of organic hydroperoxides, [30]

(EC 1.11.1.) exhibiting peroxidase activity

Peptide-methionine (S)-S-oxide 93289697 Catalyzes the reduction of oxidized methionine-S- [31]

reductase (msrA) (EC 1.8.4.11) sulfoxide (Met-(S)-SO) back to methionine in proteins, preventing loss of function and misfolding of nascent proteins. Repairs oxidized methionine residues caused by reactive oxygen and nitrogen species (ROS and RNS), thereby maintaining cellular homeostasis and protecting against oxidative damage

Pyruvate oxidase (spxB) (EC 1.2.3.3) 93290892 Catalyzes the oxidative decarboxylation of pyruvate to produce acetyl phosphate, carbon dioxide (CO2), and hydrogen peroxide (H2O2). Participates in aerobic metabolism and helps eliminate molecular oxygen, thereby maintaining intracellular redox balance. The H2O2 produced exerts antimicrobial activity and triggers signaling cascades that regulate the oxidative stress response. spxB expression increases over time upon oxygen exposure, providing protection against oxidative damage and supporting ATP levels [32, 33, 34]

Quinol monooxygenase-1 (ygiN-1) 93289682 Catalyzes the oxidation of menadiol to menadione, [35, 36]

Quinol monooxygenase-2 (ygiN-2) 93290374 preventing the accumulation of unstable semiquinones that can spontaneously oxidize to form superoxide radicals. It reduces reactive oxygen species (ROS) levels by maintaining an efficient quinone redox cycle and preventing electron leakage in the respiratory chain

the expression of trxA-1, trxA-3, spxB decreased to 0.50 ± 0.11, 0.48 ± 0.16 and 0.23 ± 0.06, respectively, which may indicate a functional shift toward other thioredoxin isoforms and their linkage with specific ROS neutralization systems, as was shown with methionine sulfoxide reductase [37] or a redistribution of redox potential. The highest activation of antioxidant genes was

observed at 120 min. tpx expression reached 7.88 ± 0.34, along with increased expression of trxA-1 (2.50 ± 0.55), trxA-3 (2.48 ± 0.33), and trxB-2 (2.96 ± 0.10). A significant increase in ygiN-1 (3.17 ± 0.05) and ygiN-2 (2.89 ± 0.31) expression was detected, suggesting their involvement in the detoxification of secondary stress products. By 180 min, the expression levels of most genes

Table 3. Primer sequences and their characteristics for the target genes

Gene Primer sequences T ^ m Product size, bp Primer length, nt

Quinol monooxygenase-1 ACAGAAATTGGCGTTGGTCT 60.2 98 20

GCTAAAATGTCCTCTTCTTGTGC 60.5 23

Quinol monooxygenase-2 TGCAGAAAATGACCGTAGTGAA 60.5 98 22

GGCCGCTTCCAATGAGTAAA 60.7 20

Peptide-methionine (5)-^-oxide reductase GGCGGTCATACCATTAATCCA 60.1 93 21

CTTGCCTGGATCGTAAGTGAT 60 21

Thioredoxin-dependent peroxiredoxin TTAGTAGGTACTCCGCCAGC 60.8 97 20

TGCCTAGCAAATCAGACTTAGTAAA 60.6 25

Thioredoxin-disulfide reductase-2 AATTATTGGAGCTGGGCCTG 60.1 94 20

GCCATAAACGCCTCGATCAA 60.9 20

Thioredoxin-1 AGATTGCCGTTTCCTTGATCC 60.8 100 21

TGCAACATCAACTGAACCATCA 61 22

Thioredoxin-2 CTTAATTGATTTTTGGGCAACTTGG 60.3 91 25

TTTTACATCTTGACGTTCTTCAGC 60.2 24

Thioredoxin-3 GAAATTTTATCCGTACCAAGTATCGT 60.1 96 26

AACTGTTTCAATTTGTTTGCCATTT 60.1 25

OsmC family peroxiredoxin ATAAAAAGTACGATGCTGGTCCT 60.1 92 23

TTTAGTGATCATTCCTGCTGACA 60.1 23

Pyruvate oxidase GGTAAAGGCGTGGTTGAAGA 60.3 100 20

CCAGGTCAGTTGCTGTTTGA 60.5 20

Thioredoxin-disulfide reductase-1 GATGTGGTTGTAGTGGGTGG 60.4 93 20

ACGACGGTGAATAACAGTTACG 60.9 22

Acidocin J TAACTAAGGTTGTTGGCGGGA 59.1 73 19

AGGTTTTCCCATAGTCCTCTACC 58.9 20

Helveticin J AGCATAAGGGACTGACCAAGG 59.4 72 21

GTGTATGACCAAAGCCGGTC 58.9 20

LSEI_2386 TAACTAAGGTTGTTGGCGGGA 59.3 70 21

AGGTTTTCCCATAGTCCTCTACC 59 23

Enterolysin A TGATTCACTGGCCTTGCCTT 59.9 70 20

AATATAAAGGGTGGGGTGGC 60 21

Enterocin X p-chain AATATAAAGGGTGGGGTGGC 57.2 108 20

CCATCCTCGTTTAAATCCCTT 56 21

Class Ilc Enterocin/a/p Enterocin CGGTACCACGTTTGTTAGGTC 58.9 86 21

TGGGAAATGACGAAACGATTGA 58.6 22

Bacteriocin II class CAGGTTATTGGTGGCCGAAG 58,9 75 20

ACCTGGCATACCATCTGGAC 59.2 20

Bacteriocin Ilc class CAAGAGTCGGAGTTGGTTGG 58.5 88 20

CCACAGCTTACTGCTTTCGT 58.5 20

rplB GACCAACTGGAGCCTTACCT 59 88 20

TTAGGCAAGCGTCCACAATC 58.6 22

gyrB CATCGACATCGGCATCAGTC 58.9 78 20

CGGGATTTGGTGCAGACTTT 58.8 20

Fig. 4. Changes in the relative transcription levels of genes involved in bacteriocin synthesis following exposure to TiO2 NPs (15 ^g/mL) at different time points (0, 30, 60, 120, and 180 min). The red line is a level of control sample expression.

declined to values comparable to the control, reflecting a transition from an active response phase to stabilization of redox homeostasis or adaptive changes.

Concurrent with the oxidative stress response, a significant upregulation of bacteriocin genes expression up to six-fold higher than in the control was observed with a peak at 120 min (Fig. 4). The study analyzed bacterio-cins active against Gram-positive bacteria, including Enterocin X, class Ilc Enterocin, and LSEI_2386 [38, 39], as well as those targeting Gram-negative bacteria, such as Helveticin J, Enterolysin A, and Acidocin J [40, 41].

Correlation analysis of gene expression related to the oxidative stress response (Fig. 5) revealed characteristic patterns of association. Positive correlations between thioredoxin-1, thioredoxin-3, thioredoxin-disulfide re-ductase-2, and peptide-methionine (S)-S-oxide reductase with the most of the bacteriocins studied were observed. In contrast, thioredoxin-2, thioredoxin-disulfide reductase-1, and pyruvate oxidase exhibited negative correlations with bacteriocin expression, resulting in expression levels lower than the control at 60 min of the experiment.

The observed correlations, together with the temporal expression dynamics, suggest that the TiO2 NP-induced oxidative hormesis activates complex molecular pathways that enhance the synthesis of antibacterial peptides.

The Enhancement of Antibacterial Properties of L. acidophilus by Oxidative Hormesis

Based on the obtained data on increased gene expression and the correlation between oxidative stress and bacteriocin synthesis, an in vitro study of the antibacterial activity of L. acidophilus under the influence of TiO2 NPs at 15 ^g/mL was conducted to confirm the enhanced antibacterial potential. The study was performed on pathogenic bacteria E. coli and S. aureus with antibiotic resistance to tylosin, streptomycin, and kanamycin, ampicillin, respectively. The experiment was carried out using agar wells prepared with L. acidophilus and NPs, followed by measurement of inhibition zones after 24 h of cultivation. As a result, statistically significant differences were observed between the control samples of L. acidophilus and L. acidophilus with induced oxidative hormesis, showing an increase in inhibition zone size. For E. coli, the inhibition zone varied from 0.8 ± 0.08 cm

Thioredoxin-dependent peroxiredoxin (tpx) Thioredoxin-1 (trxA-1) Thioredoxin-2 (trxA-2) Thioredoxin-3 (trxA-3) Thioredoxin-disulfide reductase-1 (trxB-1) Thioredoxin-disulfide reductase-2 (trxB-2) OsmC family peroxiredoxin (yhfA) Peptide-methionine (S)-S-oxide reductase (msrA) Pyruvate oxidase (spxB) Quinol monooxygenase-1 (yg/N-1)

02. X

dl I

c lu

Sa

o

s

c lu

o

O

0.7 0.3 0.3 0.2 0.3 0.3 0.4 0.4

0.3 0.8 0.8 0.3 0.8 0.8 0.5 0.5

-0.8 -0.7 -0.7 -0.7 -0.7 -0.7 -0.9 -0.9

0.4 0.9 0.9 0.5 0.9 0.9 0.7 0.7

-0.5 -0.6 -0.6 -0.9 -0.6 -0.6 -0.7 -0.7

0.4 0.9 0.9 0.5 0.9 0.9 0.7 0.7

0.5 0.8 0.8 -0.3 0.8 0.8 0.6 0.6

0.1 0.4 0.4 0.9 0.4 0.4 0.3 0.3

-0.8 -0.7 -0.7 -0.7 -0.7 -0.7 -0.9 -0.9

0 0.3 0.3 0.7 0.3 0.3 0.1 0.1

0.6 0.9 0.9 0.1 0.9 0.9 0.7 0.7

1.0

0.5

-0.5

-1.0

Fig. 5. Spearman correlation analysis of bacteriocin expression association with oxidative stress response genes.

(«50 mm2) to 0.98 ± 0.06 cm («75 mm2), and for S. aureus, from 0.73 ± 0.05 cm («41 mm2) to 1.18 ± 0.16 cm («109 mm2), representing increases of 1.5- and 2.7-fold, respectively (Fig. 6). Such a large difference in the inhibition of the growth between E. coli and S. aureus can be explained by the predominance of bacteriocins with activity against Gram-positive bacteria.

EXPERIMENTAL

Equipment. CFX Connect™ Real-Time PCR Detection System, Photocor EPM/Photocor Compact Z particle size and zeta potential analyzer, Spark™ microplate reader, Tescan Vega 3 scanning electron microscope, NanoDrop spectrophotometer.

Reagents. Titanium(IV) isopropoxide, iron(II) chloride tetrahydrate, iron(III) chloride decahydrate, copper(II) sulfate pentahydrate, zinc nitrate decahydrate, and aluminum isopropoxide (Sigma-Aldrich, St. Louis,

MO, USA). Ammonium solution (25%), sodium hydroxide, sodium chloride (Lenreactiv, Saint Petersburg, Russia). Deionized water was obtained using an Elix Essential 3UV system. Tryptone, yeast extract (Helikon), MRS broth and agar (BD). Myeloperoxidase and o-diani-sidine (Merck). ExtractRNA, MMLV reverse transcriptase, oligo(dT)16, DTT (20 mM), dNTPs (10 mM), 5X first-strand cDNA synthesis buffer, 5X qPCRmix-HS SYBR, primers (Evrogen).

Synthesis of Fe3O4. 2.5 g of FeCl2-4H2O and 5 g of FeCl36H2O were dissolved in 100 mL of deionized water under constant stirring (500 rpm). Then, 12mL of aqueous ammonia solution was added dropwise with stirring at room temperature for 3 min (500 rpm). The particles were magnetically separated and washed with 100 mL of deionized water until neutral pH was reached. Finally, the suspension was sonicated (37 kHz, 110 W) for 120 min under stirring (300 rpm).

Inhibition zones

5-1 * *

£l

L. acidophilus L. acidophilus + Ti02 15 (jg/mL

E. coli K12

S.aureus ATCC 29213

Fig. 6. Change of inhibition zone size within 24 h in control L. acidophilus and L. acidophilus subjected to oxidative hormesis.

Synthesis of ZnO. ZnN0310H20 solution at 0.2 M concentration was heated to 91°C with constant stirring (450 rpm). Then, 2 mL of 1 M NaOH was added until the formation of white precipitate. The precipitate was centrifuged (8000g, 10min) and washed with water and 96% ethanol.

Synthesis of CuO. 0.1 M CuSO45H2O solution was heated to 100°C with stirring (450 rpm). Then, 2 mL of 5 M NaOH was added under vigorous stirring until the solution turned black. The nanoparticles were centrifuged and washed with water and 96% ethanol. The precipitate was resuspended in deionized water to obtain the final CuO solution.

Synthesis of AlOOH. A 4.4% solution of Al(C3H7O)3 (50 mL) was heated to 90°C until a white precipitate formed. Before sonication, the precipitate was incubated at 90°C with stirring (450 rpm) for 15 min to complete nanoparticle formation and to evaporate isopropanol produced during hydrolysis. The resulting suspension was sonicated (37 kHz, 110 W) for 2 h.

Synthesis of TiO2. 100 mL of deionized water was mixed with 0.7 mL of nitric acid solution (>70%) in a 500 mL glass cylinder. The solution was heated to 70°C with vigorous magnetic stirring (1000 rpm). Meanwhile, a mixture of 18 mL titanium isopropoxide and 12 mL isopropyl alcohol was prepared at room temperature. This mixture was added to the heated solution, which was then heated to 80°C and maintained for 1 h under continuous stirring. The solution was then cooled to room temperature and stirred for 96 h until the synthesis was

complete. Particle size continuously decreased until the system reached stabilization.

Nanoparticle characterization. Particle size and zeta potential in colloidal solutions were measured using Photocor EPM/Photocor Compact Z. Surface area, volume, and pore size distribution were analyzed by nitrogen adsorption at 77K using a Quantachrome Nova 1200e. All samples were degassed at 110°C for 4 h prior to analysis.

Nanoparticle antibacterial assay. Overnight culture of L. acidophilus (109 CFU/mL) was centrifuged (5000g, 10 min) and diluted 100-fold in fresh MRS broth. Nanoparticles were added to achieve final concentrations of 15, 250, and 1000 ^g/mL. Cultures were incubated statically at 37°C for 24 h. After incubation, serial 10-fold dilutions were plated on MRS agar for CFU counting after 48 h.

EDX detection. To measure titanium ion content on the surface of L. acidophilus, bacteria were cultured with TiO2 nanoparticles for 24 h as described above. Samples were then lyophilized, coated with gold to reduce measurement interference, and analyzed by scanning electron microscopy (Tescan Vega 3) with an energy dispersive X-ray spectroscopy (EDX) attachment.

Hydrogen peroxide dynamics. 20 ^L of overnight L. acidophilus culture was mixed with 180 ^L MRS broth containing 15 ^g/mL TiO2. Controls included 50 mmol/mL H2O2 solution and MRS medium with the same amount of L. acidophilus. To all samples, o-dianisidine (0.33 mM) and 0.1 U myeloperoxidase were added. H2O2 concentration was measured on a SparkTM microplate reader at 37°C for 3 h (X = 460nm).

Genome annotation. The genome of L. acidophilus ATCC 4356 (NZ_CP139575.1) was annotated using Bakta v1.7. Functional protein categories and genes involved in the oxidative stress response were identified using UniProt and InterPro databases, which included protein domains, signatures, and biological pathways.

RNA extraction. Total RNA was extracted using ExtractRNA (Evrogen, Russia) following the manufacturer's protocol. Briefly, cell suspensions were lysed, followed by chloroform extraction, isopropanol precipitation, and 80% ethanol wash. The RNA pellet was dissolved in nuclease-free water, and RNA purity and concentration were assessed spectrophotometrically (NanoDrop, Thermo Fisher Scientific, USA).

RT-PCR. cDNA was synthesized from 2 ^g total RNA using MMLV reverse transcriptase. RNA was mixed with 1 ^L 20 mM oligo (dT)16 and brought to 9 ^L with water, incubated at 70 °C for 5 min, then chilled on ice. Subsequently, 3 ^L water, 2 ^L 20 mM DTT, 1 ^L 10 mM dNTP, 4 ^L 5X first-strand buffer, and 1 ^L MMLV were added. Incubations were at 25°C for 10 min, 42°C for 60 min, and 70°C for 10 min,

Quantitative real-time PCR (qRT-PCR) was performed using the intercalating dye SYBR Green. Reactions were performed in 25 ^L volumes containing 5 ^L 5X qPCRmix-HS SYBR (Evrogen), 1 ^L of primer mix (Table 2), 1 ^L of cDNA, and 18 ^L of water. Amplification was performed using the CFX Connect™ Real-Time PCR Detection System with three biological replicates. The reference genes were rplB and gyrB.

Expression analysis. Relative gene expression was calculated using 2-AACt method, where:

The relative expression level of the control sample was set to 1.

Antibacterial activity assay. Overnight cultures of L. acidophilus, E. coli, and S. aureus were prepared in advance. Wells with a diameter of 5 mm were punched in 9-cm Petri dishes containing LB agar. 1mL of the L. acidophilus overnight culture was washed by cen-trifugation (5000g, 10 min), and the culture medium was replaced with 1mL of physiological saline. A 20-fold concentrated suspension of TiO2 nanoparticles was added to the bacterial suspension to obtain a final concentration of 15 ^g/mL. Aliquots of 30 ^L of this mixture were added to the wells. The overnight cultures of pathogenic strains were diluted to OD600 = 0.1 and 100 ^L of the diluted culture were spread over the surface of each plate. The plates were incubated at 37°C for 24 h, after which the inhibition zones were measured.

Statistical analysis. Data were processed using GraphPad Prism 10. Chemical synthesis and characterization experiments were performed at least three times. In vitro assays were conducted in three biological replicates with three technical repeats. Results are presented as mean ± standard deviation (SD). Differences between groups were considered statistically significant at p < 0.05 to p < 0.0005 using two-way ANOVA and t-test for in vitro experiments. Spearman's correlation

analysis was used to detect nonlinear dependencies in gene expression.

CONCLUSIONS

This study demonstrates that oxidative hormesis induced by TiO2 NPs affects the antibacterial activity of L. acidophilus. The ascending stimulatory effect on L. acidophilus growth provoked by TiO2 NPs at 15 ^g/mL was demonstrated, resulting in a twofold increase in bacterial count in comparison with the control. Adsorption of TiO2 NPs on the surface of the L. acidophilus cell wall and the increase in hydrogen peroxide production by 11.8 mmol/mL, as a marker of oxidative stress, was also demonstrated. It was shown that the expression dynamics of oxidative stress-related genes both directly and inversely correlated with the dynamics of bacteriocin genes, resulting in upregulation of all studied bacteriocins, with their expression increasing up to sixfold. The obtained data on bacteriocins were validated by an antibacterial activity assay, which demonstrates increased inhibition zones of Gram-positive and Gram-negative pathogens with antibiotic resistance E. coli by 1.5-fold and S. aureus by 2.6-fold.

For the first time in this study, oxidative hormesis provoked by TiO2 NPs and its influence on the L. acidophilus antibacterial activity induction with the described mechanism. The obtained data demonstrates the approach to enhance the antibacterial potential of bacteria belonging to the genus Lactobacillus sp that can be applied in biotechnology or biohybrid systems development as a new strategy for bacterial metabolism modulation.

FUNDING

Elena Koshel was supported by Ministry of science and higher education of the Russian Federation no. FSER-2025-0019

CONFLICT OF INTEREST

The authors declare that they have no conflicts of interest.

AUTHOR CONTRIBUTION

All authors contributed to the writing of the article.

DATA AVAILABILITY

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

1. Sengul, A.B. and Asmatulu, E., Environ. Chem. Lett., 2020, vol. 18, no. 5, pp. 1659-1683. https://doi.org/10.1007/s10311-020-01033-6

2. Sirelkhatim, A., Mahmud, S., Seeni, A., Kaus, N.H.M., Ann, L.C., Bakhori, S.K.M., Hasan, H., and Mohamad, D., Nano-Micro Lett., 2015, vol. 7, no. 3, pp. 219-242. https://doi.org/10.1007/s40820-015-0040-x

3. Wang, W., Yu, Z., Lin, M., and Mustapha, A., Int. J. Biol. Macromol., 2023, vol. 241, Art ID: 124705. https://doi.org/10.1016/jijbiomac.2023.124705

4. Min, Y., Suminda, G.G.D., Heo, Y., Kim, M., Ghosh, M., and Son, Y.-O., Antioxidants, 2023, vol. 12, no. 3, p. 703.

https://doi.org/10.3390/antiox12030703

5. Manke, A., Wang, L., and Rojanasakul, Y., BioMed Res. Int., 2013, vol. 2013, pp. 1-15. https://doi.org/10.1155/2013/942916

6. Shkodenko, L., Kassirov, I., and Koshel, E., Microorganisms, 2020, vol. 8, no. 10, Art ID: 1545. https://doi.org/10.3390/microorganisms8101545

7. Llorens, A., Lloret, E., Picouet, P.A., Trbojevich, R., and Fernandez, A., Trends Food Sci. Technol., 2012, vol. 24, no. 1, pp. 19-29. https://doi.org/10.1016/j.tifs.2011.10.001

8. Couto, C. and Almeida, A., Foods, 2022, vol. 11, no. 3, Art ID: 402.

https://doi.org/10.3390/foods11030402

9. Hancock, B., Harris, D., Kaye, J., Meehan, L., Mel-nick, J., Tobyn, M., Gibbard, B., Grou, J., Guarino, C.T., Halota, M., Howard, M., Marshall, C.L., Varghese, S., Khaled, H., and Butterworth, P., J. Pharm. Sci., 2024, vol. 113, no. 5, pp. 1285-1298. https://doi.org/10.1016Zj.xphs.2023.12.006

10. Rumyantceva, V., Rumyantceva, V., Koshel, E., and Vinogradov, V., Ther. Deliv., 2019, vol. 10, no. 4, pp. 241-250.

11. Radziwill-Bienkowska, J.M., Talbot, P., Kam-phuis, J.B.J., Robert, V., Cartier, C., Fourquaux, I., Lentzen, E., Audinot, J.-N., Jamme, F., Réfrégiers, M., Bardowski, J.K., Langella, P., Kowalczyk, M., Houdeau, E., Thomas, M., and Mercier-Bonin, M., Front. Microbiol., 2018, vol. 9, Art. ID: 794. https://doi.org/10.3389/fmicb.2018.00794

12. Otinov, G.D., Lokteva, A.V., Petrova, A.D., Zinchen-ko, I.V., Isauva, M.V., Kovtunov, E.A., and Koshel, E.I., Antibiotics, 2020, vol. 9, no. 11, Art ID: 742. https://doi.org/10.3390/antibiotics9110742

13. Evariste, L., Lamas, B., Ellero-Simatos, S., Khoury, L., Cartier, C., Gaultier, E., Chassaing, B., Feltin, N., Devoille, L., Favre, G., Audebert, M., and Houdeau, E., Part. Fibre Toxicol., 2023, vol. 20, no. 1, Art ID: 27. https://doi.org/10.1186/s12989-023-00539-5

14. Erofeeva, E.A., Curr. Opin. Environ. Sci. Health, 2022, vol. 29, Art ID: 100378. https://doi.org/10.1016Zj.coesh.2022.100378

15. Hertzberger, R., Arents, J., Dekker, H.L., Pridmore, R.D., Gysler, C., Kleerebezem, M., and Teixeira de Mattos, M.J., Appl. Environ. Microbiol., 2014, vol. 80, no. 7, pp. 2229-2239.

https://doi.org/10.1128/AEM.04272-13

16. ImLay, J.A., Environ. Microbiol., 2019, vol. 21, no. 2, pp. 521-530.

https://doi.org/10.1111/1462-2920.14445

17. Kang, J., Zhou, X., Zhang, W., Pei, F., and Ge, J., LWT, 2022, vol. 154, Art ID: 112897. https://doi.org/10.1016/j.lwt.2021.112897

18. Aruoja, V., Pokhrel, S., Sihtmäe, M., Mortimer, M., Mädler, L., and Kahru, A., Environ. Sci.: Nano, 2015, vol. 2, no. 6, pp. 630-644. https://doi.org/10.1039/C5EN00057B

19. Krishnaiah, D., Khiari, M., Klibet, F., and Kechrid, Z., Toxicology, Elsevier, 2021, pp. 107-117. https://doi.org/10.1016/B978-0-12-819092-0.00012-1

20. Moschini, E., Colombo, G., Chirico, G., Capitani, G., Dalle-Donne, I., and Mantecca, P., Sci. Rep., 2023, vol. 13, no. 1, Art ID: 2326. https://doi.org/10.1038/s41598-023-28958-6

21. Lallo da Silva, B., Abuçafy, M.P., Manaia, E.B., Oshiro Junior, J.A., Chiari-Andréo, B.G., Pietro, R.C.L.R., and Chiavacci, L.A., Int. J. Nanomed., 2019, vol. 14, pp. 9395-9410.

https://doi.org/10.2147/IJN.S216204

22. Wang, Y., Qin, N., Chen, S., Zhao, J., and Yang, X., Front. Biol., 2013, vol. 8, no. 5, pp. 549-555. https://doi.org/10.1007/sll515-013-1277-8

23. Sun, B., Ji, Z., Liao, Y.-P., Wang, M., Wang, X., Dong, J., Chang, C.H., Li, R., Zhang, H., Nel, A.E., and Xia, T., ACSNano, 2013, vol. 7, no. 12, pp. 10834-10849. https://doi.org/10.1021/nn404211j

24. Li, M., Yin, J.-J., Wamer, W.G., and Lo, Y.M., J. Food Drug Anal., 2014, vol. 22, no. 1, pp. 76-85. https://doi.org/10.1016/jjfda.2014.01.006

25. Moschini, E., Gualtieri, M., Colombo, M., Fascio, U., Camatini, M., and Mantecca, P., Toxicol. Lett., 2013, vol. 222, no. 2, pp. 102-116. https://doi.org/10.1016Zj.toxlet.2013.07.019

26. Averina, O.V., Poluektova, E.U., Marsova, M.V., and Danilenko, V.N., Biomedicines, 2021, vol. 9, Art ID: 1340.

https://doi.org/10.3390/biomedicines9101340

27. Somprasong, N., Jittawuttipoka, T., Duang-nkern, J., Romsang, A., Chaiyen, P., Schweizer, H.P., Vattanavi-boon, P., and Mongkolsuk, S., J. Bacteriol., 2012, vol. 194, pp. 3904-3912

https://doi.org/10.1128/jb.00347-12

28. Bryukhanov, A.L., Klimko, A.I., and Netrusov, A.I., Microbiology, 2022, vol. 91, pp. 463-478. https://doi.org/10.1134/S0026261722601439

29. Serrano, L.M., Molenaar, D., Wels, M., Teusink, B., Bron, P.A., de Vos, W.M., and Smid, E.J., Microb. Cell Fact., 2007, vol. 6, no. 1, Art ID: 29. https://doi.org/10.1186/1475-2859-6-29

30. Poluektova, E.U., Mavletova, D.A., Odorskaya, M.V., Marsova, M.V., Klimina, K.M., Koshenko, T.A., Yunes, R.A., and Danilenko, V.N., Russ. J. Genet., 2022, vol. 58, pp. 1079-1090. https://doi.org/10.1134/S1022795422090125

31. Atack, J.M. and Kelly, D.J., Microbiology, 2008, vol. 154, no. 8, pp. 2219-2230. https://doi.org/10.1099/mic.0.2008/019711-0

32. Feng, T. and Wang, J., Gut Microbes, 2020, vol. 12, no. 1, Art. ID: 1801944.

https://doi.org/10.1080/19490976.2020.1801944

33. Pericone, C.D., Park, S., ImLay, J.A., and Weiser, J.N., J. Bacteriol., 2003, vol. 185, no. 23, pp. 6815-6825. https://doi.org/10.1128/jb.185.23.6815-6825.2003

34. Liu, L., Tong, H., and Dong, X., Appl. Environ. Microbiol., 2012, vol. 78, no. 7, pp. 2120-2127. https://doi.org/10.1128/aem.07539-11

35. Adams, M.A. and Jia, Z., J. Biol. Chem., 2004, vol. 280, no. 9, pp. 8358-8363. https://doi.org/10.1074/jbc.M412637200

36. Rowe, A.R., Salimijazi, F., Trutschel, L., Sackett, J., Adesina, O., Anzai, I., Kugelmass, L.H., Baym, M.H., and Barstow, B., Commun. Biol., 2021, vol. 4, Art. ID: 957. https://doi.org/10.1038/s42003-021-02454-x

37. Arner, E.S.J. and Holmgren, A., Eur. J. Biochem., 2000, vol. 267, no. 20, pp. 6102-6109. https://doi.org/10.1046/j.1432-1327.2000.01701.x

38. Hu, C.-B., Malaphan, W., Zendo, T., Nakayama, J., and Sonomoto, K., Appl. Environ. Microbiol., 2010, vol. 76, no. 13, pp. 4542-4545. https://doi.org/10.1128/aem.02264-09

39. Kuo, Y.C., Liu, C.F., Lin, J.F., Li, A.C., Lo, T.C., and Lin, T.H., Appl. Microbiol. Biotechnol., 2013, vol. 97, pp. 237-246.

https://doi.org/10.1007/s00253-012-4149-2

40. Kumariya, R., Garsa, A.K., Rajput, Y.S., Sood, S.K., Akhtar, N., and Patel, S., Microb. Pathog., 2019, vol. 128, pp. 171-177.

https://doi.org/10.1016/j.micpath.2019.01.002

41. Antoshina, D.V., Balandin, S.V., Finkina, E.I., Bog-danov, I.V., Eremchuk, S.I., Kononova, D.V., Kovrizhnykh, A.A., and Ovchinnikova, T.V., Int. J. Mol. Sci., 2024, vol. 25, Art. ID: 10059. https://doi.org/10.3390/ijms251810059

Publisher's Note. Pleiades Publishing remains neutral with

regard to jurisdictional claims in published maps and institutional affiliations.

AI tools may have been used in the translation or editing of

this article.

H) Check for updates

Macromolecular Bioscience 157

-Em}:

acro-olecular

Bioscience

www.mbs-journal.de

| RESEARCH ARTICLE

Biohybrid Living Material with Antibacterial and Regenerating Properties Based on Probiotic Bacteria Stress

Metabolism Modulation

Alina V. Lokteva© I Kristina O. Baskakova > I Erik R. Gandalipov D I Nikita S. Serov D I Mariia A. Mikhailova E> I Elena I. Koshel ©

Center for Molecular and Biological Technologies, Megafaculty of Life Science, ITMO University, Saint-Petersburg, Russia Correspondence: Alina V. Lokteva (lokteva@itmo.ru) I Elena I. Koshel (koshel@itmo.ru) Received: 15 August 2025

Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания. В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.