Анализ структурно-функциональных особенностей РНК-полимеразы термофильной бактерии Thermus Aquaticus тема диссертации и автореферата по ВАК РФ 03.01.03, кандидат биологических наук Миропольская, Наталия Александровна
- Специальность ВАК РФ03.01.03
- Количество страниц 138
Оглавление диссертации кандидат биологических наук Миропольская, Наталия Александровна
СПИСОК ИСПОЛЬЗУЕМЫХ СОКРАЩЕНИЙ.
ВВЕДЕНИЕ.
ОБЗОР ЛИТЕРАТУРЫ.
I. Основные механизмы инициации и элонгации транскрипции бактериальной РНКП.
1. Механизм инициации транскрипции.
2. Механизм синтеза РНК на стадии элонгации транскрипции.
2.1. Структура эло/рационного комплекса.
2.2. Реакции, катализируемые РНКП.
2.3. Механизм присоединения NTP в активном центре РНКП.
2.4. Механизм транслокации РНКП.
3. Действие антибиотиков на каталитический цикл РНКП.
3.1. Стрептолидигин.
3.2. а-Аманитин.
Рекомендованный список диссертаций по специальности «Молекулярная биология», 03.01.03 шифр ВАК
Сравнительное исследование взаимодействий РНК-полимераз термофильных и мезофильных бактерий с нуклеиновыми кислотами2002 год, кандидат биологических наук Кульбачинский, Андрей Владимирович
Функции σ-субъединиц РНК-полимераз Escherichia coli и Thermus aquaticus на разных стадиях транскрипции2012 год, кандидат биологических наук Жилина, Екатерина Владимировна
Исследование функциональной роли специфических и неспецифических взаимодействий РНК-полимеразы Escherichia coli с ДНК на разных стадиях транскрипции2010 год, кандидат биологических наук Пупов, Данил Владимирович
Механизмы инициации транскрипции у мезофильных и термофильных бактерий2009 год, доктор биологических наук Кульбачинский, Андрей Владимирович
Особенности реакции расщепления РНК и регуляции активности у РНК-полимераз Deinococcus radiodurans, Thermus aquaticus и Thermus thermophilus2013 год, кандидат наук Есюнина, Дарья Михайловна
Введение диссертации (часть автореферата) на тему «Анализ структурно-функциональных особенностей РНК-полимеразы термофильной бактерии Thermus Aquaticus»
Актуальность проблемы
Транскрипция - один из ключевых процессов, лежащих в основе экспрессии генетического материала. Транскрипция генов в клетках всех организмов осуществляется многосубъединичными РНК-полимеразами (РНКП). Основные механизмы транскрипции и общая структура РНКП высоко консервативны в эволюции. Бактериальная РНКП, имеющая наиболее простое строение, является удобной моделью для изучения фундаментальных механизмов транскрипции и ее регуляции. РНКП способна синтезировать РНК длиной до нескольких десятков тысяч нуклеотидов с очень высокой точностью и процессивпостыо, что обеспечивается сложными структурными перестройками фермента в процессе транскрипции. Активность РНКП на разных стадиях транскрипции регулируется самыми разнообразными факторами: белками, некодирующими РНК, низкомолекулярными соединениями и метаболитами, антибиотиками. Большинство регуляторов транскрипции действуют либо на стадии инициации транскрипции, влияя на взаимодействие РНКП с промоторами, либо непосредственно на каталитическую активность РНКП. Расшифровка детальных механизмов различных стадий транскрипции, в том числе, анализ взаимодействий РНКП с промоторами, регуляторными сигналами в ДНК и РНК, транскрипционными факторами, а также изучение механизмов катализа в активном центре РНКП, является одной из важнейших проблем современной молекулярной биологии и необходима для понимания основных механизмов регуляции генной экспрессии.
Транскрипция включает три основные стадии: инициацию, элонгацию и терминацию. Инициация происходит в специфических участках ДНК - промоторах, и является одной из основных мишеней генетической регуляции. В процессе инициации РНКП узнает промотор и плавит промоторную ДНК в точке инициации, после чего начинает синтез РНК de novo, без использования затравки. У бактерий все стадии инициации осуществляются холоферментом РНКП, состоящим из кор-фермента (субъединичный состав агРР'со) и фактора инициации — ст-субъединицы, которая диссоциирует при переходе к элонгации. Элонгация и терминация транскрипции осуществляются кор-ферментом РНКП. Сигма-субъединица играет основную роль в узнавании промоторов и плавлении ДНК в районе стартовой точки транскрипции, а также непосредственно участвует в инициации синтеза РНК и уходе РНКП с промотора. Имеются данные, указывающие на то, что кор-фермент РНКП также может участвовать в специфическом узнавании промоторов, но детально его роль в этом процессе пс исследовалась.
Понимание молекулярных механизмов катализа РНКП стало возможным в последние годы в связи с успехами в расшифровке трехмерной структуры РНКП термофильных бактерий (Thermus aquaticus и Thermus thermophilus) и РНКП II Saccharomyces cerevisiae, а также структуры элонгационных комплексов этих РНКП в различных состояниях. Активный центр РНКП имеет очень консервативную структуру и содержит два иона магния, координирующие реакционные группы, а также дополнительные структурные элементы, обеспечивающие связывание и правильную ориентацию субстратов реакции. На основе полученных данных была предложена модель присоединения нуклеотидов в активном центре РНКП, которая позволяет предположить возможную роль различных структурных элементов в катализе и может служить основой для детального структурно-функционального анализа активного центра РНКП.
Следует подчеркнуть, что до настоящего времени подавляющее большинство исследований механизмов инициации транскрипции и каталитических механизмов РНКП были проведены на примере РНКП мезофильной бактерии Escherichia coli. В то же время, было обнаружено, что РНКП других бактерий, в частности термофильных бактерий Т. aquaticus и Т. thermophilus, могут проявлять значительные отличия в механизмах узнавания промоторов, инициации транскрипции и в каталитических свойствах (Xue et al., 2000; Minakhin et al., 2001; Kulbachinskiy et al., 2004). РНКП термофильных бактерий являются исключительно интересной моделью для изучения различных стадий транскрипции, поскольку, при сохранении консервативного механизма транскрипции, они обладают особенностями, связанными с адаптацией к высоким температурам. РНКП термофильных бактерий имеют более «жесткую» структуру и сниженную конформационную подвижность, что обеспечивает их термостабильность. Сравнение транскрипционных свойств РНКП термофильных и мезофильных бактерий дает уникальную возможность для поиска функционально-важных участков РНКП, задействованных в узнавании промоторов и в катализе и ответственных за адаптивные различия в свойствах РНКП разных бактерий. РНКП Т. aquaticus является наиболее интересной модельной РНКП, так как для этой РНКП известна трехмерная структура высокого разрешения.
Кроме несомненной научной ценности, исследование детального механизма инициации транскрипции и механизмов катализа в активном центре РНКП имеет также большое практическое значение. В частности, анализ механизма транскрипции прокариот необходим для разработки новых методов регуляции активности бактериальной РНКП, которые могут найти широкое применение в биотехнологии, а также для получения новых ингибиторов РНКП, которые могут иметь большое значение для медицины.
Цели и задачи исследования
Целью данной работы являлся анализ особенностей узнавания промоторов и катализа РНКП термофильной бактерии Т. aquaticus по сравнению с РНКП мезофильных бактерий Е. coli и Deinococcus radiodurans. Для достижения данной цели были поставлены следующие задачи:
1. Изучить механизм узнавания нового промоторного элемента GGGA РНКП Т. aquaticus. Сравнить роль этого элемента в инициации транскрипции РНКП Т. aquaticus и Е. coli.
2. Сравнить каталитические свойства РНКП Т. aquaticus и D. radiodurans и охарактеризовать структурные элементы активного центра РНКП, участвующие в катализе и обеспечивающие функциональные различия между этими РНКП.
ОБЗОР ЛИТЕРАТУРЫ
I. Основные механизмы инициации и элонгации транскрипции бактериальной РНКП
РНКП является одним из ключевых ферментов, участвующих в экспрессии генов. За примерно 50 лет, прошедших с момента открытия РНКП, были достаточно подробно исследованы механизмы основных стадий транскрипции, идентифицированы многие функционально-важные районы РНКП, изучены генетические и биохимические эффекты мутаций в различных субъединицах фермента. Настоящий прорыв в исследованиях структурно-функциональной организации РНКП произошел в самые последние годы, в связи с расшифровкой трехмерных структур РНКП термофильных бактерий Т. aquaticus и Т. thermophilus и РНКП II дрожжей S. cerevisiae. В частности, были расшифрованы структуры кор-фермента РНКП Т. aquaticus (Zhang et al., 1999), ст-субъединицы РНКП Е. coli и Т. aquaticus (Campbell et al., 2002; Malhotra et al., 1996), холоферментов РНКП Т. aquaticus и Т. thermophilus (Murakami et al., 2002a; Murakami et al., 2002b; Vassylyev et al., 2002), РНКП II дрожжей S. cerevisiae (Cramer et al., 2001), элонгационного комплекса (ЭК) РНКП Т. thermophilus и S. cerevisiae (Gnatt et al., 2001; Vassylyev et al., 2007a; Vassylyev et al., 2007b), а также структуры комплексов РНКП с ингибиторами: миксопиронином (Belogurov et al., 2009; Mukhopadhyay et al., 2008), стрептолидигином (Temiakov et al., 2005; Tuske et al., 2005), а-аманитином (Brueckner and Cramer, 2008; Bushnell et al., 2002), тагетитоксином (Vassylyev et al., 2005), рифампицином (Artsimovitch et al., 2005; Campbell et al., 2001), сорангицином (Campbell et al., 2005). Кроме того, были расшифрованы структуры целого ряда транскрипционных факторов, непосредственно регулирующих работу активного центра РНКП: Gre-факторов (Vassylyeva et al., 2007), белков DksA (Perederina et al., 2004), Gfhl (Lamour et al., 2006; Laptenko et al., 2006; Symersky et al., 2006), Rnk (Lamour et al., 2008). Анализ полученной информации позволил создать модели транскрипционных комплексов на разных стадиях синтеза РНК, предложить основные принципы работы активного центра РНКП и возможные механизмы регуляции транскрипции различными факторами. Первая часть данного обзора посвящена краткому анализу известных на сегодняшний день данных о механизмах инициации, элонгации транскрипции и о структуре активного центра бактериальной РНКП.
Похожие диссертационные работы по специальности «Молекулярная биология», 03.01.03 шифр ВАК
Структурно-функциональные исследования взаимодействий ДНК-зависимой РНК-полимеразы бактерий с промоторами2006 год, доктор биологических наук в форме науч. доклада Северинов, Константин Викторович
Структурная организация функционально активных комплексов РНК полимеразы E. coli с факторами транскрипции GreA и GreB. Идентификация и анализ промоторных мишеней для GreA E. coli и Gfh1 T. thermophilus2009 год, кандидат биологических наук Озерова, Мария Владимировна
Роль специфических контактов РНК-полимеразы Escherichia coli с ДНК в формировании транскрипционных пауз2017 год, кандидат наук Петушков, Иван Владимирович
Изучение клеточной функции транскрипционного фактора E. coli GreA2009 год, кандидат биологических наук Степанова, Екатерина Викторовна
Молекулярный механизм реакций расщепления и элонгации РНК-транскрипта, катализируемых ДНК-зависимой РНК-полимеразой E. coli2004 год, кандидат биологических наук Сосунова, Екатерина Владимировна
Заключение диссертации по теме «Молекулярная биология», Миропольская, Наталия Александровна
выводы
1. Промоторный элемент GGGA стимулирует узнавание природных и синтетических промоторов РНКП Т. aquaticus. GGGA-элемент способствует плавлению промоторов и увеличивает стабильность промоторных комплексов РНКП.
2. РНКП Т. aquaticus узнает промоторы, содержащие GGGA-элемент, с большей эффективностью, чем РНКП Е. coli. Эти различия не связаны с различиями в специфичности узнавания GGGA-элемента ст-субъединицами Т. aquaticus и Е. coli, а определяются особенностями структуры кор-фермента РНКП Т. aquaticus.
3. РНКП Т. aquaticus характеризуется резко сниженной скоростью синтеза РНК при умеренных и низких температурах по сравнению с РНКП D. radiodurans. Эти различия определяются особенностями структуры нескольких участков активного центра РНКП Т. aquaticus, в том числе, F-спирали, F-петли и "jaw''-домена Р'-субъединицы.
4. F-петля, расположенная в активном центре РНКП, стимулирует присоединение нуклеотидов, способствуя формированию закрытой конформации активного центра в процессе катализа. F-петля участвует в дискриминации субстратов в активном центре РНКП. F-петля не участвует в реакции расщепления РНК.
Последовательности промоторов, использованных в работе
Показаны последовательности центральной части промоторов, включая участки отжига праймеров, использованных для амплификации промоторных фрагментов. Праймеры показаны под последовательностями соответствующих промоторов; в составе праймеров подчеркнуты последовательности рестриктных сайтов EcoRL и Hindlll. -10, -35, TG и GGGA элементы в составе промоторов показаны красным, голубым, зеленым и желтым цветами, соответственно. Стартовая точка транскрипции показана серым.
Т7А1 и его производные
Т7А1 gaaaat Т ТAT CAAAAAGAGTAl
T7A1GGGA GAAAATTTATCAAAAAGAGTAl t7aiccct gaaaatttatcaaaaagagtaI TAAAGTCTAACCTATAGj з АШ T AAAG TCTAAC С TAT AG; ^J^AAAGTCTAACCTATAG tacagccatcgagagggacacggcgaatag gggagccatcgagagggacacggcgaatag ccctgccatcgagagggacacggcgaatag
T7A11RI T7AlrHindIII
AGTGAATTCTATTTGGATCCAGATCCCGAAAArrrATCAAAAAGAG CGAAGCTTCCCCGGTGTCGATTGGGATGGCrATrCGCCGrGTCCC galPl ^^^ ccactaatttattccatgtcacacttttcgcatcttttttahck^^tatttcataccataagcctaatggagcgaa galPllRI galPl rHindlll
AGTGAATTCATTCTTGTGTAAACGATTCCACTAArrrArrCCATGr CCGAAGCTTCGGTAACCAGAACTCTCATAATrCGCrCCArrAGGCr
XPR
CGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGBBBATTTTACCTCTGGCGGTC
TATGGAAGAGGCGGTAGCGTGCGTTTTTCGATCTTCC
EGGTTGCATGTAGTAAGGAGGTTG
XPRleft XPRright
CGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTG GGCTTTCTCATGCGTTCATGCACCACTGGAAGATCGAAAAACG dnaK dnaK dnaKGGGA dnaK-35 tcatactcaactcc tcatactcaactcc
TGA<
TGCGGCATGTGCGT1 TGCGGCATGTGCGT^
GGGAGGCGAGGTGAAGACGTATGGCCAAGGCAGT TACTCGCGAGGTGAAGACGTATGGCCAAGGCAGT
TCATACTCAACTCCCGGTCACAAAATGCGGCATGTGCGTTAGCCTGGGAGGCGAGGTGAAGACGTATGGCCAAGGCAGT dnaK-35GGGA TCATACTCAACTCCC GGTCACAAAATGCGGCATGTGCGTTAGCCT|IACTGGCgAGGTGAAGACGTATGGCCAAGGCAGT dnaKleft dnaKright
AGTGAATTCACAAAATCATACTCAACTCCC; CGAAGCTTTCAATGCCCACTGCCTTGGCCATAC
Синтетические промоторы на основе аптамеров sTapl sTapl+35 sTapl+35-GGGA sTap2 sTap2 "-GGGA" sTap2 "+35" sTap2 "+35-GGGA1
AGAATAAACGCTCAACACGGCCGAGGj AGAA|^eCTCAACACGGCCGAGG
AGAA^^HCTCAACACGGCCGAGGI
GGGAGCTCAGAATAAACGCTCAAGGCCACGj GGGAGCTCAGAATAAACGCTCAAGGCCACG GGGAGCTC^^eAACGCTCAAGGCCACG| GGGAGCTC^^eAACGCTCAAGGCCACG! itaatgggagcggtat pta&tgggagcgg'TAT шш ccctgc gg T AT eaaactgggagcacctacggatggttcgacatgaggcccggatc h^^^ccctgcacctacggatggttcgacatgaggcccggatc
Sgggagcacctacggatggttcgacatgaggcccggatc Btaaactccctg сacсtacggatggttсgacatgaggcссggatс
PLEcoRI:
PL+35
PRHindHI:
5'-cagtgaattcgggagctcagaataaacgctcaa
5'-CAGTGAATTCGGGAGCTCTTGACAAACGCTCAAGGCC 5'-CCGAAGCTTGATCCGGGCCTCATGTCGAA
Список литературы диссертационного исследования кандидат биологических наук Миропольская, Наталия Александровна, 2010 год
1. Acharya, P., Rajakumara, Е., Sankaranarayanan, R., and Rao, N.M. (2004). Structural basis of selection and thermostability of laboratory evolved Bacillus subtilis lipase. J Mol Biol 341, 12711281.
2. Aniskovitch, L.P., and Winkler, H.H. (1995). Instability of Rickettsia prowazekii RNA polymerase-promoter complexes. J Bacteriol 177, 6301-6303.
3. Artsimovitch, I., Chu, C., Lynch, A.S., and Landick, R. (2003). A new class of bacterial RNA polymerase inhibitor affects nucleotide addition. Science 302, 650-654.
4. Artsimovitch, I., Patlan, V., Sekine, S., Vassylyeva, M.N., Hosaka, Т., Ochi, K., Yokoyama, S., and Vassylyev, D.G. (2004). Structural basis for transcription regulation by alarmone ppGpp. Cell 117, 299-310.
5. Artsimovitch, I., Svetlov, V., Anthony, L., Burgess, R.R., and Landick, R. (2000). RNA polymerases from Bacillus subtilis and Escherichia coli differ in recognition of regulatory signals in vitro. J Bacteriol 182, 6027-6035.
6. Bae, E., and Phillips, G.N., Jr. (2004). Structures and analysis of highly homologous psychrophilic, mesophilic, and thermophilic adenylate kinases. J Biol Chem 279, 28202-28208.
7. Bar-Nahum, G., Epshtein, V., Ruckenstein, A.E., Rafikov, R., Mustaev, A., and Nudler, E. (2005). A ratchet mechanism of transcription elongation and its control. Cell 120, 183-193.
8. Bar-Nahum, G., and Nudler, E. (2001). Isolation and characterization of sigma(70)-retaining transcription elongation complexes from Escherichia coli. Cell 106, 443-451.
9. Barlow, D.J., and Thornton, J.M. (1983). Ion-pairs in proteins. J Mol Biol 168, 867-885.
10. Barne, K.A., Bown, J. A., Busby, S.J., and Minchin, S.D. (1997). Region 2.5 of the Escherichia coli RNA polymerase sigma70 subunit is responsible for the recognition of the 'extended-10' motif at promoters. EMBO J 16, 4034-4040.
11. Batada, N.N., Westover, K.D., Bushnell, D.A., Levitt, M., and Komberg, R.D. (2004). Diffusion of nucleoside triphosphates and role of the entry site to the RNA polymerase II active center. Proc Natl Acad Sci U S A101, 17361-17364.
12. Bell, G.S., Russell, R.J., Connaris, H., Hough, D.W., Danson, M.J., and Taylor, G.L. (2002). Stepwise adaptations of citrate synthase to survival at life's extremes. From psychrophile to hyperthermophile. Eur J Biochem 269, 6250-6260.
13. Bigelow, C.C. (1967). On the average hydrophobicity of proteins and the relation between it and protein structure. J Theor Biol 16, 187-211.
14. Bismuto, E., Febbraio, F., Limongelli, S., Briante, R., and Nucci, R. (2003). Dynamic fluorescence studies of beta-glycosidase mutants from Sulfolobus solfataricus: effects of single mutations on protein thermostability. Proteins 51, 10-20.
15. Bouthier de la Tour, C., Portemer, C., Nadal, M., Stetter, K.O., Forterre, P., and Duguet, M. (1990). Reverse gyrase, a hallmark of the hyperthermophilic archaebacteria. J Bacteriol 172, 68036808.
16. Brodolin, K.L., Studitsky, V.M., and Mirzabekov, A.D. (1993). Conformational changes in E. coli RNA polymerase during promoter recognition. Nucleic Acids Res 21, 5748-5753.
17. Brueckner, F., and Cramer, P. (2008). Structural basis of transcription inhibition by alpha-amanitin and implications for RNA polymerase II translocation. Nat Struct Mol Biol 15, 811-818.
18. Bushnell, D.A., Cramer, P., and Kornberg, R.D. (2002). Structural basis of transcription: alpha-amanitin-RNA polymerase II cocrystal at 2.8 A resolution. Proc Natl Acad Sci U S A 99, 1218-1222.
19. Cambillau, C., and Claverie, J.M. (2000). Structural and genomic correlates of hyperthermostability. J Biol Chem 275, 32383-32386.
20. Campbell, E.A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A., and Darst, S.A. (2001). Structural mechanism for rifampicin inhibition of bacterial rna polymerase. Cell 104, 901-912.
21. Campbell, E.A., Muzzin, O., Chlenov, M., Sun, J.L., Olson, C.A., Weinman, O., Trester-Zedlitz, M.L., and Darst, S.A. (2002). Structure of the bacterial RNA polymerase promoter specificity sigma subunit. Mol Cell 9, 527-539.
22. Campbell, E.A., Pavlova, O., Zenkin, N., Leon, F., Irschik, H., Jansen, R., Severinov, K., and Darst, S.A. (2005). Structural, functional, and genetic analysis of sorangicin inhibition of bacterial RNA polymerase. Embo J 24, 674-682.
23. Carey, J., Cameron, V., de Haseth, P.L., and Uhlenbeck, O.C. (1983). Sequence-specific interaction of R17 coat protein with its ribonucleic acid binding site. Biochemistry 22, 2601-2610.
24. Cech, C.L., and McClure, W.R. (1980). Characterization of ribonucleic acid polymerase-T7 promoter binary complexes. Biochemistry 19, 2440-2447.
25. Chafin, D.R., Guo, H., and Price, D.H. (1995). Action of alpha-amanitin during pyrophosphorolysis and elongation by RNA polymerase II. J Biol Chem 270, 19114-19119.
26. Chakrabartty, A., and Baldwin, R.L. (1995). Stability of alpha-helices. Adv Protein Chem 46, 141176.
27. Chakravarty, S., and Varadarajan, R. (2000). Elucidation of determinants of protein stability through genome sequence analysis. FEBS Lett 470, 65-69.
28. Cramer, P., Bushnell, D.A., and Kornberg, R.D. (2001). Structural basis of transcription: RNA polymerase II at 2.8 angstrom resolution. Science 292, 1863-1876.
29. Croft, J.E., Love, D.R., and Bergquist, P.L. (1987). Expression of leucine genes from an extremely thermophilic bacterium in Escherichia coli. Mol Gen Genet 210, 490-497.
30. Davis, C.A., Capp, M.W., Record, M.T., Jr., and Saecker, R.M. (2005). The effects of upstream DNA on open complex formation by Escherichia coli RNA polymerase. Proc Natl Acad Sci USA 102, 285-290.
31. Demirjian, D.C., Moris-Varas, F., and Cassidy, C.S. (2001). Enzymes from extremophiles. Curr OpinChemBiol 5,144-151.
32. Dill, K.A. (1990). Dominant forces in protein folding. Biochemistry 29, 7133-7155.
33. Ederth, J., Artsimovitch, I., Isaksson, L.A., and Landick, R. (2002). The downstream DNA jaw of bacterial RNA polymerase facilitates both transcriptional initiation and pausing. J Biol Chem 277, 37456-37463.
34. Eichler, J., and Adams, M.W. (2005). Posttranslational protein modification in Archaea. Microbiol Mol Biol Rev 69, 393-425.
35. Elcock, A.H. (1998). The stability of salt bridges at high temperatures: implications for hyperthermophilic proteins. J Mol Biol 284, 489-502.
36. Epshtein, V., Mustaev, A., Markovtsov, V., Bereshchenko, O., Nikiforov, V., and Goldfarb, A. (2002). Swing-gate model of nucleotide entry into the RNA polymerase active center. Mol Cell 10, 623-634.
37. Faraldo, M.M., de Pedro, M.A., and Berenguer, J. (1992). Sequence of the S-layer gene of Thermus thermophilus HB8 and functionality of its promoter in Escherichia coli. J Bacteriol 174, 7458-7462.
38. Farias, S.T., and Bonato, M.C. (2003). Preferred amino acids and thermostability. Genet Mol Res 2,383-393.
39. Fields, P.A. (2001). Review: Protein function at thermal extremes: balancing stability and flexibility. Comp Biochem Physiol A Mol Integr Physiol 129, 417-431.
40. Fields, P.A., and Somero, G.N. (1998). Hot spots in cold adaptation: localized increases in conformational flexibility in lactate dehydrogenase A4 orthologs of Antarctic notothenioid fishes. Proc Natl Acad Sci U S A 95, 11476-11481.
41. Fitter, J., Herrmann, R., Dencher, N.A., Blume, A., and Hauss, T. (2001). Activity and stability of a thermostable alpha-amylase compared to its mesophilic homologue: mechanisms of thermal adaptation. Biochemistry 40, 10723-10731.
42. Fukuchi, S., Yoshimune, K., Wakayama, M., Moriguchi, M., and Nishikawa, K. (2003). Unique amino acid composition of proteins in halophilic bacteria. J Mol Biol 327, 347-357.
43. Gershenson, A., Schauerte, J.A., Giver, L., and Arnold, F.H. (2000). Tryptophan phosphorescence study of enzyme flexibility and unfolding in laboratory-evolved thermostable esterases. Biochemistry 39, 4658-4665.
44. Gianese, G., Bossa, F., and Pascarella, S. (2002). Comparative structural analysis of psychrophilic and meso- and thermophilic enzymes. Proteins 47, 236-249.
45. Gnatt, A.L., Cramer, P., Fu, J., Bushnell, D.A., and Kornberg, R.D. (2001). Structural basis of transcription: an RNA polymerase II elongation complex at 3.3 A resolution. Science 292, 1876-1882.
46. Golding, G.B., and Dean, A.M. (1998). The structural basis of molecular adaptation. Mol Biol Evol 15, 355-369.
47. Goldman, A. (1995). How to make my blood boil. Structure 3, 1277-1279.
48. Gourse, R.L., Gaal, Т., Aiyar, S.E., Barker, M.M., Estrem, S.T., Hirvonen, C.A., and Ross, W. (1998). Strength and regulation without transcription factors: lessons from bacterial rRNA promoters. Cold Spring Harb Symp Quant Biol 63, 131-139.
49. Gross, C.A., Chan, C., Dombroski, A., Gruber, Т., Sharp, M., Tupy, J., and Young, B. (1998). The functional and regulatory roles of sigma factors in transcription. Cold Spring Harb Symp Quant Biol 63, 141-155.
50. Haney, P.J., Stees, M., and Konisky, J. (1999b). Analysis of thermal stabilizing interactions in mesophilic and thermophilic adenylate kinases from the genus Methanococcus. J Biol Chem 274, 28453-28458.
51. Hartmann, R.K., and Erdmann, V.A. (1989). Thermits thermophilus 16S rRNA is transcribed from an isolated transcription unit. J Bacteriol 171, 2933-2941.
52. Hartmann, R.K., Ulbrich, N., and Erdmann, V.A. (1987). An unusual rRNA operon constellation: in Thermus thermophilus HB8 the 23S/5S rRNA operon is a separate entity from the 16S rRNA operon. Biochimie 69, 1097-1104.
53. Haslbeck, M., Franzmann, Т., Weinfurtner, D., and Buchner, J. (2005). Some like it hot: the structure and function of small heat-shock proteins. Nat Struct Mol Biol 12, 842-846.
54. Haugen, S.P., Berkmen, M.B., Ross, W., Gaal, Т., Ward, C., and Gourse, R.L. (2006). rRNA promoter regulation by nonoptimal binding of sigma region 1.2: an additional recognition element for RNA polymerase. Cell 125, 1069-1082.
55. Haugen, S.P., Ross, W., and Gourse, R.L. (2008a). Advances in bacterial promoter recognition and its control by factors that do not bind DNA. Nat Rev Microbiol 6, 507-519.
56. Haugen, S.P., Ross, W., Manrique, M., and Gourse, R.L. (2008b). Fine structure of the promoter-sigma region 1.2 interaction. Proc Natl Acad Sci USA 105, 3292-3297.
57. Hendsch, Z.S., and Tidor, B. (1999). Electrostatic interactions in the GCN4 leucine zipper: substantial contributions arise from intramolecular interactions enhanced on binding. Protein Sci 8, 1381-1392.
58. Henne, A., Bruggemann, H., Raasch, C., Wiezer, A., Hartsch, Т., Liesegang, H., Johann, A., Lienard, Т., Gohl, O., Martinez-Arias, R., et al. (2004). The genome sequence of the extreme thermophile Thermus thermophilus. Nat Biotechnol 22, 547-553.
59. Jaenicke, R. (2000). Do ultrastable proteins from hyperthermophiles have high or low conformational rigidity? Proc Natl Acad Sci U S A 97, 2962-2964.
60. Johns, G.C., and Somero, G.N. (2004). Evolutionary convergence in adaptation of proteins to temperature: A4-lactate dehydrogenases of Pacific damselfishes (Chromis spp.). Mol Biol Evol 21, 314-320.
61. Jung, Y.H., and Lee, Y. (1997). Escherichia coli rnpB promoter mutants altered in stringent response. Biochem Biophys Res Commun 230, 582-586.
62. Kannan, N., and Vishveshwara, S. (2000). Aromatic clusters: a determinant of thermal stability of thermophilic proteins. Protein Eng 13, 753-761.
63. Kaplan, C.D., and Kornberg, R.D. (2008). A bridge to transcription by RNA polymerase. J Biology 7,39.31-39.34.
64. Kaplan, C.D., Larsson, K.M., and Kornberg, R.D. (2008). The RNA polymerase II trigger loop functions in substrate selection and is directly targeted by alpha-amanitin. Mol Cell 30, 547-556.
65. Karshikoff, A., and Ladenstein, R. (1998). Proteins from thermophilic and mesophilic organisms essentially do not differ in packing. Protein Eng 11, 867-872.
66. Kettenberger, H., Armache, K.J., and Cramer, P. (2004). Complete RNA polymerase II elongation complex structure and its interactions with NTP and TFIIS. Mol Cell 16, 955-965.
67. Komissarova, N., and Kashlev, M. (1997a). RNA polymerase switches between inactivated and activated states By translocating back and forth along the DNA and the RNA. J Biol Chem 272, 15329-15338.
68. Komissarova, N., and Kashlev, M. (1997b). Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3' end of the RNA intact and extruded. Proc Natl Acad Sci USA 94, 1755-1760.
69. Korkegian, A., Black, M.E., Baker, D., and Stoddard, B.L. (2005). Computational thermostabilization of an enzyme. Science 308, 857-860.
70. Korndorfer, I., Steipe, В., Huber, R., Tomschy, A., and Jaenicke, R. (1995). The crystal structure of holo-glyceraldehyde-3-phosphate dehydrogenase from the hyperthermophilic bacterium Thermotoga maritima at 2.5 A resolution. J Mol Biol 246, 511-521.
71. Korolev, S., Nayal, M., Barnes, W.M., Di Cera, E., and Waksman, G. (1995). Crystal structure of the large fragment of Thermus aquaticus DNA polymerase I at 2.5-A resolution: structural basis for thermostability. Proc Natl Acad Sci U S A 92, 9264-9268.
72. Korzheva, N., Mustaev, A., Kozlov, M., Malhotra, A., Nikiforov, V., Goldfarb, A., and Darst, S.A. (2000). A structural model of transcription elongation. Science 289, 619-625.
73. Korzheva, N., Mustaev, A., Nudler, E., Nikiforov, V., and Goldfarb, A. (1998). Mechanistic model of the elongation complex of Escherichia coli RNA polymerase. Cold Spring Harb Symp Quant Biol 63, 337-345.
74. Kotik, M., and Zuber, H. (1993). Mutations that significantly change the stability, flexibility and quaternary structure of the 1-lactate dehydrogenase from Bacillus megaterium. Eur J Biochem 211, 267-280.
75. Kulbachinskiy, A., Bass, I., Bogdanova, E., Goldfarb, A., and Nikiforov, V. (2004). Cold sensitivity of thermophilic and mesophilic RNA polymerases. J Bacteriol 186, 7818-7820.
76. Kumar, S., and Nussinov, R. (2001). How do thermophilic proteins deal with heat? Cell Mol Life Sci 58, 1216-1233.
77. Kumar, S., Tsai, C.J., and Nussinov, R. (2001). Thermodynamic differences among homologous thermophilic and mesophilic proteins. Biochemistry 40, 14152-14165.
78. Kuznedelov, K., Lamour, V., Patikoglou, G., Chlenov, M., Darst, S.A., and Severinov, K. (2006). Recombinant Thermus aquaticus RNA polymerase for structural studies. J Mol Biol 359, 110-121.
79. Kuznedelov, К., Minakhin, L., and Severinov, K. (2003). Preparation and characterization of recombinant Thermus aquaticus RNA polymerase. Methods Enzymol 370, 94-108.
80. Ma, В., Kumar, S., Tsai, C.J., and Nussinov, R. (1999). Folding funnels and binding mechanisms. Protein Eng 12, 713-720.
81. Macedo-Ribeiro, S., Darimont, В., Sterner, R., and Huber, R. (1996). Small structural changes account for the high thermostability of l4Fe-4S. ferredoxin from the hyperthermophilic bacterium Thermotoga maritima. Structure 4, 1291-1301.
82. Machius, M., Declerck, N., Huber, R., and Wiegand, G. (2003). Kinetic stabilization of Bacillus licheniformis alpha-amylase through introduction of hydrophobic residues at the surface. J Biol Chem 278, 11546-11553.
83. Madigan, M.T., and Oren, A. (1999). Thermophilic and halophilic extremophiles. Curr Opin Microbiol 2, 265-269.
84. Makhatadze, G.I., and Privalov, P.L. (1995). Energetics of protein structure. Adv Protein Chem 47, 307-425.
85. Malhotra, A., Severinova, E., and Darst, S.A. (1996). Crystal structure of a sigma 70 subunit fragment from E. coli RNA polymerase. Cell 87, 127-136.
86. Markovtsov, V., Mustaev, A., and Goldfarb, A. (1996). Protein-RNA interactions in the active center of transcription elongation complex. Proc Natl Acad Sci U S A 93, 3221-3226.
87. Maseda, H., and Hoshino, T. (1995). Screening and analysis of DNA fragments that show promoter activities in Thermus thermophilus. FEMS Microbiol Lett 128, 127-134.
88. Matsui, I., and Harata, K. (2007). Implication for buried polar contacts and ion pairs in hyperthermostable enzymes. FEBS J 274, 4012-4022.
89. McClure, W.R. (1985). Mechanism and control of transcription initiation in prokaryotes. Annu Rev Biochem 54, 171-204.
90. McDonald, J.H. (2001). Patterns of temperature adaptation in proteins from the bacteria Deinococcus radiodurans and Thermus thermophilus. Mol Biol Evol 18, 741-749.
91. McDonald, J.H., Grasso, A.M., and Rejto, L.K. (1999). Patterns of temperature adaptation in proteins from Methanococcus and Bacillus. Mol Biol Evol 16, 1785-1790.
92. Meyer, J., Clay, M.D., Johnson, M.K., Stubna, A., Munck, E., Higgins, C., and Wittung-Stafshede, P. (2002). A hyperthermophilic plant-type 2Fe-2S. ferredoxin from Aquifex aeolicus is stabilized by a disulfide bond. Biochemistry 41, 3096-3108.
93. Minakhin, L., Nechaev, S., Campbell, E.A., and Severinov, K. (2001). Recombinant Thermus aquaticus RNA polymerase, a new tool for structure- based analysis of transcription. J Bacteriol 183, 71-76.
94. Minakhin, L., and Severinov, K. (2003). On the role of the Escherichia coli RNA polymerase sigma 70 region 4.2 and alpha-subunit C-terminal domains in promoter complex formation on the extended -10 galPl promoter. J Biol Chem 278,29710-29718.
95. Miyazaki, K., Wintrode, P.L., Grayling, R.A., Rubingh, D.N., and Arnold, F.H. (2000). Directed evolution study of temperature adaptation in a psychrophilic enzyme. J Mol Biol 297, 1015-1026.
96. Mukhopadhyay, J., Das, K., Ismail, S., Koppstein, D., Jang, M., Hudson, В., Sarafianos, S., Tuske, S., Patel, J., Jansen, R., et al. (2008). The RNA polymerase "switch region" is a target for inhibitors. Cell 135, 295-307.
97. Murakami, K.S., Masuda, S., Campbell, E.A., Muzzin, O., and Darst, S.A. (2002a). Structural basis of transcription initiation: an RNA polymerase holoenzyme-DNA complex. Science 296, 12851290.
98. Murakami, K.S., Masuda, S., and Darst, S.A. (2002b). Structural basis of transcription initiation: RNA polymerase holoenzyme at 4 A resolution. Science 296, 1280-1284.
99. Muslin, E.H., Clark, S.E., and Henson, C.A. (2002). The effect of proline insertions on the thermostability of a barley alpha-glucosidase. Protein Eng 15, 29-33.
100. Nagi, A.D., and Regan, L. (1997). An inverse correlation between loop length and stability in a four-helix-bundle protein. Fold Des 2, 67-75.
101. Nardmann, J., and Messer, W. (2000). Identification and characterization of the dnaA upstream region of Thermus thermophilus. Gene 261, 299-303.
102. Naryshkina, Т., Kuznedelov, K., and Severinov, K. (2006). The role of the largest RNA polymerase subunit lid element in preventing the formation of extended RNA-DNA hybrid. J Mol Biol 361, 634-643.
103. Nikiforov, V.G. (1971). Hybrid RNA polymerases formed from core enzymes and sigma factors of E. coli and thermophilic B. megaterium. FEBS Lett 16, 74-76.
104. Nudler, E., Kashlev, M., Nikiforov, V., and Goldfarb, A. (1995). Coupling between transcription termination and RNA polymerase inchworming. Cell 81, 351-357.
105. Opalka, N., Chlenov, M., Chacon, P., Rice, W.J., Wriggers, W., and Darst, S.A. (2003). Structure and function of the transcription elongation factor GreB bound to bacterial RNA polymerase. Cell 114, 335-345.
106. Orlova, M., Newlands, J., Das, A., Goldfarb, A., and Borukhov, S. (1995). Intrinsic transcript cleavage activity of RNA polymerase. Proc Natl Acad Sci USA 92, 4596-4600.
107. Osipiuk, J., and Joachimiak, A. (1997). Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus. Biochim Biophys Acta 1353, 253265.
108. Pack, S.P., and Yoo, Y.J. (2004). Protein thermostability: structure-based difference of amino acid between thermophilic and mesophilic proteins. J Biotechnol 111, 269-277.
109. Pack, S.P., and Yoo, Y.J. (2005). Packing-based difference of structural features between thermophilic and mesophilic proteins. Int J Biol Macromol 35, 169-174.
110. Pemberton, I.K., Muskhelishvili, G., Travers, A.A., and Buckle, M. (2000). The G+C-rich discriminator region of the tyrT promoter antagonises the formation of stable preinitiation complexes. J Mol Biol 299, 859-864.
111. Perederina, A., Svetlov, V., Vassylyeva, M.N., Tahirov, Т.Н., Yokoyama, S., Artsimovitch, I., and Vassylyev, D.G. (2004). Regulation through the secondary channel—structural framework for ppGpp-DksA synergism during transcription. Cell 118, 297-309.
112. Perutz, M.F., and Raidt, H. (1975). Stereochemical basis of heat stability in bacterial ferredoxins and in haemoglobin A2. Nature 255, 256-259.
113. Ramirez-Romero, M.A., Masulis, I., Cevallos, M.A., Gonzalez, V., and Davila, G. (2006). The Rhizobium etli sigma70 (SigA) factor recognizes a lax consensus promoter. Nucleic Acids Res 34, 1470-1480.
114. Razvi, A., and Scholtz, J.M. (2006). Lessons in stability from thermophilic proteins. Protein Sci 15, 1569-1578.
115. Ring, B.Z., Yarnell, W.S., and Roberts, J.W. (1996). Function of E. coli RNA polymerase sigma factor sigma 70 in promoter-proximal pausing. Cell 86, 485-493.
116. Roberts, C.W., and Roberts, J.W. (1996). Base-specific recognition of the nontemplate strand of promoter DNA by E. coli RNA polymerase. Cell 86, 495-501.
117. Roberts, J.W., Yarnell, W., Bartlett, E., Guo, J., Marr, M., Ко, D.C., Sun, H., and Roberts, C.W. (1998). Antitermination by bacteriophage lambda Q protein. Cold Spring Harb Symp Quant Biol 63, 319-325.
118. Robinson, C.R., and Sauer, R.T. (1998). Optimizing the stability of single-chain proteins by linker length and composition mutagenesis. Proc Natl Acad Sci USA 95, 5929-5934.
119. Ross, W., Gosink, K.K., Salomon, J., Igarashi, K., Zou, C., Ishihama, A., Severinov, K., and Gourse, R.L. (1993). A third recognition element in bacterial promoters: DNA binding by the alpha subunit of RNA polymerase. Science 262, 1407-1413.
120. Ross, W., and Gourse, R.L. (2005). Sequence-independent upstream DNA-alphaCTD interactions strongly stimulate Escherichia coli RNA polymerase-lacUV5 promoter association. Proc Natl Acad Sci USA 102, 291-296.
121. Rozovskaya, T.A., Chenchik, A.A., and Beabealashvilli, R. (1982). Processive pyrophosphorolysis of RNA by Escherichia coli RNA polymerase. FEBS Lett 137, 100-104.
122. Rudd, M.D., Izban, M.G., and Luse, D.S. (1994). The active site of RNA polymerase II participates in transcript cleavage within arrested ternary complexes. Proc Natl Acad Sci U S A 91, 8057-8061.
123. Rudd, M.D., and Luse, D.S. (1996). Amanitin greatly reduces the rate of transcription by RNA polymerase II ternary complexes but fails to inhibit some transcript cleavage modes. J Biol Chem 271, 21549-21558.
124. Russell, R.J., Hough, D.W., Danson, M.J., and Taylor, G.L. (1994). The crystal structure of citrate synthase from the thermophilic archaeon, Thermoplasma acidophilum. Structure 2, 1157-1167.
125. Sadeghi, M., Naderi-Manesh, H., Zarrabi, M., and Ranjbar, B. (2006). Effective factors in thermostability of thermophilic proteins. Biophys Chem 119, 256-270.
126. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning. (Cold Spring Harbour Press.).
127. Sanchez, R., Roovers, M., and Glansdorff, N. (2000). Organization and expression of a Thermus thermophilus arginine cluster: presence of unidentified open reading frames and absence of a Shine-Dalgarno sequence. J Bacteriol 182, 5911-5915.
128. Sanderova, H., Hulkova, M., Malon, P., Kepkova, M., and Jonak, J. (2004). Thermostability of multidomain proteins: elongation factors EF-Tu from Escherichia coli and Bacillus stearothermophilus and their chimeric forms. Protein Sci 13, 89-99.
129. Sandman, K., Krzycki, J.A., Dobrinski, В., Lurz, R., and Reeve, J.N. (1990). HMf, a DNA-binding protein isolated from the hyperthermophilic archaeon Methanothermus fervidus, is most closely related to histones. Proc Natl Acad Sci U S A 87, 5788-5791.
130. Sato, S., Nakada, Y., Kanaya, S., and Tanaka, T. (1988). Molecular cloning and nucleotide sequence of Thermus thermophilus HB8 trpE and trpG. Biochim Biophys Acta 950, 303-312.
131. Serrano, L., Bycroft, M., and Fersht, A.R. (1991). Aromatic-aromatic interactions and protein stability. Investigation by double-mutant cycles. J Mol Biol 218, 465-475.
132. Shiraki, K., Nishikori, S., Fujiwara, S., Hashimoto, H., Kai, Y., Takagi, M., and Imanaka, T. (2001). Comparative analyses of the conformational stability of a hyperthermophilic protein and its mesophilic counterpart. Eur J Biochem 268, 4144-4150.
133. Siddhikol, C., Erbstoeszer, J.W., and Weisblum, B. (1969). Mode of action of streptolydigin. J Bacteriol 99, 151-155.
134. Singer, G.A., and Hickey, D.A. (2003). Thermophilic prokaryotes have characteristic patterns of codon usage, amino acid composition and nucleotide content. Gene 317, 39-47.
135. Sosunov, V., Sosunova, E., Mustaev, A., Bass, I., Nikiforov, V., and Goldfarb, A. (2003). Unified two-metal mechanism of RNA synthesis and degradation by RNA polymerase. EMBO J 22, 22342244.
136. Sosunova, E., Sosunov, V., Kozlov, M., Nikiforov, V., Goldfarb, A., and Mustaev, A. (2003). Donation of catalytic residues to RNA polymerase active center by transcription factor Gre. Proc Natl Acad Sci USA 100, 15469-15474.
137. Steitz, T.A. (1998). A mechanism for all polymerases. Nature 391, 231-232.
138. Sterner, R., and Liebl, W. (2001). Thermophilic adaptation of proteins. Crit Rev Biochem Mol Biol 36, 39-106.
139. Stetter, K.O. (1999). Extremophiles and their adaptation to hot environments. FEBS Lett 452, 2225.
140. Struck, J.C., Toschka, H.Y., and Erdmann, V.A. (1988). Nucleotide sequence of the 4.5S RNA gene from Thermus thermophilus HB8. Nucleic Acids Res 16, 9042.
141. Suhre, K., and Claverie, J.M. (2003). Genomic correlates of hyperthermostability, an update. J Biol Chem 278, 17198-17202.
142. Svetlov, V., Belogurov, G.A., Shabrova, E., Vassylyev, D.G., and Artsimovitch, I. (2007). Allosteric control of the RNA polymerase by the elongation factor RfaH. Nucleic Acids Res 35, 56945705.
143. Svetlov, V., Vassylyev, D.G., and Artsimovitch, I. (2004). Discrimination against deoxyribonucleotide substrates by bacterial RNA polymerase. J Biol Chem 279, 38087-38090.
144. Svingor, A., Kardos, J., Hajdu, I., Nemeth, A., and Zavodszky, P. (2001). A better enzyme to cope with cold. Comparative flexibility studies on psyclirotrophic, mesophilic, and thermophilic IPMDHs. J Biol Chem 276, 28121-28125.
145. Szilagyi, A., and Zavodszky, P. (2000). Structural differences between mesophilic, moderately thermophilic and extremely thermophilic protein subunits: results of a comprehensive survey. Structure 8, 493-504.
146. Tan, L., Wiesler, S., Trzaska, D., Carney, H.C., and Weinzierl, R.O. (2008). Bridge helix and trigger loop perturbations generate superactive RNA polymerases. J Biol 7, 40.
147. Tanner, J.J., Hecht, R.M., and Krause, K.L. (1996). Determinants of enzyme thermostability observed in the molecular structure of Thermus aquaticus D-glyceraldehyde-3-phosphate dehydrogenase at 25 Angstroms Resolution. Biochemistry 35, 2597-2609.
148. Temiakov, D., Zenkin, N., Vassylyeva, M.N., Perederina, A., Tahirov, Т.Н., Kashkina, E., Savkina, M., Zorov, S., Nikiforov, V., Igarashi, N., et al. (2005). Structural basis of transcription inhibition by antibiotic streptolydigin. Mol Cell 19, 655-666.
149. Thompson, M.J., and Eisenberg, D. (1999). Transproteomic evidence of a loop-deletion mechanism for enhancing protein thermostability. J Mol Biol 290, 595-604.
150. Tomazic, S.J., and Klibanov, A.M. (1988). Mechanisms of irreversible thermal inactivation of Bacillus alpha-amylases. J Biol Chem 263, 3086-3091.
151. Toulokhonov, I., and Landick, R. (2006). The role of the lid element in transcription by E. coli RNA polymerase. J Mol Biol 361, 644-658.
152. Toulokhonov, I., Zhang, J., Palangat, M., and Landick, R. (2007). A central role of the RNA polymerase trigger loop in active-site rearrangement during transcriptional pausing. Mol Cell 27, 406419.
153. Travers, A.A. (1980). Promoter sequence for stringent control of bacterial ribonucleic acid synthesis. J Bacteriol 141, 973-976.
154. Trivedi, S., Gehlot, H.S., and Rao, S.R. (2006). Protein thermostability in Archaea and Eubacteria. Genet Mol Res 5,816-827.
155. Unsworth, L.D., van der Oost, J., and Koutsopoulos, S. (2007). Hyperthermophilic enzymes-stability, activity and implementation strategies for high temperature applications. FEBS J 274, 40444056.
156. Van de Casteele, M., Chen, P., Roovers, M., Legrain, C., and Glansdorff, N. (1997). Structure and expression of a pyrimidine gene cluster from the extreme thermophile Thermus strain Z05. J Bacteriol 179, 3470-3481.
157. Van den Burg, В., Vriend, G., Veltman, O.R., Venema, G., and Eijsink, V.G. (1998). Engineering an enzyme to resist boiling. Proc Natl Acad Sci U S A 95, 2056-2060.
158. Vassylyev, D.G., Sekine, S., Laptenko, O., Lee, J., Vassylyeva, M.N., Borukhov, S., and Yokoyama, S. (2002). Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A resolution. Nature 417, 712-719.
159. Vassylyev, D.G., Svetlov, V., Vassylyeva, M.N., Perederina, A., Igarashi, N., Matsugaki, N., Wakatsuki, S., and Artsimovitch, I. (2005). Structural basis for transcription inhibition by tagetitoxin. Nat Struct Mol Biol 12, 1086-1093.
160. Vassylyev, D.G., Vassylyeva, M.N., Perederina, A., Tahirov, Т.Н., and Artsimovitch, I. (2007a). Structural basis for transcription elongation by bacterial RNA polymerase. Nature 448, 157-162.
161. Vassylyev, D.G., Vassylyeva, M.N., Zhang, J., Palangat, M., Artsimovitch, I., and Landick, R. (2007b). Structural basis for substrate loading in bacterial RNA polymerase. Nature 448, 163-168.
162. Vassylyeva, M.N., Svetlov, V., Dearborn, A.D., Klyuyev, S., Artsimovitch, I., and Vassylyev, D.G. (2007). The carboxy-terminal coiled-coil of the RNA polymerase beta'-subunit is the main binding site for Gre factors. EMBO Rep 8, 1038-1043.
163. Vetriani, C., Maeder, D.L., Tolliday, N., Yip, K.S., Stillman, T.J., Britton, K.L., Rice, D.W., Klump, И.Н., and Robb, F.T. (1998). Protein thermostability above 100 degreesC: a key role for ionic interactions. Proc Natl Acad Sci U S A 95, 12300-12305.
164. Vieille, C., and Zeikus, G.J. (2001). Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol Mol Biol Rev 65, 1-43.
165. Villbrandt, В., Sobek, H., Frey, В., and Schomburg, D. (2000). Domain exchange: chimeras of Thermus aquaticus DNA polymerase, Escherichia coli DNA polymerase I and Thermotoga neapolitana DNA polymerase. Protein Eng 13, 645-654.
166. Vogt, G., Woell, S., and Argos, P. (1997). Protein thermal stability, hydrogen bonds, and ion pairs. J Mol Biol 269, 631-643.
167. Wang, D., Bushnell, D.A., Westover, K.D., Kaplan, C.D., and Kornberg, R.D. (2006). Structural basis of transcription: role of the trigger loop in substrate specificity and catalysis. Cell 127, 941-954.
168. Wang, D., and Hawley, D.K. (1993). Identification of a 3'—>5' exonuclease activity associated with human RNA polymerase II. Proc Natl Acad Sci U S A 90, 843-847.
169. Weisburg, W.G., Giovannoni, S.J., and Woese, C.R. (1989). The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction. Syst Appl Microbiol 11, 128134.
170. Westover, K.D., Bushnell, D.A., and Kornberg, R.D. (2004). Structural basis of transcription: nucleotide selection by rotation in the RNA polymerase II active center. Cell 119, 481-489.
171. Wieland, Т., and Faulstich, H. (1991). Fifty years of amanitin. Experientia 47, 1186-1193.
172. Wintrode, P.L., Miyazaki, K., and Arnold, F.H. (2001). Patterns of adaptation in a laboratory evolved thermophilic enzyme. Biochim Biophys Acta 1549, 1-8.
173. Wooll, J.O., Wrabl, J.O., and Hilser, V.J. (2000). Ensemble modulation as an origin of denaturant-independent hydrogen exchange in proteins. J Mol Biol 301, 247-256.
174. Xiao, L., and Honig, B. (1999). Electrostatic contributions to the stability of hyperthermophilic proteins. J Mol Biol 289, 1435-1444.
175. Xue, Y., Hogan, B.P., and Erie, D.A. (2000). Purification and initial characterization of RNA polymerase from Thermus thermophilus strain HB8. Biochemistry 39, 14356-14362.
176. Yang, X., and Price, C.W. (1995). Streptolydigin resistance can be conferred by alterations to either the beta or beta' subunits of Bacillus subtilis RNA polymerase. J Biol Chem 270, 23930-23933.
177. Zaccai, G. (2000). How soft is a protein? A protein dynamics force constant measured by neutron scattering. Science 288, 1604-1607.
178. Zavodszky, P., Kardos, J., Svingor, and Petsko, G.A. (1998). Adjustment of conformational flexibility is a key event in the thermal adaptation of proteins. Proc Natl Acad Sci USA 95, 74067411.
179. Zaychikov, E., Martin, E., Denissova, L., Kozlov, M., Markovtsov, V., Kashlev, M., Heumann, H., Nikiforov, V., Goldfarb, A., and Mustaev, A. (1996). Mapping of catalytic residues in the RNA polymerase active center. Science 273, 107-109.
180. Zenkin, N., Naryshkina, Т., Kuznedelov, K., and Severinov, K. (2006a). The mechanism of DNA replication primer synthesis by RNA polymerase. Nature 439, 617-620.
181. Zenkin, N., Yuzenkova, Y., and Severinov, K. (2006b). Transcript-assisted transcriptional proofreading. Science 313, 518-520.
182. Zhang, G., Campbell, E.A., Minakhin, L., Richter, C., Severinov, K., and Darst, S.A. (1999). Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution. Cell 98, 811-824.
183. Zhou, X.X., Wang, Y.B., Pan, Y.J., and Li, W.F. (2008). Differences in amino acids composition and coupling patterns between mesophilic and thermophilic proteins. Amino Acids 34, 25-33.
Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания. В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.