Молекулярно-генетические детерминанты клеточного ответа на несвернутые белки и их патогенетическая роль в развитии сахарного диабета 2 типа тема диссертации и автореферата по ВАК РФ 00.00.00, кандидат наук Клёсова Елена Юрьевна
- Специальность ВАК РФ00.00.00
- Количество страниц 267
Оглавление диссертации кандидат наук Клёсова Елена Юрьевна
ВВЕДЕНИЕ
ГЛАВА 1 ЛИТЕРАТУРНЫЙ ОБЗОР
1.1 Современные представления об этиологии и патогенетических механизмах развития сахарного диабета 2 типа
1.2 Генетические исследования сахарного диабета 2 типа
1.3 Фолдинг как важнейший процесс формирования трехмерной структуры белков, определяющий их биологические функции
1.4 Клеточный ответ на несвернутые белки как механизм поддержания протеостаза в норме и патологии
ГЛАВА 2 МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ
2.1 Характеристика материала исследования
2.2 Характеристика методов исследования
2.2.1 Анкетирование пациентов
2.2.2 Молекулярно-генетические методы
2.2.3 Генетико-статистические биоинформатические методы
Глава 3 РЕЗУЛЬТАТЫ СОБСТВЕННЫХ ИССЛЕДОВАНИЙ
3.1 Характеристика частот аллелей и генотипов полиморфных вариантов генов регулирующих фолдинг белков и клеточный ответ на несвернутые белки у жителей Центральной России
3.2 Анализ ассоциаций полиморфных вариантов генов регулирующих фолдинг белков и клеточный ответ на несвернутые белки с предрасположенностью к сахарному диабету 2 типа
3.3 Валидация ассоциаций полиморфных вариантов генов регулирующих фолдинг белков и клеточный ответ на несвернутые белки и с риском сахарного диабета 2 типа в независимых популяциях мира
3.4 Анализ неравновесия по сцеплению и ассоциаций гаплотипов генов регулирующих фолдинг белков и клеточный ответ на несвернутые белки с риском развития СД2
3.5 Анализ совместного влияния средовых факторов риска сахарного диабета 2 типа и полиморфных вариантов генов на развитие болезни
3.6 Моделирование межгенных и генно-средовых взаимодействий, ассоциированных с риском развития СД2, методом MB-MDR
3.7 Функциональное аннотирование полиморфных вариантов генов регулирующих фолдинг белков и клеточный ответ на несвернутые белки
3.8 Анализ транскрипционного профиля генов регулирующих фолдинг белков и клеточный ответ на несвернутые белки в В-клетках поджелудочной
железы при сахарном диабете 2 типа
ОБСУЖДЕНИЕ
ВЫВОДЫ
СПИСОК СОКРАЩЕНИЙ
СПИСОК ЛИТЕРАТУРЫ
ПРИЛОЖЕНИЯ
ВВЕДЕНИЕ
Рекомендованный список диссертаций по специальности «Другие cпециальности», 00.00.00 шифр ВАК
Комплексное исследование вовлеченности генов ферментов редокс-гомеостаза в развитие сахарного диабета 2 типа и его осложнений2022 год, доктор наук Азарова Юлия Эдуардовна
Патогенетика сахарного диабета 1 типа и его осложнений: гены синтаз оксида азота и цитокинов2008 год, кандидат медицинских наук Тарасенко, Наталия Викторовна
Роль генетических и средовых факторов в развитии и клиническом течении острого панкреатита и разработка новых подходов к диагностике, лечению и профилактике болезни2023 год, доктор наук Самгина Татьяна Александровна
Полиморфные генетические маркеры сахарного диабета 2-го типа и их ассоциации с клинико-метаболическими показателями в русской популяции2015 год, кандидат наук Вахромеева, Ксения Александровна
Патогенетические механизмы формирования сахарного диабета 2 типа2024 год, доктор наук Авзалетдинова Диана Шамилевна
Введение диссертации (часть автореферата) на тему «Молекулярно-генетические детерминанты клеточного ответа на несвернутые белки и их патогенетическая роль в развитии сахарного диабета 2 типа»
Актуальность исследования
Сахарный диабет - одна из глобальных проблем здравоохранения в XXI веке (Sun H. et al., 2022). По данным Международной диабетической федерации (IDF) в мире на 2021 год сахарным диабетом страдают 537 млн. человек в возрасте 20-79 лет (распространенность 10,5%), а к 2045 г это число увеличится до 783 млн. (распространенность 12,2 %) (Sun H. et al., 2022). При этом Россия находится на втором месте среди всех европейских стран по количеству больных диабетом, 90% из которых составляют больные диабетом 2 типа (СД2) (Sun H. et al., 2022). Заболевание представляет собой постоянно прогрессирующую хроническую патологию, в развитии которого принимают участие генетические и средовые факторы.
Большую роль в развитие СД2 играет генетическая предрасположенность, что подтверждается рядом фактических данных, в том числе сильной семейной отягощенностью заболевания и высокими показателями конкордантности СД2 у однояйцевых близнецов (Chatterjee S. et al., 2017; Oellgaard J. et al., 2018). Проведено большое количество генетических исследований сахарного диабета 2 типа, включая поиск ассоциаций с генами кандидатами и полногеномные ассоциативные исследования (Genome-wide association studies, GWAS). Ресурс GeneCards (Barshir R. et al., 2021) содержит информацию о 16 622 кандидатных генах, связанных с сахарным диабетом 2 типа и его патогенетическими значимыми фенотипами. Согласно данным каталога GWAS (https://www.ebi.ac.uk/gwas/), по результатам полногеномных ассоциативных исследований идентифицировано 5263 однонуклеотидных полиморфных, ассоциированных с развитием СД2.
Согласно результатам многочисленных исследований, ключевая роль в развитии и прогрессировании СД2 приходится на снижение функции в-клеток поджелудочной железы, связанное с их гибелью и уменьшением массы (Steiner D. F.,2008; Krause M. et al., 2014; Wysham C. et al., 2020). На сегодняшний день
основными генами-кандидатами, связанными с развитием СД2 посредством неблагоприятного влияния на функцию Р-клеток, являются гены ABO, IGF2BP2, MTNR1B, TCF7L2, HNF1A, HNF1B, ADCY5, SLC30A8, CCND2 и PAM(Eizirik D. L. et al., 2020). Несмотря на то, что появление геномных, транскриптомных, протеомных и метаболомных технологий способствовало быстрому прогрессу в понимании молекулярных механизмов СД2, тем не менее, ключевые этиологические факторы и первичные механизмы, ответственные за инициирование апоптоза Р-клеток и прогрессирующую их потерю, остаются неизвестны.
Степень разработанности темы
Известно, что сахарный диабет 2 типа является мультифакториальным заболеванием, в развитии которого лежат как генетические, так и средовые факторы (Shrestha N. et al., 2021; Nauck, M. A et al., 2021). Установлен широкий спектр генов, ассоциированных с ключевыми патофизиологическими изменениями при СД2, среди которых дисфункция и прогрессирующая потеря инсулин секретирующих Р-клеток поджелудочной железы является ведущим нарушением, причины которого, по-прежнему, остаются неизвестными (Petersen, K. F. et al., 2002; Roden M. et al., 2019; Galicia-Garcia U. et al., 2020). Одним из ключевых нарушений, выявляемых в Р-клетках поджелудочной железы при сахарном диабете 2 типа, является стресс эндоплазматического ретикулума (ЭР), который сопряжен с активацией клеточного ответа на накопление неправильно свернутых белков в ЭР (UPR, unfolding protein response) (Kubisch C. H. et al., 2008; Shrestha N. et al., 2021, Yong J. et al., 2021; Diane A. et al., 2021). Установлено, что в В-клетках поджелудочной железы у больных СД2 нарушения белкового фолдинга характеризуются, с одной стороны, повышенным запросом на сворачивание проинсулина в трехмерную структуру, с другой, неспособностью ЭР предотвратить накопление масс неправильно свернутого белка (Mukherjee et al., 2015; Moreno-Gonzalez I. et al., 2017; Dhayalan B. et al., 2021, Lee А.Н., et al., 2020).
Клеточный ответ на несвернутые белки рассматривается как один из фундаментальных механизмов поддержания и регуляции белкового гомеостаза (протеостаза) и реализуется через сеть сигнальных путей по перепрограммированию регуляции экспрессии генов, трансляции мРНК и посттрансляционных модификации белков с целью восстановления протеостаза (Hetz et al., 2020). Хорошо известно, что важнейшим биологическим процессом, обеспечивающим белковые молекулы нативной функцией, является фолдинг. Ключевыми участниками сворачивания полипептидной цепи в функциональную молекулу является особый класс белков теплового шока - шаперонов, ответственных за посттрансляционный фолдинга белка (Liu M. et al., 2018). Основными компонентами поддержания белкового гомеостаза практически во всех клетках являются белки теплового шока семейств 90 (Hsp90), 70 (Hsp70) и 40 (Hsp40) (Luengo T. M. et al., 2019; Hartl F.U. et al., 2011), которые функционируют как АТФ-зависимые молекулярные шапероны, необходимые для сворачивания белков в их нативную трехмерную структуру (Gupta A. et al., 2020). Рядом исследований продемонстрирована потенциальная причастность отдельных шаперонов, в частности, DNAJB1, HSF1 и DNAJC3 к патологическим нарушениям, выявляемым при сахарном диабете 2 типа - апоптозу в-клеток поджелудочной железы и гипергликемии (Purwana I. et al., 2017; Kavanagh K. et al., 2009; Tzeng J. et al., 2022, Ladiges W.C. et al., 2005).
Известно, что наличие мутаций в гене проинсулина нарушает фолдинг белков, приводя к стрессу ЭР, что является причиной развития моногенных форм сахарного диабета (Dhayalan B. et al., 2019; Arunagiri A. et al., 2019; Dhayalan B. et al., 2022). Недавними исследованиями было обнаружено, что и при СД2 имеет место нарушения фолдинга молекулы инсулина (Liu M. et al., 2018; Bhatia, S. et al., 2022). Однако до настоящего времени в мире выполнены единичные исследования по оценке роли полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки в развитии СД2 (Sudagani J. et al., 2010; Thameem F. et al., 2006; Chu W.S. et al., 2007, Meex S. J. R. et al., 2007,Moniruzzaman M., 2020, Witka B.Z. et al., 2019). Данное обстоятельство
послужило основанием для проведения настоящего исследования, целью которого было проанализировать вовлеченность генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки в молекулярные механизмы развития сахарного диабета 2 типа.
Цель исследования
Провести комплексное исследование по анализу вовлеченности генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, в молекулярные механизмы развития сахарного диабета 2 типа.
Задачи исследования
1. Исследовать ассоциации полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, с риском развития сахарного диабета 2 типа у жителей Центральной России и провести репликативные исследования выявленных ассоциаций в независимых популяциях мира.
2. Изучить пол-специфичные эффекты генотипов и гаплотипов полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, на предрасположенность к сахарному диабету 2 типа раздельно у мужчин и женщин.
3. Выявить особенности ассоциаций полиморфных вариантов исследуемых генов с риском развития сахарного диабета 2 типа в зависимости от индекса массы тела пациентов.
4. Исследовать совместные эффекты полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки и средовых факторов риска болезни на предрасположенность к сахарному диабету 2 типа.
5. Проанализировать взаимодействия генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, с генами ферментов метаболизма
глутатиона и известными генами-кандидатами СД2 и оценить их совместную вовлеченность в молекулярные механизмы развития болезни.
6. Проанализировать экспрессионный профиль генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, в В-клетках поджелудочной железы у больных сахарным диабетом 2 типа и пациентов без диабета.
Научная новизна
Впервые проведено комплексное молекулярно-генетическое исследование, в рамках которого проведен анализ ассоциаций полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, с развитием сахарного диабета 2 типа. В результате установлено, что полиморфные варианты ^3810252 и ге8496 гена и ^2341471 гена ЛТБб сильно
ассоциированы с развитием сахарного диабета 2 типа, тогда как ^755892 ОЫ^В1, ге1882019 НБРЯвВ1, ге1043618 НБРЛ1Л, ге391957 НБРЛ5, ге3757971 НББ1, rs7517862 ЛТРб, ^196914 ЕШ1 и rs1046495 ОБЕР характеризовались значимыми, но относительно слабыми эффектами на предрасположенность к болезни. Обнаружены пол-специфические эффекты исследованных полиморфных вариантов генов НБРЯ0В1 ^1165682, ге1882019, rs10778306), (rs8496),
НБРЛ1Л (ге3095154), НБРЛ5 (^55736103^, НББ1 (ге7838717, rs3757971), ОБЕР (^1046495^ и гена ЛТБб (rs7517862) на риск развития СД2. Впервые показано, что полиморфные варианты генов, регулирующих фолдинг белка и клеточный ответ на несвернутые белки, ассоциируются с предрасположенностью к СД2 в зависимости от индекса массы тела. Впервые было установлено, что полиморфные варианты генов, регулирующие фолдинг белков и клеточный ответ на несвернутые белки, проявляют синергизм со средовыми факторами риска во влиянии на развитие сахарного диабета 2 типа. Впервые установлено, что исследованные гены составляют важнейшую составляющую генетической предрасположенности к сахарному диабету 2 типа и сила влияния отдельных полиморфных вариантов на развитие болезни превышает таковую,
установленную в отношении локусов, ассоциированных с СД2 по результатам полногеномных ассоциативных исследований. Впервые при сахарном диабете в Р-клетках поджелудочной железы выявлены дифференциально экспрессирующиеся гены, вовлеченные в фолдинг белков (HSP90AB1, HSP90AA1, HSPA1B, HSPA8, BAG3, NDC1, NUP160, RLN1 и RPS19BP1) и клеточный ответ на несвернутые белки (CREB3L4, ERP27 и BID).
Теоретическая и практическая значимость работы
В диссертационной работе представлены результаты, раскрывающие ранее неизвестные аспекты генетической детерминации системы регуляции фолдинга белков и клеточного ответа на не свернутые белки при сахарном диабете 2 типа. Показано, что полиморфные варианты генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, такие как rs3810252, rs8496, rs755892 и rs7517862 гена DNAJB1 и rs2341471 гена ATF6, rs1882019 гена HSP90B1, rs1043618 гена HSPA1A, rs391957 гена HSPA5, rs3757971 гена HSF1, rs196914 гена ERN1 и rs1046495 гена GFER тесно взаимосвязаны с предрасположенностью к болезни и выступают в качестве генетических детерминант, способных инициировать нарушения фолдинга белков, тем самым вызвать стресс ЭР и индукцию апоптоза Р-клеток поджелудочной железы при СД2. Взаимодействие между данным классом генов с генами метаболизма глутатиона и известными генами-кандидатами СД2 указывают на их совместную вовлеченность в полигенные механизмы развития болезни. Факт установленного совместного влияния исследованных генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки и средовых факторов на риск развития СД2, открывает перспективы разработки программ профилактических мероприятий по предотвращению развития болезни у лиц, генетически предрасположенных к болезни. Результаты диссертационного исследования открывают новое направление в изучении этиопатогенеза сахарного диабета 2 типа, связанного с дальнейшей расшифровкой генетически детерминированных нарушений фолдинга белков и клеточного ответа на несвернутые белки, способных
инициировать каскад патологических изменений, приводящих к апоптозу Р-клеток островкового аппарата поджелудочной железы. Раскрытие данных молекулярных механизмов позволит разработать новые подходы к лечению болезни посредством нормализации процессов фолдинга белков и подавления сигнальных путей активации апоптоза. В этой связи полиморфные варианты генов, особенно rs3810252 и rs8496 гена DNAJB1 и rs2341471 гена ATF6, в отношении которых установлены выраженные ассоциации с СД2, с одной стороны, представляют собой новые молекулярные мишени для фармакотерапии и фармакопрофилактики болезни, с другой - могут использоваться в качестве генетических маркеров для оценки индивидуального риска развития заболевания, в том числе при медико-генетическом консультировании семей, отягощенных сахарным диабетом. Результаты диссертационной работы используются в образовательном процессе кафедр биологии, медицинской генетики и экологии, биологической химии и патофизиологии ФГБОУ ВО КГМУ Минздрава России по направлению подготовки «Лечебное дело» и «Педиатрия».
Методология и методы диссертационного исследования
Диссертационное исследование выполнено в соответствии с рекомендации STREGA (https://www.equator-network.org/reporting-guidelines/strobe-strega/) по проведению генетико-эпидемиологических исследований. В исследование были включены 35 полиморфных вариантов двух групп генов - генов регулирующих фолдинг белков (ГРФБ) и генов клеточного ответа на несвернутые белки (UPR). Для выполнения исследования использовались репрезентативные выборки пациентов с сахарным диабетом 2 типа (1579 человек) и относительно здоровых лиц (1650 человек), численность которых обеспечивала высокую (>85%) статистическую мощность исследования. Генотипирование образцов ДНК по полиморфным локусам выполнялось на базе научно-исследовательского института генетической и молекулярной эпидемиологии ФГБОУ ВО «Курского государственного медицинского университета» Минздрава России с помощью технологии iPLEX методом MALDI-TOF на геномном времяпролетном масс-
спектрометре MassARRAY Analyzer 4 (Agena Bioscience, США). Для анализа данных использовались современные методы генетико-статистического и биоинформатического анализа. При расчетах вводились поправки на пол, возраст, индекс массы тела и множественность тестирования. Для оценки регуляторного потенциала и функциональных эффектов генетических вариантов, ассоциированных с СД2, использовались современные биоинформатические ресурсы, использующиеся в генетической эпидемиологии.
Положения, выносимые на защиту
1. Полиморфные варианты генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, являются важнейшей частью генетической предрасположенности к сахарному диабету 2 типа, которая реализуется посредством изменений в экспрессии генов молекулярных шаперонов и ко-шаперонов, способствуя нарушению формирования третичной структуры белков и возникновения стресса эндоплазматического ретикулума.
2. Характер и степень вовлеченности полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, в молекулярные механизмы развития сахарного диабета 2 типа существенно варьируются в зависимости от пола, индекса массы тела и этнической принадлежности индивидов.
3. Полиморфные варианты генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки, находятся в тесных взаимодействиях с полиморфными вариантами генов ферментов метаболизма глутатиона и известными генами-кандидатами СД2, тем самым, демонстрируя на их совместную вовлеченность в полигенные механизмы развития сахарного диабета 2 типа.
4. При реализации генетической предрасположенности к сахарному диабету 2 типа средовые факторы риска, главным образом качественные и количественные характеристики питания и малоподвижный образ жизни, создают условия для проявления негативных эффектов функционально неполноценных
аллелей полиморфных вариантов генов, регулирующих фолдинг белков и клеточный ответ на несвернутые белки.
5. В Р-клетках поджелудочной железы у больных СД2 обнаружены дифференциально экспрессирующиеся гены, вовлеченные в фолдинг белка (HSP90AB1, HSP90AA1, HSPA1B, HSPA8, BAG3, NDC1, NUP160, RLN1 и RPS19BP1) и клеточный ответ на несвернутые белки (CREB3L4, ERP27 и BID), что указывает на существование при сахарном диабете 2 типа молекулярных нарушений формирования третичной структуры белка и связанных с ними накоплением неправильно свернутых белков, обуславливающих стресс эндоплазматического ретикулума и активацию сигнальных путей апоптоза Р-клеток островкового аппарата поджелудочной железы.
Степень достоверности и апробация результатов
Достоверность полученных результатов исследования подтверждается достаточным числом участников исследования, корректным формированием обследованных групп пациентов по полу, возрасту и индексу массы тела, использованием современных молекулярно-генетических методов исследования и успешным применением генетико-статистического и биоинформатического анализа биомедицинских данных. Материалы диссертационного исследования доложены и опубликованы на V-ой научно-практической конференции «Актуальные вопросы высокотехнологичной помощи в терапии» (Санкт -Петербург, 20-21 мая 2021); I Всероссийском научном форуме «Генетические ресурсы России» конференции молодых ученых "Генофонд и репродуктивное здоровье человека" (Санкт - Петербург, 22-23 июня 2022); 1 Международной научно-практическая онлайн-конференции, посвященной 90-летию со дня рождения профессора Л.Г. Прокопенко «Прокопенковские чтения» (Курск, 24 мая 2022); 87 Международной научной конференции студентов и молодых ученых «Молодежная наука и современность» (Курск, 20-21 апреля 2022); 88 Международной научной конференции студентов и молодых ученых «Молодежная наука и современность» (Курск, 20-21апреля 2023); конгрессе с
международным участием «Молекулярная диагностика и биобезопасность — 2023» (Москва, 27-28 апреля 2023); III конференции по лечению и диагностике сахарного диабета «Фундаментальная и клиническая диабетология в 21 веке: от теории к практике» (Москва, 25-26 мая 2023).
По теме диссертации опубликовано 13 печатных работ, из них 6 статей в научных изданиях, включенных в мировые базы данных научного цитирования Web of Science/Scopus.
Личный вклад автора
Лично диссертантом проведен анализ отечественных и зарубежных источников литературы по теме диссертации. Диссертант самостоятельно проводил выделение образцов ДНК, разработал дизайн мультиплексной панели для генотипирования на времяпролетном масс-спектрометре MassArray-4, выполнил генотипирование 30 полиморфных вариантов ГРФБ и 5 полиморфных вариантов генов UPR. Диссертант лично проводил статистическую обработку данных, используя современные генетико-статистические и биоинформатические ресурсы, самостоятельно интерпретировал.
Структура и объем диссертации
Материалы диссертации изложены на 191 странице текста компьютерного набора, иллюстрированного 27 таблицами и 5 рисунками, и снабжены приложениями на 76 страницах. Диссертация состоит из введения, обзора литературы, материалов и методов исследования, результатов собственных исследований, обсуждения, выводов, списка сокращений, списка литературы и приложения. Библиографический список используемой литературы включает 347 источников, из них - 5 отечественных и 342 зарубежных.
Диссертационное исследование выполнено при финансовой поддержке Российского научного фонда (проекты № 20-15-00227 и № 22-25-00585).
ГЛАВА 1 ОБЗОР ЛИТЕРАТУРЫ
1.1 Современные представления об этиологии и патогенетических механизмах развития сахарного диабета 2 типа
Сахарный диабет - одна из глобальных проблем здравоохранения в 21 веке (Sun H. et al., 2022). По данным Международной диабетической федерации (IDF) в мире на 2021 год сахарным диабетом страдают 537 млн. человек в возрасте 2079 лет (распространенность 10,5%), а к 2045 г это число увеличится до 783 млн. (распространенность 12,2 %) (Sun H. et al., 2022). При этом Россия находится на втором месте среди всех европейских стран по количеству больных диабетом, 90% из которых составляют больные диабетом 2 типа (СД2) (Sun H. et al., 2022).
Согласно данным множества исследований, сахарный диабет 2 типа характеризуется снижением чувствительности периферических тканей к инсулину и нарушением выработки инсулина поджелудочной железой (Goldstein B. J. et al., 2002; Stumvoll M., 2005; McCarthy M., Menzel S., 2019; Galicia-Garcia U. et al., 2020). Современные исследования дополнили концепцию патогенеза СД2, и она включает уменьшение синтеза гормонов желудочно-кишечного тракта инкретинов, усиление всасывания глюкозы в кишечнике, увеличение продукции глюкозы печенью и почками, усиление секреции глюкагона островками Лангерганса и повышение реабсорбции глюкозы почками (DeFronzo R.A., 2009; McCarthy et al., 2019; Roden M., Shulman G. I., 2019; Wysham C., Shubrook J., 2020). Все эти факторы способствуют развитию хронической гипергликемии и нарушению практически всех видов обмена в организме. Инсулинрезистентность приводит к увеличению выработки глюкозы печенью и снижению поглащения глюкозы жировой тканью и скелетными мышцами, способствуя накоплению глюкозы в кровотоке (Fuchsberger C. et al., 2016). Однако по данным большинства исследований, хроническая гипергликемия является следствием дисфункции ß-клеток поджелудочной железы, проявляющейся градиентным снижением секреции инсулина в ответ на глюкозу (Campbell J.E. et al., 2021). При СД2
гистология островков поджелудочной железы включает ~ 40% сниженной массы ß-клеток (диапазон 25-60%), повышенный апоптоз ß-клеток, большее отложение амилоидного белка и пониженное содержание инсулина в поджелудочной железе по сравнению с таковым в островках поджелудочной железы без диабета (Rahier J. et al., 2008; Hanley S. C. et al., 2010). Амилоидные отложения образуются из островкового амилоидного полипептида (IAPP), и агрегаты IAPP могут вызывать стресс эндоплазматического ретикулума (Raleigh D. et al., 2017). Таким образом, учитывая, что функция ß-клеток существенно снижается при возникновении диабета 2 типа и затем снижается на ~ 80% в процессе прогрессирования заболевания (Eizirik D. L. et al., 2020), можно сделать вывод, что дисфункция ß-клеток является ранним звеном в патогенезе СД2 и возникает независимо от потери ß-клеток. Для обеспечения надлежащей функции ß-клеток необходимо обеспечить целостность клеток, а механизмы и пути, участвующие в физиологии ß-клеток, должны быть строго отрегулированы (Khater S. I. et al., 2022).
Хорошо известно, что СД2 является мультифакториальным заболеванием, в основе которого лежат генетические и средовые факторы (McCarthy M. et al., 2016; Fuchsberger C. et al., 2016; Ismail L. et al., 2021;). Индивидуальная предрасположенность к СД2 определяется не модифицируемыми факторами риска, такими как этническая принадлежность, пол, возраст и семейный анамнез, а определенно имеет генетическую основу, тем не менее, эпидемиологические данные свидетельствуют о том, что многих случаев СД2 можно избежать посредством влияния на модифицируемые факторы риска (Schellenberg E.S. et al., 2013). Среди таких факторов ведущее место занимают избыточное употребление высококалорийной пищи (в особенности углеводов, жиров) и малоподвижный образ жизни. По данным последних исследований, к факторам риска также относится дефицит белка, растительной пищи, клетчатки, наличие хронического стресса и курение (Bi Y. et al., 2012; Ismail L. et al., 2021; Azarova I. et al., 2021).
По данным многих исследований, одним из ключевых факторов риска СД2 является ожирение — сложное метаболическое заболевание, которое связано с чрезмерным количеством жира в организме, изветсное как индекс массы тела -
ИМТ выше 30 кг/м2 (Malone J. I. et al., 2018). Абдоминальное ожирение ассоциируется с наличием воспаления, которое может снижать чувствительность к инсулину и приводить к инсулинорезистентности, нарушая функцию Р-клеток, что представляет собой первый шаг в патогенезе СД2 и служит фактором развития СД2 независимо от ИМТ (Ismail L. et al., 2021). Посчитано, что ожирение первой степени увеличивает риск СД2 в 2 раза, второй степени - в 5 раз, третьей степени - более чем в 10 раз (Аметов А.С., 2013). Интересно, что риск СД2 увеличивается в 8 раз при объеме талии более 80 см и увеличивается в 20 раз при объеме талии более 96 см (Malone J. I. et al., 2018).
Сидячий или малоподвижный образ жизни является еще одним сильнейшим фактором риска развития СД2. Как показано в исследованиях «Women's Health Study» и «Kuipio» у людей, занимающихся ходьбой 2-3 часа в неделю, происходит снижение риска развития СД2 на 34% и 56% соответственно (Gill J. M. R. et al., 2008; Llavero-Valero M. et al., 2021).
По данным исследований последних лет, установлено, что химические факторы окружающей среды также могут являться причиной развития сахарного диабета 2 типа (Dendup T. et al., 2018; Bilal U. et al., 2018; Fouladi F. et al., 2020). Несколькими крупными мета-анализами установлена связь органических загрязнителей (Wu H. et al., 2013), пестицидов (Evangelou E. et al., 2016) и тяжелых металлов (Misra B.B. et al., 2020) с повышенным риском развития диабета 2 типа. Так же, было показано, что загрязнение воздуха (1,08-1,10 мкг/м3 для твердых частиц размером менее 2,5 мкм (PM2,5), 1,10-1,12 мкг/м3 для твердых частиц размером менее 10 мкм (PM10) и 1,05-1,08 мкг/м3 для диоксида азота (NO2) может влиять на изменение функции эндотелия, а также ассоциировано с воспалением, инсулинорезистентностью, изменением микробиоты кишечника и повышенным риском СД2 (Dendup T. et al., 2018; Fouladi F. et al., 2020).
Кроме того, фактором риска в условиях быстрой глобализации и социально-экономического развития является курение и злоупотребление алкоголем. Показано, что активное курение положительно коррелирует с повышенным
риском развития диабета 2 типа (Willi C. et al., 2007; Yuan S., Larsson S.C., 2020). По сравнению с некурящими, у курильщиков риск развития диабета увеличен на 45% (Sliwinska-Mosson M. et al., 2017). Что касается употребления алкоголя, мета-анализ, включающий исследования за 12 лет и общей численностью 369 862 человек показал, что по сравнению с людьми, злоупотребляющими алкоголем (>48 г/день спирта) или людьми, не употребляющими алкоголь, умеренно пьющие (потребляющие от 6 до 48 г/день) имели на 30-40% ниже риск развития СД2 (Koppes L. L. et al., 2005). В работе Jin с соавторами (Jin L. N. et al., 2012) установлено, что риск развития диабета 2 типа у лиц, злоупотребляющих алкоголем, равен риску у людей, совсем не употребляющих алкоголь. Предполагается, что защитные эффекты умеренного употребления алкоголя в отношении риска СД2 связаны с улучшением чувствительности тканей к инсулину, повышением уровня холестерина липопротеидов высокой плотности и адипонектина, а также снижением уровня системного воспаления (Bi Y, 2012).
Похожие диссертационные работы по специальности «Другие cпециальности», 00.00.00 шифр ВАК
Клинико-генетическое исследование сахарного диабета 2 типа в республике Башкортостан2022 год, кандидат наук Шарипова Ляйсан Фаритовна
МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ОСНОВЫ САХАРНОГО ДИАБЕТА ТИПА 1 И ЕГО ОСЛОЖНЕНИЙ2009 год, кандидат медицинских наук Балхиярова, Жанна Радиковна
Роль полиморфизма генов сосудистых эндотелиальных факторов роста в развитии ишемической болезни сердца среди жителей Центральной России2023 год, кандидат наук Медведева Мария Владиславовна
Клинико-генетические аспекты и прогнозирование диабетической ретинопатии у якутов при сахарном диабете 2-го типа2014 год, кандидат наук Явловская, Любовь Леонидовна
Разработка персонализированной диетотерапии на основе данных молекулярно-генетических исследований и оценки микронутриентного статуса больных сахарным диабетом 2-го типа2015 год, кандидат наук Лапик, Ирина Александровна
Список литературы диссертационного исследования кандидат наук Клёсова Елена Юрьевна, 2024 год
СПИСОК ЛИТЕРАТУРЫ
1. Азарова, Ю. Э. Полиморфный вариант rs4430796 гена HNF1B: пол-специфические, ИМТ-зависимые ассоциации с показателями метаболизма глюкозы, редокс-гомеостаза и риском сахарного диабета 2 типа / Ю. Э. Азарова, Е. Ю. Клёсова, А.В. Полоников // Медицинская генетика. - 2021.
- Т. 20, № 1. - С. 25-36.
2. Азарова, Ю. Э. Комплексное исследование вовлеченности генов ферментов редокс-гомеостаза в развитие сахарного диабета 2 типа и его осложнений: специальность 1.5.7. «Генетика»: автореферат диссертации на соискание ученой степени доктора медицинских наук / Ю. Э. Азарова.
- Белгород, 2022. - 43 с.
3. Аметов, А. С. Комплексная метаболическая протекция как современная стратегия управления сахарным диабетом 2 типа / А. С. Аметов, О. В. Цыганкова // Эндокринология: Новости. Мнения. Обучение. - 2021.
- № 2 (35). - С. 93-104.
4. Бочарова, Ю. А. Комплексная оценка роли полиморфных вариантов генов ферментов метаболизма глутатиона в развитии и клиническом проявлении ишемического инсульта: специальность 03.02.07 «Генетика»: автореферат диссертации на соискание ученой степени кандидата медицинских наук / Ю. А. Бочарова. - Белгород, 2021. - 23 с.
5. Краснова, М. Г. Фолдинг белка и его связь с генетическими заболеваниями / М. Г. Краснова // Актуальные научные исследования в современном мире. - 2020. - № 5-6. - С. 161-165.
6. Цыганкова, О. В. Инкретины сегодня: множественные эффекты и терапевтический потенциал / О. В. Цыганкова, В. В. Веретюк, А. С. Аметов // Сахарный диабет. - 2019. - Т. 22, № 1. - С. 70-78.
7. A Bidirectional Mendelian Randomization Study to evaluate the causal role of reduced blood vitamin D levels with type 2 diabetes risk in South Asians and Europeans / C. A. Bejar, S. Goyal, S. Afzal [et al.] // Nutrition journal. - 2021.
- Vol. 20, Iss. 1. - Art. 71. - URL: https://doi.org/10.1186/s12937-021-00725-1.
8. Active regulator of SIRT1 cooperates with SIRT1 and facilitates suppression of p53 activity / E.J. Kim, J.H. Kho, M.R. Kang [et al.] // Molecular Cell. -2007. - Vol. 28, Iss. 2. - P. 277-290.
9. A prospective study of the association between quantity and variety of fruit and vegetable intake and incident type 2 diabetes / A. J. Cooper, S. J. Sharp, M. A. H. Lentjes [et al.] // Diabetes care. - 2012. - Vol. 35, Iss. 6. - P. 1293-1300.
10.A protein caught in a kinetic trap: structures and stabilities of insulin disulfide isomers / Q.-X. Hua, W. Jia, B. H. Frank [et al.] // Biochemistry. - 2002. -Vol. 41, Iss. 50. - P. 14700-14715.
11.A small molecule UPR modulator for diabetes identified by high throughput screening / V. Marrocco, T. Tran, S. Zhu [et al.] // Acta Pharmaceutica Sinica B. - 2021. - Vol. 11, Iss. 12. - P. 3983-3993.
12.A variant of GRK5 is associated with the therapeutic efficacy of repaglinide in Chinese Han patients with type 2 diabetes mellitus / Z. Shang, F. Han, X. Zhou [et al.] // Drug Development Research. - 2018. - Vol. 79, Iss. 3. - P. 129-135.
13.Aberrant islet unfolded protein response in type 2 diabetes / F. Engin, T. Nguyen, A. Yermalovich, G. S. Hotamisligil // Scientific reports. - 2014. -Vol. 4. - Art. 4054. - URL: https://doi.org/10.1038/srep04054.
14.Absence of BiP Co-chaperone DNAJC3 Causes Diabetes Mellitus and Multisystemic Neurodegeneration / M. Synofzik, T. B. Haack, R. Kopajtich [et al.] // The American Journal of Human Genetics. - 2014. - Vol. 95, Iss. 6. - P. 689-697.
15.Acceleration of disulfide-coupled protein folding using glutathione derivatives / M. Okumura, M. Saiki, H. Yamaguchi, Y. Hidaka // The FEBS journal. -2011. - Vol. 278, Iss. 7. - P. 1137-1144.
16.Activating transcription factor 6 polymorphisms and haplotypes are associated with impaired glucose homeostasis and type 2 diabetes in Dutch Caucasians / S. J. R. Meex, M. M. J. van Greevenbroek, T. A. Ayoubi [et al.] // The Journal
of Clinical Endocrinology & Metabolism. - 2007. - Vol. 92, Iss. 7. - P. 27202725.
17.Activating transcription factor 6 (ATF6) sequence polymorphisms in type 2 diabetes and pre-diabetic traits / W.S. Chu, S.K. Das, H. Wang // Diabetes. -2007. - Vol. 56, Iss. 3. - P. 856-862.
18.Activation of ATF4 triggers trabecular meshwork cell dysfunction and apoptosis in POAG / Y. Ying, R. Xue, Y. Yang [et al.] // Aging (Albany NY).
- 2021. - Vol. 13, Iss. 6. - P. 8628-8642.
19.Active smoking and the risk of type 2 diabetes: a systematic review and metaanalysis / C. Willi, P. Bodenmann, W. A. Ghali [et al.] // JAMA. - 2007. -Vol. 298, Iss. 222. - P. 2654-2664.
20.Adenoviral transfer of HSP-70 into pulmonary epithelium ameliorates experimental acute respiratory distress syndrome / Y. G. Weiss, A. Maloyan, J. Tazelaar [et al.] // The Journal of clinical investigation. - 2002. - Vol. 110, Iss. 6. - P. 801-806.
21.Advanced research on risk factors of type 2 diabetes / Y. Bi, T. Wang, M. Xu [et al.] // Diabetes/metabolism research and reviews. - 2012. - Vol. 28, Suppl. 2. - P. 32-39.
22.Air pollution exposure is associated with the gut microbiome as revealed by shotgun metagenomic sequencing / F. Fouladi, M. J. Bailey, W. B. Patterson [et al.] // Environment international. - 2020. - Vol. 138. - Art. 105604. - URL: https://doi.org/10.1016/j.envint.2020.105604.
23.Alasoo, K. Clinical traits impacting human tissue transcriptomes / K. Alasoo // Cell Genomics. - 2023. - Vol. 3, Iss. 1. - Art. 100245. - URL: https://doi.org/10.1016Zj.xgen.2022.100245.
24.Alcohol Consumption and Cigarette Smoking are Important Modifiers of the Association Between Acute Pancreatitis and the PRSS1-PRSS2 Locus in Men / A. V. Polonikov, T. A. Samgina, P. M. Nazarenko [et al.] // Pancreas. - 2017.
- Vol. 46, Iss. 2. - P. 230-236.
25.Analysis of heat shock protein 70 gene polymorphisms Mexican patients with idiopathic pulmonary fibrosis / A. Aquino-Gálvez, G. González-Ávila, M. Pérez-Rodríguez [et al.] // BMC pulmonary medicine. - 2015. - Vol. 15. - Art. 129. - URL: https://doi.org/10.1186/s12890-015-0127-7.
26.Archer, A. E. Exercise, heat shock proteins and insulin resistance / A. E. Archer, A. T. Von Schulze, P. C. Geiger // Philosophical transactions of the Royal Society of London. Series B, Biological sciences. - 2018. - Vol. 373, Iss. 1738. - Art. 20160529. - URL: https://doi.org/10.1098/rstb.2016.0529.
27.ARD1-mediated Hsp70 acetylation balances stress-induced protein refolding and degradation / J. H. Seo, J. H. Park, E. J. Lee [et al.] // Nature communications. - 2016. - No. 7. - Art. 12882. - URL: https://doi.org/10.1038/ncomms12882.
28.Association and Gene-Gene Interactions Study of Late-Onset Alzheimer's Disease in the Russian Population / A. Bocharova, K. Vagaitseva, A. Marusin [et al.] // Genes (Basel). - 2021. - Vol. 12, Iss. 10. - Art. 1647. - URL: https://doi.org/10.3390/genes12101647.
29.Association between alcohol consumption and metabolic syndrome in 19215 middle-aged and elderly Chinese / L. N. Jin, Y. Huang, Y. Bi [et al.] // Diabetes research and clinical practice. - 2012. - Vol. 92, Iss. 3. - P. 386-392.
30.Association of common genetic variants of KCNJ11 gene with the risk of type 2 diabetes mellitus / A. Malekizadeh, M. Rahbaran, M. Afshari [et al.] //Nucleosides, Nucleotides & Nucleic Acids. - 2021. - Vol. 40, Iss. 5. - P. 530-541.
31.Association of amino acid variants in the activating transcription factor 6 gene (ATF6) on 1q21-q23 with type 2 diabetes in Pima Indians / F. Thameem, V. S. Farook, C. Bogardus, M. Prochazka // Diabetes. - 2006. - Vol. 55, Iss. 3. - P. 839-842.
32.Association of polymorphism in heat shock protein 70 genes with type 2 diabetes in Bangladeshi population / M. Moniruzzaman, I. Ahmed, S. Huq [et
al.] // Molecular genetics & genomic medicine. - 2020. - Vol. 8, Iss. 2. - Art. e1073. - URL: https://doi.org/10.1002/mgg3.1073.
33.Association of heat shock protein polymorphisms with patient susceptibility to coronary artery disease comorbid depression and anxiety in a Chinese population / H. Wang, Y. Ba, W. Han [et al.] //PeerJ. - 2021. - Vol. 9. - P. e11636.
34.Association of HSP90B1 genetic polymorphisms with efficacy of glucocorticoids and improvement of HRQoL in systemic lupus erythematosus patients from Anhui Province / X. X. Sun, S. S. Li, M. Zhang [et al.] //American Journal of Clinical and Experimental Immunology. - 2018. - Vol. 7, Iss. 2. - P. 27.
35.ATF6 is a transcription factor specializing in the regulation of quality control proteins in the endoplasmic reticulum / Y. Adachi, K. Yamamoto, T. Okada [et al.] // Cell structure and function. - 2008. - Vol. 33, Iss. 1. - P. 75-89.
36.Azarova, I. The link between type 2 diabetes mellitus and the polymorphisms of glutathione-metabolizing genes suggests a new hypothesis explaining disease initiation and progression / I. Azarova, E. Klyosova, A. Polonikov // Life. - 2021. - Vol. 11, Iss. 9. - Art. 886. - URL: https://doi.org/10.3390/life11090886.
37.Back, S. H. Endoplasmic reticulum stress and type 2 diabetes / S. H. Back, R. J. Kaufman // Annual review of biochemistry. - 2012. - Vol. 81. - P. 767-793.
38.Baggio, L. L. Biology of incretins: GLP-1 and GIP / L. L. Baggio, D. J. Drucker // Gastroenterology. - 2007. - Vol. 132, Iss. 6. - P. 2131-2157.
39.Bagherion, M. Evaluation of Serum Uric Acid and Glutathione Levels in Diabetic Patients and Healthy Subjects / M. Bagherion, D. Qujeq, G. R. Bakhshi Khaniniki // Iranian Journal of Diabetes and Obesity. - 2013. - Vol. 5, Iss. 4. - P. 157-162.
40.BAG3: a multifaceted protein that regulates major cell pathways / A. Rosati, V. Graziano, V. De Laurenzi [et al.] // Cell Death and Disease. -2011. - Vol. 4, Iss. 4. -P e141. - URL: https://doi: 10.1038/cddis.2011.24.
41.BAG3 regulates formation of the SNARE complex and insulin secretion / V. Iorio, M. Festa, A. Rosati [et al.] // Cell Death and Disease. - 2015. - Vol. 6, Iss. 3. - P. 1684-1695.
42.Bcl-2 and Bcl-xL suppress glucose signaling in pancreatic ß-cells / D. S. Luciani, S. A. White, S. B. Widenmaier [et al.] // Diabetes. -2013. -Vol. 62, Iss. 1. - P. 170-182.
43.Beneficial effects of quercetin on oxidative stress in liver and kidney induced by titanium dioxide (TiO2) nanoparticles in rats / A. E. González-Esquivel, C. L. Charles-Niño, F. P. Pacheco-Moisés [et al.] // Toxicology mechanisms and methods. - 2015. - Vol. 25, Iss. 3. - P. 166-175.
44.Beta cell dedifferentiation induced by IRE1a deletion prevents type 1 diabetes / H. Lee, Y.-S. Lee, Q. Harenda [et al.] // Cell metabolism. - 2020. - Vol. 31, Iss. 4. - P. 822-836.
45.Bengal E., Aviram S., Hayek T. p38 MAPK in glucose metabolism of skeletal muscle: beneficial or harmful? //International journal of molecular sciences. -2020. - T. 21. - №. 18. - C. 6480.
46.Bengal E, Aviram S, Hayek T. p38 MAPK in Glucose Metabolism of Skeletal Muscle: Beneficial or Harmful? Int J Mol Sci. 2020 Sep 4;21(18):6480. doi: 10.3390/ijms21186480.
47.Bhatia, S. Heterogeneity in protein folding and unfolding reactions / S. Bhatia, J. B. Udgaonkar // Chemical Reviews. - 2022. - Vol. 122, Iss. 9. - P. 89118935.
48.Bindra D., Mishra R. K. In pursuit of distinctiveness: Transmembrane nucleoporins and their disease associations / D. Bindra, R. K. Mishra // Frontiers in Oncology. - 2021. - Vol. 11. - P. 784319.
49.Bilal, U. Neighborhood environments and diabetes risk and control / U. Bilal, A. H. Auchincloss, A. V. Diez-Roux // Current diabetes reports. - 2018. - Vol. 18, Iss. 19. - Art. 62. - URL: https://doi.org/10.1007/s11892-018-1032-2.
50.Biosynthesis, structure, and folding of the insulin precursor protein / M. Liu, M. A. Weiss, A. Arunagiri [et al.] // Diabetes, obesity & metabolism. - 2018. -Vol. 20, Suppl. 2. - P. 28-50.
51.BioGPS: building your own mash-up of gene annotations and expression profiles / C. Wu, X. Jin, G. Tsueng [et al.] // Nucleic acids research. - 2016. -Vol. 44, Iss. D1. - P. D313-D316.
52.Both GLP-1 and GIP are insulinotropic at basal and postprandial glucose levels and contribute nearly equally to the incretin effect of a meal in healthy subjects / T. Vilsboll, T. Krarup, S. Madsbad, J. J. Holst // Regulatory peptides. - 2003.
- Vol. 114, Iss. 2-3. - P. 115-121.
53.Boucher, J. Insulin receptor signaling in normal and insulin-resistant states / J. Boucher, A. Kleinridders, C. R. Kahn // Cold Spring Harbor perspectives in biology. - 2014. - Vol. 6, No. 1. - P. a009191.
54.Braakman, I. Protein folding and modification in the mammalian endoplasmic reticulum / I. Braakman, N. J. Bulleid // Annual review of biochemistry. -2011. - Vol. 80. - P. 71-99.
55.Brenner, D. Mitochondrial cell death effectors / D. Brenner, T. W. Mak // Current opinion in cell biology. - 2009. - Vol. 21, Iss. 6. - P. 871-887.
56.Carithers, L. J. The genotype-tissue expression (GTEx) project / L. J. Carithers, H. M. Moore // Biopreservation and biobanking. - 2015. - Vol. 13, Iss. 5. - P. 307-308.
57.Correlation of heat shock protein expression to gender difference in development of stress-induced gastric mucosal injury in rats / T. Takahashi, M. Otaka, M. Odashima [et al.] // Journal of Clinical Biochemistry and Nutrition.
- 2010. - Vol. 47, Iss. 1. - P. 64-73.
58.Chadt, A. Glucose transporters in adipose tissue, liver, and skeletal muscle in metabolic health and disease / A. Chadt, H. Al-Hasani // Pflugers Archiv : European Journal of Physiology. - 2020. - Vol. 472, Iss. 9. - P. 1273-1298.
59.Chakravarthi, S. Glutathione Is Required to Regulate the Formation of Native Disulfide Bonds within Proteins Entering the Secretory Pathway /
S. Chakravarthi, N. Bulleid // The Journal of biological chemistry. - 2004. -Vol. 279, Iss. 38. - P. 39872-39879.
60.Chaperone-assisted degradation: multiple paths to destruction / N. Kettern, M. Dreiseidler, R. Tawo, J. Höhfeld // Biological chemistry. - 2010. - Vol. 391, Iss. 5. - P. 481-489.
61.Chaperone-based therapeutic target innovation: Heat shock protein 70 (HSP70) for Type 2 diabetes mellitus / W. R. W. Mulyani, M. I. D. Sanjiwani, Sandra [et al.] // Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy. -2020. - Vol. 13. - P. 559-568.
62.Chatterjee, S. Type 2 diabetes / S. Chatterjee, K. Khunti, M. J. Davies // Lancet. - 2017. - Vol. 389, Iss. 10085. - P. 2239-2251.
63.Chemoproteomics reveals arctigenin as a phagophore-closure blocker via targeting ESCRT-I subunit VPS28 / J. Han, Y. Yu, S. Li [et al.] // Bioorganic Chemistry. - 2023. - Vol. 134. - Art. 106457. - URL: https://doi.org/10.1016Zj.bioorg.2023.106457.
64.Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes / U. Ozcan, E. Yilmaz, L. Ozcan [et al.] // Science. - 2006. - Vol. 313, Iss. 5790. -P. 1137-1140.
65.Chop deletion reduces oxidative stress, improves ß cell function, and promotes cell survival in multiple mouse models of diabetes / B. Song, D. Scheuner, D. Ron [et al.] // The Journal of Clinical Investigation. - 2008. - Vol. 118, no. 10. - P. 3378-3389.
66.Co-and post-translational protein folding in the ER / L. Ellgaard, N. McCaul, A. Chatsisvili, I. Braakman // Traffic. - 2016. - Vol. 17, Iss. 6. - P. 615-638.
67.Cook, J. P. Multi-ethnic genome-wide association study identifies novel locus for type 2 diabetes susceptibility / J. P. Cook, A. P. Morris // European journal of human genetics. - 2016. - Vol. 24, Iss. 8. - P. 1175-1180.
68.Cooperativity principles in self-assembled nanomedicine / Y. Li, Y. Wang, G. Huang, J. Gao // Chemical reviews. - 2018. - Vol. 118, Iss. 11. - P. 53595391.
69.Corosolic acid, a natural triterpenoid, induces ER stress-dependent apoptosis in human castration resistant prostate cancer cells via activation of IRE-1/JNK, PERK/CHOP and TRIB3 / B. Ma, H. Zhang, Y. Wang [et al.] // Journal of Experimental & Clinical Cancer Research. - 2018. - Vol. 37, Iss. 1. - Art. 210.
- URL: https://doi.org/10.1186/s13046-018-0889-x.
70.Correlation between MTNR1B gene rs10830963 polymorphism and type 2 diabetes mellitus in Gansu Bao-an population / X. E. Shi, X. J. Peng, Z. T. Wang, J. L. Ma // Clinical Focus. - 2015. - Vol. 30. - P. 544-547.
71.Construct validity and the validity of replication studies: A systematic review / J. K. Flake, I. J. Davidson, O.Wong [et al.] //American Psychologist. - 2022. -Vol. 77, Iss. 4 - P. 576.
72.Cigarette smoke induces an unfolded protein response in the human lung: a proteomic approach / S. G. Kelsen, X. Duan, R. Ji [et al.] //American journal of respiratory cell and molecular biology. - 2008. - Vol. 38, Iss. 5. - P. 541-550.
73.Cytoskeleton-Associated Protein 4, a promising biomarker for tumor diagnosis and therapy / S. X. Li, J. Li, L. W. Dong [et al.] // Frontiers in molecular biosciences. - 2021. - Vol. 7. - P. 552056.
74.Critical review: vegetables and fruit in the prevention of chronic diseases / H. Boeing, A. Bechthold, A. Bub [et al.] // European journal of nutrition. - 2012.
- Vol. 51, Iss. 6. - P. 637-663.
75.CREB3L1 and CREB3L2 control Golgi remodelling during decidualization of endometrial stromal cells / D. Pittari, M. Dalla Torre, E. Borini [et al.] // Frontiers in Cell and Developmental Biology. - 2022. - Vol. 10. - P. 986997.
76.Chatterjee, S. Type 2 diabetes / S. Chatterjee, K. Khunti, M. J. Davies // Lancet. - 2017. - Vol. 389, Iss. 10085. - P. 2239-2251.
77.Czech, M. P. Insulin action and resistance in obesity and type 2 diabetes / M. P. Czech // Nature medicine. - 2017. - Vol. 23, Iss. 7. - P. 804-814.
78.Czech, M. P. Mechanisms of insulin resistance related to white, beige, and brown adipocytes / M. P. Czech // Molecular metabolism. - 2020. - Vol. 34. -P. 27-42.
79.Decreased expression of the augmenter of liver regeneration results in increased apoptosis and oxidative damage in human-derived glioma cells / L. Polimeno, B. Pesetti, F. De Santis [et al.] // Cell death & disease. - 2012. -Vol. 3, Iss. 4. - Art. e289. - URL: https://doi.org/10.1038/cddis.2012.25.
80.Decreased insulin secretion and increased risk of type 2 diabetes associated with allelic variations of the WFS1 gene: the data from Epidemiological Study on the Insulin Resistance Syndrome (DESIR) prospective study / N. Cheurfa, G. M. Brenner, A. F. Reis [et al.] // Diabetologia. - 2011. - Vol. 54, Iss. 3. - P. 554-562.
81.Defining the essential function of yeast Hsf1 reveals a compact transcriptional program for maintaining eukaryotic proteostasis / E. J. Solis, J. P. Pandey, X. Zheng [et al.] // Molecular cell. - 2016. - Vol. 63, Iss. 1. - P. 60-71.
82.DeFronzo, R. A. From the triumvirate to the ominous octet: a new paradigm for the treatment of type 2 diabetes mellitus / R. A. DeFronzo // Diabetes. -2009. - Vol. 58, Iss. 4. - P. 773-795.
83.DeFronzo, R. A. Lilly lecture 1987. The triumvirate: Beta-cell, muscle, liver. A collusion responsible for NIDDM / R. A. DeFronzo // Diabetes. - 1988. - Vol. 37, Iss, 6. - P. 667-687.
84.Dhayalan, B. Diabetes-Associated Mutations in Proinsulin Provide a "Molecular Rheostat" of Nascent Foldability / B. Dhayalan, M. A. Weiss // Current Diabetes Reports. - 2022. - Vol. 22, Iss. 2. - P. 85-94.
85.Diacylglycerol-evoked activation of PKC and PKD isoforms in regulation of glucose and lipid metabolism: a review / K. Kolczynska, A. Loza-Valdes, I. Hawro, G. Sumara // Lipids in health and disease. - 2020. - Vol. 19, Iss. 1. -Art. 113.
86.Differential responses of hepatic endoplasmic reticulum stress and inflammation in diet-induced obese rats with high-fat diet rich in lard oil or soybean oil / M. Zhao, B. Zang, M. Cheng [et al.] // PLoS One. - 2013. - Vol. 6, Iss. 8. - P. e78620.
87.Dietary supplementation with curcumin reduce circulating levels of glycogen synthase kinase-3p and islet amyloid polypeptide in adults with high risk of type 2 diabetes and Alzheimer's disease / R. N. Thota, J. I. Rosato, C. B. Dias [et al.] // Nutrients. - 2020. - Vol. 12, Iss. 4. - P. 1032.
88.Dill, K. A. The protein-folding problem, 50 years on / K. A. Dill, J. L. MacCallum // Science. - 2012. - Vol. 338, Iss. 6110. - P. 1042-1046.
89.DNA Hypomethylation of the MPO Gene in Peripheral Blood Leukocytes Is Associated with Cerebral Stroke in the Acute Phase / O. Bushueva, E. Barysheva, A. Markov [et al.] // Journal of molecular neuroscience. - 2021. -Vol. 71, Iss. 9. - P. 1914-1932.
90.DNAJC3 deficiency induces P-cell mitochondrial apoptosis and causes syndromic young-onset diabetes / M. Lytrivi, V. Senée, P. Salpea [et al.] // European journal of endocrinology. - 2021. - Vol. 184, Iss. 3. - P. 455-468.
91.Dobson, C. M. Protein folding and misfolding / C. M. Dobson // Nature. -2003. - Vol. 426, Iss. 6968. - P. 884-890.
92.Double-gene ablation of SSTR1 and SSTR5 results in hyperinsulinemia and improved glucose tolerance in mice / X.P. Wang, M.A. Norman, J. Yang [et al.] // Surgery. - 2004. - Vol. 136, Iss. 3. - P. 585-592.
93.Dual and opposing roles of the unfolded protein response regulated by IRE1alpha and XBP1 in proinsulin processing and insulin secretion / A. H. Lee, K. Heidtman, G. S. Hotamisligil [et al.] // Proceedings of the National Academy of Sciences of the United States of America. - 2011. - Vol. 108, Iss. 21. - P. 8885-8890.
94.Dual role of JNK1-mediated phosphorylation of Bcl-2 in autophagy and apoptosis regulation / Y. Wei, S. Sinha, B. Levine // Autophagy. - 2008. - Vol. 4, Iss. 7. - P. 949-951.
95.Dulin, E. Genetic variations of HSPA1A, the heat shock protein levels, and risk of atherosclerosis / E. Dulin, P. García-Barreno, M. C. Guisasola // Cell stress & chaperones. - 2012. - Vol. 17, Iss. 4. - P. 507-516.
96.Dyson, H. J. The role of hydrophobic interactions in initiation and propagation of protein folding / H. J. Dyson, P. E. Wright, H. A. Scheraga // Proceedings of the National Academy of Sciences. - 2006. - Vol. 103, Iss. 35. - P. 1305713061.
97.Eizirik, D. L. Pancreatic ß-cells in type 1 and type 2 diabetes mellitus: different pathways to failure / D. L. Eizirik, L. Pasquali, M. Cnop // Nature Reviews Endocrinology. - 2020. - Vol. 16, Iss. 7. - P. 349-362.
98.Effects of dietary fatty acids in pancreatic beta cell metabolism, implications in homeostasis / P. Acosta-Montaño, V. García-González // Nutrients. - 2018. -Vol. 10, Iss. 4. - P. 393.
99.Elevated levels of extracellular heat-shock protein 72 (eHSP72) are positively correlated with insulin resistance in vivo and cause pancreatic beta-cell dysfunction and death in vitro / M. Krause, K. Keane, J. Rodrigues-Krause [et al.] // Clinical science. - 2014. - Vol. 126, Iss. 10. - P. 739-752.
100. El-Khairi, R. The role of hepatocyte nuclear factor 1beta in disease and development / R. El-Khairi, L. Vallier // Diabetes, obesity & metabolism. -2016. - Vol. 18, Suppl. 1 - P. 23-32.
101. Emotional regulation and diabetes distress in adults with type 1 and type 2 diabetes / E. F. Coccaro, S. Lazarus, J. Joseph [et al.] // Diabetes Care. -2021. - Vol. 44, Iss. 1. - P. 20-25.
102. Endoplasmic reticulum stress activates autophagy but not the proteasome in neuronal cells: implications for Alzheimer's disease / D. A. Nijholt, T. R. de Graaf, E. S. van Haastert [et al.] // Cell death and differentiation. - 2011. -Vol. 18, Iss. 6. - P. 1071-1081.
103. Endoplasmic reticulum stress alters ryanodine receptor function in the murine pancreatic beta cell / W. R. Yamamoto, R. N. Bone, P. Sohn [et al.] // The Journal of biological chemistry. - 2019. - Vol. 294, Iss. 1. - P. 168-181.
104. Environmental risk factors for developing type 2 diabetes mellitus: a systematic review / T. Dendup, X. Feng, S. Clingan, T. Astell-Burt //
International journal of environmental research and public health. - 2018. -Vol. 15, Iss. 1. - Art. 78. - URL: https://doi.org/10.3390/ijerph15010078.
105. ER stress: Autophagy induction, inhibition and selection / H. O. Rashid, R. K. Yadav, H.-R. Kim, H.-J. Chae // Autophagy. - 2015. - Vol. 11, Iss. 11. -P. 1956-1977.
106. Estrada, E. Universality in protein residue networks / E. Estrada // Biophysical journal. - 2010. - Vol. 98, Iss. 5. - P. 890-900.
107. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update / M. V. Kuleshov, M. R. Jones, A. D. Rouillard [et al.] // Nucleic acids research. - 2016. - Vol. 44, Iss. W1. - P. W90-W97.
108. Evans, C. G. Heat shock protein 70 (hsp70) as an emerging drug target / C. G. Evans, L. Chang, J. E. Gestwicki // Journal of medicinal chemistry. -2010. - Vol. 53, Iss. 12. - P. 4585-4602.
109. Exposure to pesticides and diabetes: a systematic review and meta-analysis / E. Evangelou, G. Ntritsos, M. Chondrogiorgi [et al.] // Environment international. - 2016. - Vol. 91. - P. 60-68.
110. Expression of heat shock protein 72 in renal cell carcinoma: possible role and prognostic implications in cancer patients / M. Santarosa, D. Favaro, M. Quaia, E. Galligioni // European Journal of Cancer. - 1997. - Vol. 33, Iss. 6. - C. 873-877.
111. Exercise Induces an Augmented Skeletal Muscle Mitochondrial Unfolded Protein Response in a Mouse Model of Obesity Produced by a High-Fat Diet / P. Apablaza, J.C. Borquez, R. Mendoza [et al.] // International Journal of Molecular Sciences. - 2023. - Vol. 24, Iss. 6. - P. 54-56.
112. Exercise training with dietary counselling increases mitochondrial chaperone expression in middle-aged subjects with impaired glucose tolerance / M. Venojärvi, S. Aunola, R. Puhke [et al.] // BMC Endocrine Disorders. -2008. - Vol. 8. - P. 1-11.
113. Experimental study of the protective effects of SYVN1 against diabetic retinopathy / S. Yang, H. He, Q.S. Ma [et al.] //Scientific reports. - 2015. -Vol. 5, Iss. 1. - P. 1-11.
114. Extracellular Hsp90a, which participates in vascular inflammation, is a novel serum predictor of atherosclerosis in type 2 diabetes / X. Ding, C. Meng, H. Dong [et al.] // BMJ Open Diabetes Research and Care. - 2022. - Vol. 10, Iss. 1. - Art. e002579. - URL: https://doi.org/10.1136/bmjdrc-2021-002579.
115. Expression profile of mitrogen-activated protein kinase (MAPK) signaling genes in the skeletal muscle & liver of rat with type 2 diabetes: role in disease pathology/ X. Tang, L. Deng, H. Xiong [et al.] // The Indian journal of medical research. - 2014. - Vol. 140, Iss. 6. - P. 744.
116. Farese, R. V. Glycerolipid Synthesis and Lipid Droplet Formation in the Endoplasmic Reticulum / R. V. Farese, T. C. Walther // Cold Spring Harbor Perspectives in Biology. - 2023. - Vol. 15, Isas. 5. - Art. a041246. - URL: https://doi.org/10.1101/cshperspect.a041246.
117. FAM13A and POM121C are candidate genes for fasting insulin: functional follow-up analysis of a genome-wide association study / V. Lundback, A. Kulyte, R.J. Strawbridge [et al.] // Diabetologia. - 2018. - Vol. 61, Iss. 5. - P. 1112-1123.
118. FcgR III Deficiency and FcgRIIb Deficiency Promote Renal Injury in Diabetic Mice / R. Zhang, T. Wang, Q.Yin [et al.] // BioMed Research International. - 2019. - Vol. 2019. - P. 16.
119. Folding of a single domain protein entering the endoplasmic reticulum precedes disulfide formation / P. J. Robinson, M. A. Pringle, C. A. Woolhead, N. J. Bulleid // Journal of Biological Chemistry. - 2017. - Vol. 292, Iss. 17. -P. 6978-6986.
120. Folding of small disulfide-rich proteins: Clarifying the puzzle / J. L. Arolas, F. X. Aviles, J.-Y. Chang, S. Ventura // Trends in biochemical sciences. - 2006. - Vol. 31, Iss. 5. - P. 292-301.
121. Forman, H. J. Glutathione: Overview of its protective roles, measurement, and biosynthesis / H. J. Forman, H. Zhang, A. Rinna // Molecular aspects of medicine. - 2009. - Vol. 30, Iss. 1-2. - P. 1-12.
122. Freeman, A. M. Insulin resistance / A. M. Freeman, N. Pennings. 2022 Sep 20. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan. PMID: 29939616. - URL: https://www.ncbi.nlm.nih.gov/books/NBK507839/.
123. Frequency and characteristics of MODY 1 (HNF4A mutation) and MODY 5 (HNF1B mutation): analysis from the DPV database / K. Warncke, S. Kummer, K. Raile [et al.] // The Journal of Clinical Endocrinology & Metabolism. - 2019. - Vol. 104, Iss. 3. - P. 845-855.
124. Fruit consumption and risk of type 2 diabetes: results from three prospective longitudinal cohort studies / I. Muraki, F. Imamura, J. E. Manson [et al.] // BMJ. - 2013. - Vol. 347. - Art. f5001. - URL: https://doi.org/10.1136/bmj .f5001.
125. Functional SNPs in HSPA1A gene predict risk of coronary heart disease / M. He, H. Guo, X. Yang [et al.] // PLoS One. - 2009. - Vol. 4, Iss. 3. - Art. e4851. - URL: https://doi.org/10.1371/journal.pone.0004851.
126. G Protein-coupled receptor kinases phosphorylate LRP6 in the Wnt pathway / M. Chen, M. Philipp, J. Wang [et al.] // Journal of Biological Chemistry. - 2009. - Vol. 284, Iss. 50. - P. 35040-35048.
127. Gastaldelli, A. Role of Adipose Tissue Insulin Resistance in the Natural History of Type 2 Diabetes: Results From the San Antonio Metabolism Study / A. Gastaldelli, M. Gaggini, R. A. DeFronzo // Diabetes. - 2017. - Vol. 66, Iss. 4. - P. 815-822.
128. Gene expression profiles of Beta-cell enriched tissue obtained by laser capture microdissection from subjects with type 2 diabetes / L. Marselli, J. Thorne, S. Dahiya [et al.] // PloS one. - 2010. - Vol. 5, Iss. 7. - Art. e11499. - URL: https://doi.org/10.1371/j ournal.pone.0011499.
129. GeneCaRNA: a comprehensive gene-centric database of human non-coding RNAs in the GeneCards Suite / R. Barshir, F. Fishilevich, T. Iny-Stein [et al.] // Journal of molecular biology. - 2021. - Vol. 433, Iss. 11. - Art. 166913. - URL: https://doi.org/10.1016/jjmb.2021.166913 (date of the application: 17.04.2023).
130. Genetic Associations of Primary Angle-Closure Disease: A Systematic Review and Meta-analysis / S. S. Rong, F. Y. Tang, W. K. Chu [et al.] // Ophthalmology. - 2016. - Vol. 123, Iss. 6. - P. 1211-1221.
131. Genetic interaction of Hsp70 family genes polymorphisms with high-altitude pulmonary edema among Chinese railway constructors at altitudes exceeding 4000 meters / Y. Qi, W. Q. Niu, T. C. Zhu [et al.] // Clinica chimica acta. - 2009. - Vol. 405, Iss. 1-2. - P. 17-22.
132. Genetic map of regional sulcal morphology in the human brain from UK biobank data / B. B. Sun, S. J. Loomis, F. Pizzagalli [et al.] // Nature Communications. - 2022. - Vol. 13, Iss. 1. - Art. 6071. - URL: https://doi.org/10.1038/s41467-022-33829-1.
133. Genetic studies of body mass index yield new insights for obesity biology / A. E. Locke, B. Kahali, S. I. Berndt [et al.] // Nature. - 2015. - Vol. 518, Iss. 7538. - P. 197-206.
134. Genetic variation in KCNQ1 associates with fasting glucose and beta-cell function: a study of 3734 subjects comprising three ethnicities living in Singapore / J. T. Tan, S. Nurbaya, D. Gardner [et al.] // Diabetes. - 2009. -Vol. 58, Iss. 6. - P. 1445-1449.
135. Genome-wide association study of the modified stumvoll insulin sensitivity index identifies BCL2 and FAM19A2 as novel insulin sensitivity loci / G. A. Walford, S. Gustafsson, D. Rybin [et al.] // Diabetes. - 2016. -Vol. 65, Iss. 10. - P. 3200-3211.
136. Genome-wide trans-ancestry meta-analysis provides insight into the genetic architecture of type 2 diabetes susceptibility / A. Mahajan, M. J. Go, W. Zhang [et al.] // Nature genetics. - 2014. - Vol. 46, Iss. 3. - P. 234-244.
137. Genetic mechanisms leading to sex differences across common diseases and anthropometric traits / M. Traglia, D. Bseiso, A. Gusev // Genetics. - 2017. - Vol. 205, Iss. 2. - P. 979-992.
138. Gender specific differences in disease susceptibility: the role of epigenetics / L. Migliore, V. Nicoli, A. Stoccoro // Biomedicines. - 2021. -Vol. 9, Iss. 6. - P. 652.
139. Giffard, R. G. Many mechanisms for hsp70 protection from cerebral ischemia / R. G. Giffard, M. A. Yenari // Journal of neurosurgical anesthesiology. - 2004. - Vol. 16, Iss. 1. - P. 53-61.
140. Gill, J. M. R. Physical activity and prevention of type 2 diabetes mellitus / J. M. R. Gill, A. R. Cooper // Sports Medicine. - 2008. - Vol. 38, Iss. 10. - P. 807-824.
141. Glutathione metabolism in type 2 diabetes and its relationship with microvascular complications and glycemia / F. K. Lutchmansingh, J. W. Hsu, F. I. Bennett [et al.] // PLoS One. - 2018. - Vol. 13, Iss. 6. - Art. e0198626. -URL: https://doi.org/10.1371/journal.pone.0198626.
142. Glutathione prevents chronic oscillating glucose intake-induced P-cell dedifferentiation and failure / J. Zhang, H. An, K. Ni [et al.] // Cell death & disease. - 2019. - Vol. 10, Iss. 4. - Art. 321. - URL: https://doi.org/10.1038/s41419-019-1552-y.
143. Glutathione synthesis is diminished in patients with uncontrolled diabetes and restored by dietary supplementation with cysteine and glycine / R. V. Sekhar, S. V. McKay, S. G. Patel [et al.] // Diabetes Care. - 2011. -Vol. 34, Iss. 1. - P. 162-167.
144. Glutathione degradation by the alternative pathway (DUG pathway) in Saccharomyces cerevisiae is initiated by (Dug2p-Dug3p) 2 complex, a novel glutamine amidotransferase (GATase) enzyme acting on glutathione / H. Kaur, D. Ganguli, A. K. Bachhawat [et al.] // Journal of Biological Chemistry. -2012. - Vol. 287, Iss. 12. - P. 8920-8931.
145. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas / P. Saeedi, I. Petersohn, P. Salpea [et al.] // Diabetes research and clinical practice. - 2019. - Vol. 157. - Art. 107843. - URL: https://doi.org/10.1016Zj.diabres.2019.107843 (date of the application: 27.12.2020).
146. Goldstein, B. J. Insulin resistance as the core defect in type 2 diabetes mellitus / B. J. Goldstein // The American journal of cardiology. - 2002. - Vol. 90, Iss. 5, Suppl. 1. - P. 3-10.
147. Goodarzi, M. O.Genetics insights in the relationship between type 2 diabetes and coronary heart disease / Goodarzi M. O., Rotter J. I. // Circulation research. - 2020. - T. 126. - №. 11. - C. 1526-1548.
148. Grandpaternal-induced transgenerational dietary reprogramming of the unfolded protein response in skeletal muscle / P. S. Alm, T. de Castro Barbosa, R. Barres [et al.] //Molecular metabolism. - 2017. - Vol. 6, Iss. 7. - P. 621630.
149. GRK5 intronic (CA) n polymorphisms associated with type 2 diabetes in Chinese Hainan Island / Z. Xia, T. Yang, Z. Wang [et al.] // PLoS One. - 2014. - Vol. 9, Iss. 3. - Art. e90597. - URL: https://doi.org/10.1371/journal.pone.0090597.
150. GRP78 overproduction in pancreatic beta cells protects against high-fat-diet-induced diabetes in mice / T. Teodoro-Morrison, I. Schuiki, L. Zhang // Diabetologia. - 2013. - Vol. 56, Iss. 3. - P. 1057-1067.
151. Gupta, A. HSP70 and HSP90 in neurodegenerative diseases / A. Gupta, A. Bansal, K. Hashimoto-Torii // Neuroscience letters. - 2020. - Vol. 716. - Art. 134678. - URL: https://doi.org/10.1016/j.neulet.2019.134678.
152. Hartl, F. U. Molecular chaperones in protein folding and proteostasis / F. U. Hartl, A. Bracher, M. Hayer-Hartl // Nature. - 2011. - Vol. 475, No. 7356. - P. 324-332.
153. Hayden, M. R. An immediate and long-term complication of COVID-19 may be type 2 diabetes mellitus: the central role of P-cell dysfunction, apoptosis and exploration of possible mechanisms / M. R. Hayden // Cells. -2020. - Vol. 9, Iss. 11. - Art. 2475. - URL: https://doi.org/10.3390/cells9112475.
154. Heat shock protein 90 in neurodegenerative diseases / W. Luo, W. Sun, T. Taldone [et al.] // Molecular neurodegeneration. - 2010. - Vol. 5. - Art. 24. - URL: https://doi.org/10.1186/1750-1326-5-24.
155. Heat shock proteins and heat therapy for type 2 diabetes: pros and cons / M. Krause, M. S. Ludwig, T. G. Heck, H. K. Takahashi // Current Opinion in Clinical Nutrition & Metabolic Care. - 2015. - Vol. 18, Iss. 4. - P. 374-380.
156. Heat-shock protein 70 gene polymorphism is associated with the severity of diabetic foot ulcer and the outcome of surgical treatment / K.A. Mir, S. Pugazhendhi, M.J. Paul [et al.] // Journal of British Surgery. - 2009. - Vol. 96, Iss. 10. - P. 1205-1209.
157. Hermouet, S. The JAK2 46/1 haplotype: a marker of inappropriate myelomonocytic response to cytokine stimulation, leading to increased risk of inflammation, myeloid neoplasm, and impaired defense against infection? / S. Hermouet, M. Vilaine // Haematologica. - 2011. - Vol. 96, Iss. 11. - P. 15751579.
158. High-fat diet triggers Mallory-Denk body formation through misfolding and crosslinking of excess keratin 8 / O. Kucukoglu, N. Guldiken, Y. Chen [et al.] // Hepatology. - 2014. - Vol. 60, Iss. 1. - P. 169-178.
159. Hetz, C. Mechanisms, regulation and functions of the unfolded protein response / C. Hetz, K. Zhang, R. J. Kaufman // Nature reviews Molecular cell biology. - 2020. - Vol. 21, Iss. 8. - P. 421-438.
160. HSF1 acetylation decreases its transcriptional activity and enhances glucolipotoxicity-induced apoptosis in rat and human beta cells / I. Purwana, J. J. Liu, B. Portha, J. Buteau // Diabetologia. - 2017. - Vol. 60, Iss. 8. -P. 1432-1441.
161. HspB8 chaperone activity toward poly (Q)-containing proteins depends on its association with Bag3, a stimulator of macroautophagy / S. Carra, S..J Seguin, H. Lambert [et al.] // Journal of Biological Chemistry. - 2008. - Vol. 283, Iss. 3. - P. 1437-1444.
162. HSP40 proteins use class-specific regulation to drive HSP70 functional diversity / O. Faust, M. Abayev-Avraham, A. S. Wentink [et al.] // Nature. -2020. - Vol. 587, Iss. 7834. - P. 489-494.
163. HSP72 is a mitochondrial stress sensor critical for Parkin action, oxidative metabolism, and insulin sensitivity in skeletal muscle / B. G. Drew, V. Ribas, J. A. Le [et al.] // Diabetes. - 2014. - Vol. 63, Iss. 5. - P. 1488-1505.
164. Hu Y. et al. Endoplasmic reticulum-associated degradation (ERAD) has a critical role in supporting glucose-stimulated insulin secretion in pancreatic ß-cells / Y. Hu, Y. Gao, M. Zhang [et al.] // Diabetes. - 2019. - Vol. 68, Iss. 4. - P. 733-746.
165. Human islet amyloid polypeptide (hIAPP)-a curse in type II diabetes mellitus: insights from structure and toxicity studies / A. K. Bishoyi, P. H. Roham, K. Rachineni [et al.] // Biological chemistry. - 2021. - Vol. 402, Iss. 2. - P. 133-153.
166. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response / K. Haze, T. Okada, H. Yoshida [et al.] // The Biochemical journal. - 2001. -Vol. 355, Pt. 1. - P. 19-28.
167. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045 / H. Sun, P.Saeedi, S. Karuranga [et al.] // Diabetes research and clinical practice. - 2022. - Vol. 183. - P. 109119.
168. Impact of type 2 diabetes susceptibility variants on quantitative glycemic traits reveals mechanistic heterogeneity / A. S. Dimas, V. Lagou, A. Barker [et al.] // Diabetes. - 2014. - Vol. 63, Iss. 6. - P. 2158-2171.
169. Impaired synthesis contributes to diabetes-induced decrease in liver glutathione / A. L. Furfaro, M. Nitti, B. Marengo [et al.] // International journal of molecular medicine. - 2012. - Vol. 29, Iss. 5. - P. 899-905.
170. InS-gene Mutations: From Genetics and Beta Cell Biology to Clinical Disease / M. Liu, J. Sun, J. Cui [et al.] // Molecular aspects of medicine. -2015. - Vol. 42. - P. 3-18.
171. Intact protein folding in the glutathione-depleted endoplasmic reticulum implicates alternative protein thiol reductants / S. Tsunoda, E. Avezov, A. Zyryanova [et al.] // eLife. - 2014. - Vol. 3. - Art. e03421. - URL: https://doi.org/10.7554/eLife.03421.
172. Increased serum HSP70 levels are associated with the duration of diabetes/ M. Nakhjavani, A. Morteza, L. Khajeali [et al.] // Cell Stress and Chaperones. - 2010. - Vol. 15. - P. 959-964.
173. Investigating the causes for decreased levels of glutathione in individuals with type II diabetes / M. Lagman, J. Ly, T. Saing [et al.] // PloS One. - 2015. - Vol. 10, Iss. 3. - Art. e0118436. - URL: https://doi.org/10.1371/journal.pone.0118436.
174. Ionescu-Tirgoviste, C. Proinsulin, proamylin and the beta cell endoplasmic reticulum: The key for the pathogenesis of different diabetes phenotypes / C. Ionescu-Tirgoviste, C. Guja // Proceedings of the Romanian Academy - Series B. - 2007. - No. 2. - P. 113-139.
175. Ismail, L. Association of risk factors with type 2 diabetes: A systematic review / L. Ismail, H. Materwala, J. Al Kaabi // Computational and Structural Biotechnology Journal. - 2021. - Vol. 19. - P. 1759-1785.
176. Janssen, J. A. Hyperinsulinemia and its pivotal role in aging, obesity, type 2 diabetes, cardiovascular disease and cancer / J. A. Janssen // International journal of molecular sciences. - 2021. - Vol. 22, Iss. 15. - Art. 7797.
177. Jezek, P. Contribution of oxidative stress and impaired biogenesis of pancreatic P-cells to type 2 diabetes / P. Jezek, M. Jaburek, L. Plecita-Hlavata // Antioxidants & redox signaling. - 2019. - Vol. 31, Iss. 10. - P. 722-751.
178. Jia, Y. Significance of functional GRP78 polymorphisms in predicting the onset of type 2 diabetic peripheral neuropathy in Chinese population / Y. Jia, Y. Tong, L. Min // Neurological research. - 2015. - Vol. 37, Iss. 8. - P. 683-687.
179. Jin, T. Current knowledge on the role of Wnt signaling pathway in glucose homeostasis / T. Jin // Molecular nutrition and diabetes. - Toronto, 2016. - Chapter 29. - P. 357-369.
180. Kalkan, I. H. The relationship between the level of glutathione, impairment of glucose metabolism and complications of diabetes mellitus / I. H. Kalkan, M. Suher // Pakistan journal of medical sciences. - 2013. - Vol. 29, Iss. 4. - P. 938-942.
181. Kampinga, H. H. The HSP70 chaperone machinery: J proteins as drivers of functional specificity / H. H. Kampinga, E. A. Craig // Nature reviews. Molecular cell biology. - 2010. - Vol. 11, Iss. 8. - P. 579-592.
182. Kabachinski G., Schwartz T. U. The nuclear pore complex-structure and function at a glance / G. Kabachinski, T. U. Schwartz //Journal of cell science. - 2015. - Vol. 128, Iss. 3. - P. 423-429.
183. Kaneko, Y. K. Diacylglycerol signaling pathway in pancreatic P-cells: an essential role of diacylglycerol kinase in the regulation of insulin secretion / Y. K. Kaneko, T. Ishikawa // Biological and Pharmaceutical Bulletin. - 2015. -Vol. 38, Iss. 5. - P. 669-673.
184. Katzmann, D. J. Receptor downregulation and multivesicular-body sorting / D. J. Katzmann, G. Odorizzi, S. D. Emr // Nature reviews Molecular cell biology. - 2002. - Vol. 3, Iss. 12. - P. 893-905.
185. Kavanagh, K. Tissue-specific regulation and expression of heat shock proteins in type 2 diabetic monkeys / K. Kavanagh, L. Zhang, J. D. Wagner // Cell stress and chaperones. - 2009. - Vol. 14, Iss. 3. - P. 291-299.
186. Kriegler, T. Translocon-associated protein complex (TRAP) is crucial for co-translational translocation of pre-proinsulin / T. Kriegler, G. Kiburg, T. Hessa // Journal of molecular biology. - 2020. - Vol. 432, Iss. 24. -Art. 166694. - URL: https://doi.org/10.1016/jjmb.2020.10.028.
187. Kubisch, C. H. Endoplasmic reticulum stress and the pancreatic acinar cell / C. H. Kubisch, C. D. Logsdon // Expert review of gastroenterology & hepatology. - 2008. - Vol. 2, Iss. 2. - P. 249-260.
188. Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes / A. P. Morris, B. F. Voight, T. M. Teslovich [et al.] // Nature genetics. - 2012. - Vol. 44, Iss. 9. - P. 981-990.
189. Lee, J. H. Endoplasmic reticulum (ER) stress and its role in pancreatic P-cell dysfunction and senescence in type 2 diabetes / J. H. Lee, J. Lee // International Journal of Molecular Sciences. - 2022. - Vol. 23, Iss. 9. -Art. 4843. - URL: https://doi.org/10.3390/ijms23094843.
190. Li, Y. Melatonin receptor 1B gene rs10830963 C/G polymorphism associated with type 2 diabetes mellitus: An updated meta-analysis of 13,752 participants / Y. Li, H. Wang, Y. Zhang // Heliyon. - 2022. - Vol. 8, Iss. 11. -Art. e11786. - URL: https://doi.org/10.1016Zj.heliyon.2022.e11786.
191. Li, X. SIRT1 and energy metabolism / X. Li //Acta Biochim Biophys Sin. - 2013. - Vol. 45, Iss. 1. - P. 51-60.
192. Lifestyle interventions for patients with and at risk for type 2 diabetes: A systematic review and meta-analysis / E. S. Schellenberg, D. M. Dryden, B. Vandermeer [et al.] // Annals of internal medicine. - 2013. - Vol. 159, Iss. 8. - P. 543-551.
193. Lima, J. E. B. F. Mechanisms underlying the pathophysiology of type 2 diabetes: From risk factors to oxidative stress, metabolic dysfunction, and hyperglycemia / J. E. B. F. Lima, N. C. S. Moreira, E. T. Sakamoto-Hojo // Mutation Research/Genetic Toxicology and Environmental Mutagenesis. -
2022. - Vol. 874-875. - Art. 503437. - URL: https://doi.org/10.1016Zj.mrgentox.2021.503437.
194. Linear ubiquitination prevents inflammation and regulates immune signalling / B. Gerlach, S. M. Cordier, A. C. Schmukle [et al.] // Nature. -2011. - Vol. 471, Iss. 7340. - P. 591-596.
195. Liu, Y. The relationship between polymorphism in MTNR1B gene and type 2 diabetes mellitus in Han people in Ningxia : Master Thesis / Y. Liu. -Ningxia : Ningxia Medical University, 2011. - p. 11.
196. Logsdon, C. D. The role of protein synthesis and digestive enzymes in acinar cell injury / C. D. Logsdon, B. Ji // Nature reviews. Gastroenterology & hepatology. - 2013. - Vol. 10, Iss. 6. - P. 362-370.
197. LOXL2 drives epithelial-mesenchymal transition via activation of IRE1-XBP1 signalling pathway / E. P. Cuevas, P. Eraso, M. J. Mazon [et al.] // Scientific reports. - 2017. - Vol. 7. - Art. 44988. - URL: https://doi.org/10.1038/srep44988.
198. Lu, J. The thioredoxin superfamily in oxidative protein folding / J. Lu, A. Holmgren // Antioxidants & redox signaling. - 2014. - Vol. 21, Iss. 3. - P. 457-470.
199. Luengo, T. M. The Hsp70-Hsp90 chaperone cascade in protein folding / T. M. Luengo, M. P. Mayer, S. G. D. Rüdiger // Trends in cell biology. - 2019.
- Vol. 29, Iss. 2. - P. 164-177.
200. LncRNA HSPA7 in human atherosclerotic plaques sponges miR-223 and promotes the proinflammatory vascular smooth muscle cell transition / S.J. Ann, H. Bang, C.J. Lee [et al.] // Experimental and Molecular Medicine. -2021. - Vol. 53, Iss. 12. - P. 1842-1849.
201. Mao Z. Role of mTOR in Glucose and Lipid Metabolism / Z. Mao, W. Zhang // International journal of molecular sciences. - 2018. - Vol. 19, No. 7.
- P. 2043.
202. Malone J. I., Hansen B. C. Does obesity cause type 2 diabetes mellitus (T2DM)? Or is it the opposite? / J. I. Malone, B. C. Hansen // Pediatric diabetes. - 2019. - Vol. 20, Iss. 1. - P. 5-9.
203. Mammalian heat shock response and mechanisms underlying its genome-wide transcriptional regulation / D. B. Mahat, H. H. Salamanca, F. M. Duarte [et al.] // Molecular cell. - 2016. - Vol. 62, Iss. 1. - P. 63-78.
204. Mayer, M. P. Recent advances in the structural and mechanistic aspects of Hsp70 molecular chaperones / M. P. Mayer, L. M. Gierasch // The Journal of biological chemistry. - 2019. - Vol. 294, Iss. 6. - P. 2085-2097.
205. McCarthy, M. The genetics of type 2 diabetes / M. McCarthy, S. Menzel // British Journal of Clinical Pharmacology. - 2019. - Vol. 51, Iss. 3. - P. 195199.
206. McCarthy, M. I. Genomics, type 2 diabetes, and obesity / M. I. McCarthy // The New England journal of medicine. - 2016. - Vol. 363, Iss. 24. - P. 2339-2350.
207. Mechanisms targeting the unfolded protein response in asthma / S. Dastghaib, P. S. Kumar, S. Aftabi [et al.] // American journal of respiratory cell and molecular biology. - 2021. - Vol. 64, Iss. 1. - P. 29-38.
208. Mechanisms of EGFR-TKI-Induced Apoptosis and Strategies Targeting Apoptosis in EGFR-Mutated Non-Small Cell Lung Cancer / M.D. McKenzie, E.M. Carrington, T. Kaufmann [et al.] // Genes. - 2022. - Vol. 13, Iss. 12. - P. 2183.
209. Misfolded proinsulin in the endoplasmic reticulum during development of beta cell failure in diabetes / A. Arunagiri, L. Haataja, C. N. Cunningham [et al.] // Annals of the New York Academy of Sciences. - 2018. - Vol. 1418, Iss. 1. - P. 5-19.
210. Misra, B. B. The chemical exposome of type 2 diabetes mellitus: opportunities and challenges in the omics era / B. B. Misra, A. Misra // Diabetes & metabolic syndrome. - 2020. - Vol. 14, Iss. 1. - P. 23-38.
211. Mitra, A. The role of intra and inter-molecular disulfide bonds in modulating amyloidogenesis: A review / A. Mitra, N. Sarkar // Archives of Biochemistry and Biophysics. - 2022. - Vol. 716. - Art. 109113. - URL: https://doi.org/10.1016/j.abb.2021.109113.
212. Mitochondria and endoplasmic reticulum in diabetes and its complications / K. U. Lee, R. A. Harris // Experimental Diabetes Research. -2012. - Vol. 2012. - P. 17.
213. Mizushima, N. Autophagy: renovation of cells and tissues / N. Mizushima, M. Komatsu // Cell. - 2011. - Vol. 147, Iss. 4. - P. 728-741.
214. Moderate alcohol consumption lowers the risk of type 2 diabetes: a meta-analysis of prospective observational studies / L. L. J. Koppes, J. M. Dekker, H. F. J. Hendriks [et al.] // Diabetes care. - 2005. - Vol. 28, Iss. 3. - P. 719-725.
215. Molecular interaction between type 2 diabetes and Alzheimer's disease through cross-seeding of protein misfolding / I. Moreno-Gonzalez, G. Edwards III, N. Salvadores [et al.] // Molecular psychiatry. - 2017. - Vol. 22, Iss. 9. - P. 1327-1334.
216. Molecular mechanisms of ROS production and oxidative stress in diabetes / P. Newsholme, V. F. Cruzat, K. N. Keane [et al.] // Biochemical Journal. - 2016. - Vol. 473, Iss. 24. - P. 4527-4550.
217. Molecular mapping of platelet hyperreactivity in diabetes: the stress proteins complex HSPA8/Hsp90/CSK2a and platelet aggregation in diabetic and normal platelets / G. Chiva-Blanch, E. Peña, J. Cubedo [et al.] // Translational Research. - 2021. - Vol. 235. - P. 1-14.
218. Montane, J. Stress and the inflammatory process: a major cause of pancreatic cell death in type 2 diabetes / J. Montane, L. Cadavez, A. Novials // Diabetes, metabolic syndrome and obesity: targets and therapy. - 2014. - Vol. 7. - P. 25-34.
219. Motsinger, A. A. Multifactor dimensionality reduction: an analysis strategy for modelling and detecting gene-gene interactions in human genetics
and pharmacogenomics studies / A. A. Motsinger, M. D. Ritchie // Human genomics. - 2006. - Vol. 2, Iss. 5. - P. 318-328.
220. Moon, S. Endoplasmic Reticulum Stress and Dysregulated Autophagy in Human Pancreatic Beta Cells / S. Moon, H. S. Jung // Diabetes & Metabolism Journal. - 2022. - Vol. 46, Iss. 4. - P. 533-542.
221. Mutations in the liver glycogen synthase gene in children with hypoglycemia due to glycogen storage disease type 0 / M. Orho, N. U. Bosshard, N. R. M. Buist [et al.] // Journal of Clinical Investigation. - 1998. -Vol. 102, Iss. 2. - P. 507-515.
222. mbmdr: an R package for exploring gene-gene interactions associated with binary or quantitative traits / M. L. Calle, V. Urrea, N. Malats, K. Van Steen // Bioinformatics. - 2010. - Vol. 26, Iss. 17. - P. 2198-2199.
223. Nauck, M. A. Treatment of type 2 diabetes: challenges, hopes, and anticipated successes / M. A. Nauck, J. Wefers, J. J. Meier // The Lancet Diabetes & Endocrinology. - 2021. - Vol. 9, Iss. 8. - P. 525-544.
224. Novel GYS2 mutations in a Japanese patient with glycogen storage disease type 0a / H. Iijima, Y. Ago, R. Fujiki [et al.] // Molecular Genetics and Metabolism Reports. - 2021. - Vol. 26. - Art. 100702. - URL: https://doi.org/10.1016/j.ymgmr.2020.100702.
225. New approach for understanding genome variations in KEGG / M. Kanehisa, Y. Sato, M. Furumichi [et al.] // Nucleic acids research. - 2019. -Vol. 47, Iss. D1. - P. D590-D595.
226. Nutritional basis of type 2 diabetes remission / R. Taylor, A. Ramachandran, W. S. Yancy Jr, N. G. Forouhi [et al.] // BMJ. - 2021. -Vol. 374. - Art. n1449. - URL: https://doi.org/10.1136/bmj.n1449.
227. Old and new approaches to target the Hsp90 chaperone / J. Sanchez, T. R. Carter, M. S. Cohen, B. S. J. Blagg // Current cancer drug targets. - 2020. -Vol. 20, Iss. 4. - P. 253-270.
228. OTTERS: a powerful TWAS framework leveraging summary-level reference data / Q. Dai, G. Zhou, H. Zhao [et al.] // Nature Communications. -
2023. - Vol. 14, Iss. 1. - Art. 1271. - URL: https://doi.org/10.1038/s41467-023-36862-w.
229. Oyadomari, S. Endoplasmic reticulum stress-mediated apoptosis in pancreatic P-cells / S. Oyadomari, E. Araki, M. Mori // Apoptosis. - 2002. -Vol. 7, Iss. 4. - P. 335-345.
230. Oleate-induced beta cell dysfunction and apoptosis: a proteomic approach to glucolipotoxicity by an unsaturated fatty acid / M. Maris, E. Waelkens, M. Cnop [et al.] // Journal of proteome research. - 2011. - Vol. 10, Iss. 8. - P. 3372-3385.
231. Pancreatic P-cell failure and diabetes in mice with a deletion mutation of the endoplasmic reticulum molecular chaperone gene P58IPK / W. C. Ladiges, S. E. Knoblaugh, J. F. Morton [et al.] // Diabetes. - 2005. - Vol. 54, Iss. 4. - P. 1074-1081.
232. Pancreatic P-cell mass in European subjects with type 2 diabetes / J. Rahier, Y. Guiot, R. M. Goebbels [et al.] // Diabetes, obesity & metabolism. - 2008. - Vol. 10, Suppl. 4. - P. 32-42.
233. Pandey, V. K. Emerging role of Unfolded Protein Response (UPR) mediated proteotoxic apoptosis in diabetes / V. K. Pandey, A. Mathur, P. Kakkar // Life sciences. - 2019. - Vol. 216. - P. 246-258.
234. Papa, F. R. Endoplasmic reticulum stress, pancreatic P-cell degeneration, and diabetes / F. R. Papa // Cold Spring Harbor perspectives in medicine. -2012. - Vol. 2, Iss. 9. - Art. a007666. - URL: https://doi.org/10.1101/cshperspect.a007666.
235. Pathological P-cell endoplasmic reticulum stress in type 2 diabetes: current evidence / N. Shrestha, E. De Franco, P. Arvan, M. Cnop // Frontiers in endocrinology. - 2021. - Vol. 12. - Art. 650158. - URL: https://doi.org/10.3389/fendo.2021.650158.
236. Pathophysiology of type 2 diabetes mellitus / U. Galicia-Garcia, A. Benito-Vicente, S. Jebari [et al.] // International journal of molecular
sciences. - 2020. - Vol. 21, Iss. 17. - Art. 6275. - URL: https://doi.org/10.3390/ijms21176275.
237. PERK is required in the adult pancreas and is essential for maintenance of glucose homeostasis / Y. Gao, D. J. Sartori, C. Li [et al.] // Molecular and cellular biology. - 2012. - Vol. 32, Iss. 24. - P. 5129-5139.
238. Perry, B. Appetite regulation and weight control: The role of gut hormones / B. Perry, Y. Wang // Nutrition & diabetes. - 2012. - Vol. 2, Iss. 1. - Art. e26. - URL: https://doi.org/10.1038/nutd.2011.21.
239. Persistent or Transient Human P Cell Dysfunction Induced by Metabolic Stress: Specific Signatures and Shared Gene Expression With Type 2 Diabetes / L. Marselli, A. Piron, M. Suleiman [et al.] // Cell reports. - 2020. - Vol. 33, Iss. 9. - Art. 108466. - URL: https://doi.org/10.1016/jxelrep.2020.108466.
240. Persistent organic pollutants and type 2 diabetes: a prospective analysis in the nurses' health study and meta-analysis / H. Wu, K. A. Bertrand, A. L. Choi [et al.] // Environmental health perspectives. - 2013. - Vol. 121, Iss. 2. -P. 153-161.
241. Perspective: Plant-Based Eating Pattern for Type 2 Diabetes Prevention and Treatment: Efficacy, Mechanisms, and Practical Considerations / M. A. Jardine, H. Kahleova, S. M. Levin [et al.] // Advances in nutrition. -2021. - Vol. 12, Iss. 6. - P. 2045-2055.
242. Petersen, K. F. Pathogenesis of skeletal muscle insulin resistance in type 2 diabetes mellitus / K. F. Petersen, G. I. Shulman // The American journal of cardiology. - 2002. - Vol. 90, Iss. 5, Suppl. 1. - P. 11G-18G.
243. Pharmacologic IRE1/XBP1s activation promotes systemic adaptive remodeling in obesity / A. Madhavan, B. P. Kok, B. Rius [et al.] // Nature communications. - 2022. - Vol. 13, Iss. 1. - Art. 608. - URL: https://doi.org/10.1038/s41467-022-28271-2.
244. Potential role of Hsp90 in rat islet function under the condition of high glucose / X. Yang, Y. Zhang, W. Xu [et al.] // Acta diabetologica. - 2016. -Vol. 53, Iss. 4. - P. 621-628.
245. Prodromou, C. Mechanisms of Hsp90 regulation / C. Prodromou // The Biochemical journal. - 2016. - Vol. 473, Iss. 16. - P. 2439-2452.
246. Proinsulin misfolding is an early event in the progression to type 2 diabetes / A. Arunagiri, L. Haataja, A. Pottekat [et al.] // Elife. - 2019. - Vol. 8. - Art. e44532. - URL: https://doi.org/10.7554/eLife.44532.
247. Promoting exercise, reducing sedentarism or both for diabetes prevention: The "Seguimiento Universidad De Navarra" (SUN) cohort / M. Llavero-Valero, J. E. San Martín, M. A. Martínez-González [et al.] // Nutrition, Metabolism and Cardiovascular Diseases. - 2021. - Vol. 31, Iss. 2. -P. 411-419.
248. Proteostasis of islet amyloid polypeptide: A molecular perspective of risk factors and protective strategies for type II diabetes / D. Milardi, E. Gazit, S. E. Radford [et al.] // Chemical Reviews. - 2021. - Vol. 121, Iss. 3. -P. 1845-1893.
249. Physical Activity Associated Proteomics of Skeletal Muscle: Being Physically Active in Daily Life May Protect Skeletal Muscle From Aging / C. Ubaida-Mohien, M. Gonzalez-Freire, A. Lyashkov [et al.] // Frontiers in Physiology. - 2019. - Vol. 10. - P. 312.
250. Quality control autophagy degrades soluble ERAD-resistant conformers of the misfolded membrane protein GnRHR / S. A. Houck, H. Y. Ren, V. J. Madden [et al.] // Molecular cell. - 2014. - Vol. 54, Iss. 1. - P. 166-179.
251. Quercetin modulates Nrf2 and glutathione-related defenses in HepG2 cells: Involvement of p38 / A. B. Granado-Serrano, M. Angeles Martín, L. Bravo [et al.] // Chemico-Biological Interactions. - 2012. - Vol. 195, Iss. 2. - P. 154-164.
252. Radons, J. The human HSP70 family of chaperones: where do we stand? / J. Radons // Cell stress & chaperones. - 2016. - Vol. 21, Iss. 3. - P. 379-404.
253. Radua, J. Meta-analytic methods for neuroimaging data explained / J. Radua, D. Mataix-Cols // Biology of mood and anxiety disorders. - 2012. -Vol. 2, Iss. 1. - P. 1-11.
254. Read, A. The unfolded protein response: An overview / A. Read, M. Schröder // Biology. - 2021. - Vol. 10, Iss. 5. - Art. 384. - URL: https://doi.org/10.3390/biology10050384.
255. Reactome GSA-efficient multi-omics comparative pathway analysis / J. Griss, G. Viteri, K. Sidiropoulos [et al.] // Molecular and cellular proteomics. -2020. - Vol. 19, Iss. 12. - P. 2115-2125.
256. Redox signaling and unfolded protein response coordinate cell fate decisions under ER stress / Z. Zhang, L. Zhang, L. Zhou [et al.] // Redox Biology. - 2019. - Vol. 25. - Art. 101047. - URL: https://doi.org/10.1016Zj.redox.2018.11.005.
257. Reduced Glucose Tolerance and Insulin Resistance Induced by Steroid Treatment, Relative Physical Inactivity, and High-Calorie Diet Impairs the Incretin Effect in Healthy Subjects / K. B. Hansen, T. Vilsboll, J. I. Bagger [et al.] // The Journal of Clinical Endocrinology & Metabolism. - 2010. - Vol. 95, Iss. 7. - P. 3309-3317.
258. Reduced risk of heart failure with intensified multifactorial intervention in individuals with type 2 diabetes and microalbuminuria: 21 years of follow-up in the randomised Steno-2 study / J. Oellgaard, P. G^de, P. Rossing [et al.] // Diabetologia. - 2018. - Vol. 61, Iss. 8. - P. 1724-1733.
259. Regulation of insulin biosynthesis in pancreatic beta cells by an endoplasmic reticulum-resident protein kinase IRE1 / K. L. Lipson, S. G. Fonseca, S. Ishigaki [et al.] // Cell metabolism. - 2006. - Vol. 4, Iss. 3. -P. 245-254.
260. Regulation of the unfolded protein response in yeast by oxidative stress / A. Guerra-Moreno, J. Ang, H. Welsch [et al.] // FEBS letters. - 2019. - Vol. 593, Iss. 10. - P. 1080-1088.
261. Relationship between oxidative stress, ER stress, and inflammation in type 2 diabetes: the battle continues / E. Burgos-Morón, Z. Abad-Jiménez, A. M. de Marañón [et al.] // Journal of clinical medicine. - 2019. - Vol. 8, Iss. 9. - Art. 1385. - URL: https://doi.org/10.3390/jcm8091385.
262. Report of the Committee on the classification and diagnostic criteria of diabetes mellitus // Y. Seino, K. Nanjo, N. Tajima [et al.] ; The Committee of the Japan Diabetes Society on the diagnostic criteria of diabetes mellitus // Journal of diabetes investigation. - 2010. - Vol. 1, Iss. 5. - P. 212-228.
263. Restoration of visual function in P23H rhodopsin transgenic rats by gene delivery of BiP-Grp78 / M.S. Gorbatyuk, T. Knox, M.M. LaVail [et al.] // Proceedings of the National Academy of Sciences. - 2010. - Vol. 107, Iss. 13. - P. 5961-5966.
264. Recognition and potential mechanisms for replication and erasure of cytosine hydroxymethylation / H. Hashimoto, Y. Liu, A. K. Upadhyay [et al.] // Nucleic acids research. - 2012. - Vol. 40, Iss. 11. - P. 4841-4849.
265. Risk of diabetes in siblings of index cases with Type 2 diabetes: implications for genetic studies / C. F. Weijnen, S. S. Rich, J. B. Meigs [et al.] // Diabetic medicine. - 2002. - Vol. 19, Iss. 1. - P. 41-50.
266. RNA Sequencing of Single Human Islet Cells Reveals Type 2 Diabetes Genes / Y. Xin, J. Kim, H. Okamoto [et al.] // Cell metabolism. - 2016. - Vol. 24, Iss. 4. - P. 608-615.
267. RNA-sequencing identifies dysregulation of the human pancreatic islet transcriptome by the saturated fatty acid palmitate / M. Cnop, B. Abdulkarim, G. Bottu [et al.] // Diabetes. - 2014. - Vol. 63, Iss. 6. - P. 1978-1993.
268. Roden, M. The integrative biology of type 2 diabetes / M. Roden, G. I. Shulman // Nature. - 2019. - Vol. 576, No. 7785. - P. 51-60.
269. Role of the unfolded protein response in ß cell compensation and failure during diabetes / N. Rabhi, E. Salas, P. Froguel, J.-S. Annicotte // Journal of diabetes research. - 2014. - Vol. 2014. - Art. 795171. - URL: https://doi.org/10.1155/2014/795171.
270. Role of the unfolded protein response in ß cell compensation and failure during diabetes / N. Rabhi, E. Salas, P. Froguel [et al.] //Journal of diabetes research. - 2014. - Vol. 2014, Iss. 795171. - P. 1-11.
271. Ron, D. Signal integration in the endoplasmic reticulum unfolded protein response / D. Ron, P. Walter // Nature reviews. Molecular cell biology. - 2007.
- Vol. 8, Iss. 7. - P. 519-529.
272. Role of the DnaJ/Hsp40 family in the pathogenesis of insulin resistance and type 2 diabetes / A. Diane, H. Abunada, N. Khattab [et al.] // Ageing Research Reviews. - 2021. - Vol. 67. - P. 101313.
273. Role of Metabolic Risk Factors, Family History, and Genetic Polymorphisms (PPARy and TCF7L2) on Type 2 Diabetes Mellitus Risk in an Asian Indian Population / P. Chaudhuri, M. Das, I. Lodh [et al.] // Public Health Genomics. - 2021. - Vol. 24, Iss. 3-4. - P. 131-138.
274. Sahoo, J. P. Linkage disequilibrium mapping: A journey from traditional breeding to molecular breeding in crop plants / J. P. Sahoo. - Date Written: April 30, 2022. - Posted: 17 May 2022. - URL: https://ssrn.com/abstract=4099380.
275. Satoh, T. Molecular mechanisms for the regulation of insulin-stimulated glucose uptake by small guanosine triphosphatases in skeletal muscle and adipocytes / T. Satoh // International journal of molecular sciences. - 2014. -Vol. 15, Iss. 10. - P. 18677-18692.
276. Scherer, P. E. The many secret lives of adipocytes: Implications for diabetes / P. E. Scherer // Diabetologia. - 2019. - Vol. 62, Iss. 2. - P. 223-232.
277. Senft, D. UPR, autophagy, and mitochondria crosstalk underlies the ER stress response / D. Senft:, Z. A. Ronai // Trends in biochemical sciences. -2015. - Vol. 40, Iss. 3. - P. 141-148.
278. Sex differences in metabolic regulation and diabetes susceptibility / B. Tramunt, S. Smati, N. Grandgeorge [et al.] // Diabetologia. - 2020. - Vol. 63.
- P. 453-461.
279. Sex differences in the burden of type 2 diabetes and cardiovascular risk across the life course / A.G. Huebschmann, R.R. Huxley, W.M. Kohrt [et al.] //Diabetologia. - 2019. - Vol. 62. - P. 1761-1772.
280. Sex differences in heat shock protein 72 expression in peripheral blood mononuclear cells to acute exercise in the heat / T. Gillum, M. Kuennen, C. Gourley [et al.] // International Journal of Endocrinology and Metabolism. -2013. - Vol. 11, Iss. 11. - P. e8739.
281. Sex difference in the heat shock response to high external load resistance training in older humans / R. Njemini, L.N. Forti, T. Mets [et al.] // Experimental Gerontology. - 2017. - Vol. 93, Iss. 1. - P. 46-53.
282. Sex and Gender Differences in Risk, Pathophysiology and Complications of Type 2 Diabetes Mellitus / A. Kautzky-Willer, J. Harreiter, G. Pacini // Endocrine Reviews. - 2016. - Vol. 37, Iss. 3. - P. 278-316.
283. Sudagani J. Genes and type 2 diabetes: polymorphisms of the EIF2AK3 gene and its relationship to type 2 diabetes mellitus : gnc. - Queen Mary University of London, 2010.
284. Shared genetic susceptibility to ischemic stroke and coronary artery disease: a genome-wide analysis of common variants / M. Dichgans, R. Malik, I. R. Konig [et al.] // Stroke. - 2014. - Vol. 45, Iss. 1. - P. 24-36.
285. Shaw, P. Nrf2-ARE signaling in cellular protection: Mechanism of action and the regulatory mechanisms / P. Shaw, A. Chattopadhyay // Journal of Cellular Physiology. - 2020. - Vol. 235, Iss. 4. - P. 3119-3130.
286. Shin, Y. Psychological Stress Accom panied by a Low-Variety Diet Is Positively Associated with Type 2 Diabetes in Middle-Aged Adults / Y. Shin, Y. Kim // Nutrients. - 2020. - Vol. 12, Iss. 9. - Art. 2612. - URL: https://doi.org/10.3390/nu12092612.
287. Shen Y., Hendershot L.M. ERdj3, a stress-inducible endoplasmic reticulum DnaJ homologue, serves as a cofactor for BiP's interactions with unfolded substrates / Y. Shen, L.M. Hendershot // Molecular Biology of the Cell. - 2005. - Vol. 16, Iss. 1. - P. 40-50.
288. Single-cell RNA sequencing reveals maturation trajectory in human pluripotent stem cell-derived cardiomyocytes in engineered tissues / S. Cheng,
D. Breniere-Letuffe, V. Ahola [et al.] // iScience. - 2023. - Vol. 26, Iss. 4. -Art. 106302. - URL: https://doi.Org/10.1016/j.isci.2023.106302.
289. Sliwinska-Mosson, M. The impact of smoking on the development of diabetes and its complications / M. Sliwinska-Mosson, H. Milnerowicz // Diabetes and Vascular Disease Research. - 2017. - Vol. 14, Iss. 4. - P. 265276.
290. Some molecular and cellular stress mechanisms associated with neurodegenerative diseases and atherosclerosis / M. A. Sazonova, V. V. Sinyov, A. I. Ryzhkova [et al.] // International journal of molecular sciences. -2021. - Vol. 22, Iss. 2. - Art. 699. - URL: https://doi.org/10.3390/ijms22020699.
291. Schneider C., Hellerstein M. Interaction of Diet with the Metabolic Flux Signatures of the Unfolded Protein Response / C. Schneider, M. Hellerstein //Current Developments in Nutrition. - 2020. - Vol. 4, Iss. 2. - P. 697-697.
292. SNPStats: a web tool for the analysis of association studies / X. Solé, E. Guinó, J. Valls [et al.] // Bioinformatics. - 2006. - Vol. 22, Iss. 15. - P. 19281929.
293. Steiner, D. F. The biosynthesis of insulin / D. F. Steiner // Pancreatic Beta Cell in Health and Disease. - Springer, Tokyo, 2008. - P. 31-49.
294. Stress-induced self-cannibalism: on the regulation of autophagy by endoplasmic reticulum stress / S. Deegan, S. Saveljeva, A. M. Gorman, A. Samali // Cellular and molecular life sciences. - 2013. - Vol. 70, Iss. 14. -P. 2425-2441.
295. Structural lessons from the mutant proinsulin syndrome / B. Dhayalan, D. Chatterjee, Y.-S. Chen, M. A. Weiss // Frontiers in endocrinology. - 2021. -Vol. 12. - Art. 754693. - URL: https://doi.org/10.3389/fendo.2021.754693.
296. Stumvoll, M. Type 2 diabetes: principles of pathogenesis and therapy / M. Stumvoll, B. J. Goldstein, T. W. Van Haeften // The Lancet. - 2005. - Vol. 365, Iss. 9467. - P. 1333-1346.
297. Systematic identification of genetic influences on methylation across the human life course / T. R. Gaunt, H. A. Shihab, G. Hemani [et al.] // Genome biology. - 2016. - Vol. 17. - Art. 61. - URL: https://doi.org/10.1186/s13059-016-0926-z.
298. Szkudelska, K. The anti-diabetic potential of betaine. Mechanisms of action in rodent models of type 2 diabetes / K. Szkudelska, T. Szkudelski // Biomedicine & Pharmacotherapy. - 2022. - Vol. 150. - Art. 112946. - URL: https://doi.org/10.1016/j.biopha.2022.112946.
299. Testosterone levels and type 2 diabetes in men: current knowledge and clinical implications / A. M. Beatrice, D. Dutta, M. Kumar [et al.] // Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy. - 2014. - Vol. 7, Iss. 1. - p. 481-486.
300. Type 2 diabetes as a protein misfolding disease / A. Mukherjee, D. Morales-Scheihing, P. C. Butler [et al.] // Trends in molecular medicine. -2015. - Vol. 21, Iss. 7. - P. 439-449.
301. The eIF2a/ATF4 pathway is essential for stress-induced autophagy gene expression / W. B'Chir, A.-C. Maurin, V. Carraro [et al.] // Nucleic acids research. - 2013. - Vol. 41, Iss. 16. - P. 7683-7699.
302. The chaperone balance hypothesis: the importance of the extracellular to intracellular HSP70 ratio to inflammation-driven type 2 diabetes, the effect of exercise, and the implications for clinical management / M. Krause, T. G. Heck, A. Bittencourt [et al.] // Mediators of inflammation. - 2015. - Vol. 2015. 8. - P. 12-24.
303. The folding nucleus of the insulin superfamily: a flexible peptide model foreshadows the native state / Q. Hua, J. P. Mayer, W. Jia [et al.] // Journal of Biological Chemistry. - 2006. - Vol. 281, Iss. 38. - P. 28131-28142.
304. The Folding Nucleus of the Insulin Superfamily: A Flexible Peptide Model Foreshadows the Native State / Q.-X. Hua, J. Mayer, W. Jia [et al.] // The Journal of biological chemistry. - 2006. - Vol. 281, Iss. 38. - P. 281312842.
305. The polygenic nature of inhibitors in hemophilia A: results from the Hemophilia Inhibitor Genetics Study (HIGS) Combined Cohort / J. Astermark, S. M. Donfield, E. D. Gomperts [et al.] // Blood, The Journal of the American Society of Hematology. - 2013. - Vol. 121, Iss. 8. - P. 1446-1454.
306. The landscape of molecular chaperones across human tissues reveals a layered architecture of core and variable chaperones / N. Shemesh, J. Jubran, S. Dror [et al.] // Nature Communications. - 2021. - Vol. 12, Iss. 12. - P. 2180.
307. The estimates of effective population size based on linkage disequilibrium are virtually unaffected by natural selection / I. Novo, E.Santiago, A. Caballero, //PLoS Genetics. - 2022. - Vol.18, Iss. 1. - P. e1009764.
308. The role of ethnicity in predicting diabetes risk at the population level / L.C. Rosella, C. A. Mustard, T. A. Stukel [et al.] // Ethnicity & health. - 2012.
- Vol. 17, Iss. 4. - P. 419-437.
309. Tumor Necrosis Factor Receptor Superfamily Member 21 Induces Endothelial-Mesenchymal Transition in Coronary Artery Endothelium of Type 2 Diabetes Mellitus / P.C. Hsu, J.C. Huang, W.C. Tsai [et al.] // Biomedicines.
- 2022. - Vol. 10, Iss. 6. - P. 1282.
310. The genetic architecture of type 2 diabetes / C. Fuchsberger, J. Flannick, T. M. Teslovich [et al.] // Nature. - 2016. - Vol. 536, No. 7614. - P. 41-47.
311. The role of estrogens in control of energy balance and glucose homeostasis / F. Mauvais-Jarvis, D.J. Clegg, A.L. Hevener // Endocrine Reviews. - 2013. - Vol. 34, Iss. 3. - P. 309 - 381.
312. The mitochondrial disulfide relay system protein GFER is mutated in autosomal-recessive myopathy with cataract and combined respiratory-chain deficiency / A. Di Fonzo, D. Ronchi, T. Lodi [et al.] // American journal of human genetics. - 2009. - Vol. 84, Iss. 5. - P. 594-604.
313. The NHGRI-EBI GWAS Catalog of published genome-wide association studies, targeted arrays and summary statistics 2019 / A. Buniello,
J. A. L. MacArthur, M. Cerezo [et al.] // Nucleic acids research. - 2018. - Vol. 47, Iss. D1. - P. D1005-D1012.
314. The NHGRI-EBI GWAS Catalog: knowledgebase and deposition resource / E. Sollis, A. Mosaku, A. Abid [et al.] // Nucleic Acids Research. -2023. - Vol. 51, Iss. D1. - P. D977-D985.
315. The role of CHOP messenger RNA expression in the link between oxidative stress and apoptosis / Y. Ariyama, Y. Tanaka, H. Shimizu [et al.] // Metabolism. - 2008. - Vol. 57, no. 12. - P. 1625-1635.
316. The UK Biobank resource with deep phenotyping and genomic data / C. Bycroft, C. Freeman, D. Petkova [et al.] // Nature. - 2018. - Vol. 562, Iss. 7726. - P. 203-209.
317. Therapeutic opportunities for pancreatic P-cell ER stress in diabetes mellitus / J. Yong, J. D. Johnson, P. Arvan [et al.] // Nature Reviews Endocrinology. - 2021. - Vol. 17, Iss. 8. - P. 455-467.
318. Thevenod, F. Ion channels in secretory granules of the pancreas and their role in exocytosis and release of secretory proteins / F. Thevenod // American Journal of Physiology-Cell Physiology. - 2002. - Vol. 283, Iss. 3. - P. C651-C672.
319. Three novel Bid proteins generated by alternative splicing of the human Bid gene / S.A. Renshaw, C.E. Dempsey, F.A. Barnes [et al.] // Journal of Biological Chemistry. - 2004. - Vol. 279, Iss. 4. -P. 2846-2855.
320. Trajectories of glycaemia, insulin sensitivity, and insulin secretion before diagnosis of type 2 diabetes: an analysis from the Whitehall II study / A. G. Tabak, M. Jokela, T. N. Akbaraly [et al.] // The Lancet. - 2009. - Vol. 373, Iss. 9682. - P. 2215-2221.
321. Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis / B. F. Voight, L. J. Scott, V. Steinthorsdottir [et al.] // Nature genetics. - 2010. - Vol. 42, Iss. 7. - P. 579-589.
322. Type 1 and type 2 diabetes in Asian and Pacific Islander US youth: the SEARCH for Diabetes in Youth Study / L. L. Liu, J. P. Yi, J. Beyer [et al.] // Diabetes Care. - 2009. - Vol. 32, Iss. Suppl. 2. - P. S133-S140.
323. Type 2 Diabetes and Congenital Hyperinsulinism Cause DNA DoubleStrand Breaks and p53 Activity in p Cells / S. Tornovsky-Babeay, D. Dadon, O. Ziv [et al.] // Cell Metabolism. - 2014. - Vol. 19, Iss. 1. - P. 109-121.
324. Type 2 diabetes as a protein misfolding disease / A. Mukherjee, D. Morales-Scheihing, P. C. Butler, C. Soto // Trends in molecular medicine. -2015. - Vol. 21, Iss. 7. - P. 439-449.
325. Type 2 diabetes susceptibility gene GRK5 regulates physiological pancreatic p-cell proliferation via phosphorylation of HDAC5 in mice / S. Sasaki, C. Nian, E. E. Xu [et al.] // bioRxiv. - 2022. - Publication date: 2022.12. 23. - URL: https://doi.org/10.1101/2022.12.23.521810.
326. Type 2 diabetes-associated genetic polymorphisms as potential disease predictors / B. Z. Witka, D. J. Oktaviani, M. Marcellino [et al.] // Diabetes, metabolic syndrome and obesity: targets and therapy. - 2019. - Vol. 12. -P. 2689-2706.
327. Upregulation of heat shock proteins (HSPA12A, HSP90B1, HSPA4, HSPA5 and HSPA6) in tumour tissues is associated with poor outcomes from HBV-related early-stage hepatocellular carcinoma / Z. Yang, L. Zhuang, P. Szatmary [et al.] // International journal of medical sciences. - 2015. - Vol. 12, Iss. 3. - P. 256-263.
328. Unraveling the polygenic architecture of complex traits using blood eQTL metaanalysis / U. Vosa, A. Claringbould, H. J. Westra [et al.] // BioRxiv. - 2018. - Art. 447367. - URL: http://doi.org/10.1101/447367 (date of application: 10.01.2019).
329. UniprotR: Retrieving and visualizing protein sequence and functional information from Universal Protein Resource (UniProt knowledgebase) / M. Soudy, A. M. Anwar, E. A. Ahmed [et al.] //Journal of proteomics. - 2020. -Vol. 213. - P. 103613.
330. Variants in KCNQ1 are associated with susceptibility to type 2 diabetes mellitus / K. Yasuda, K. Miyake, Y. Horikawa [et al.] // Nat Genet. - 2008. -Vol. 40, Iss. 40. - P. 1092-1097.
331. Variants in MTNR1B influence fasting glucose levels / I. Prokopenko, C. Langenberg, J. C. Florez [et al.] // Nature genetics. - 2009. - Vol. 41, Iss. 1.
- P. 77-81.
332. Variants of HSPA1A in combination with plasma Hsp70 and anti-Hsp70 antibody levels associated with higher risk of acute coronary syndrome / X. Zhang, R. M. Tanguay, M. He [et al.] // Cardiology. - 2011. - Vol. 119, Iss. 1.
- P. 57-64.
333. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes / S. F. Grant, G. Thorleifsson, I. Reynisdottir [et al.] // Nature genetics. - 2006. - Vol. 38, Iss. 3. - P. 320-323.
334. Verhoeven, K. J. Implementing false discovery rate control: increasing your power / K. J. Verhoeven, K. L. Simonsen, L. M. McIntyre // Oikos. -2005. - Vol. 108, Iss. 3. - P. 643-647.
335. Wang, Q. The role of insulin signaling in the development of P-cell dysfunction and diabetes / Q. Wang, T. Jin // Islets. - 2009. - Vol. 1, Iss. 2. -P. 95-101.
336. Wen, X. Emerging roles of GLIS3 in neonatal diabetes, type 1 and type 2 diabetes / X. Wen, Y. Yang // Journal of molecular endocrinology. - 2017. -Vol. 58, Iss. 2. - P. R73-R85.
337. Whitesell, L. HSP90 and the chaperoning of cancer / L. Whitesell, S. L. Lindquist // Nature reviews. Cancer. - 2005. - Vol. 5, Iss. 10. - P. 761772.
338. Williams, K. T. Tissue-specific alterations of methyl group metabolism with DNA hypermethylation in the Zucker (type 2) diabetic fatty rat / Williams K. T., Schalinske K. L. // Diabetes/metabolism research and reviews. - 2012. -Vol. 28, Iss. 2. - P. 123-131.
339. WikiPathways: a multifaceted pathway database bridging metabolomics to other omics research / D. N. Slenter, M. Kutmon, K. Hanspers [et al.] //Nucleic acids research. - 2018. - Vol. 46, Iss. D1. - P. D661-D667.
340. Wysham, C. Beta-cell failure in type 2 diabetes: mechanisms, markers, and clinical implications / C. Wysham, J. Shubrook // Postgraduate Medicine.
- 2020. - Vol. 132, Iss. 8. - P. 676-686.
341. Xu, Z. SNPinfo: integrating GWAS and candidate gene information into functional SNP selection for genetic association studies / Z. Xu, J. A. Taylor // Nucleic acids research. - 2009. - Vol. 37, suppl. 2. - P. W600-W605.
342. Yuan, S. An atlas on risk factor s for type 2 diabetes: a wide-angled Mendelian randomisation study / S. Yuan, S. C. Larsson // Diabetologia. -2020. - Vol. 63, Iss. 11. - P. 2359-2371.
343. Zhu, Q. The ER stress-autophagy axis: implications for cognitive dysfunction in diabetes mellitus / Q. Zhu // Clinical Science (London). - 2020.
- Vol. 134, Iss. 11. - P. 1255-1258.
344. ß-Cell Autophagy Pathway and Endoplasmic Reticulum Stress Regulating-Role of Liposomal Curcumin in Experimental Diabetes Mellitus: A Molecular and Morphometric Study / S. I. Khater, M. F. Dowidar, A. E. Abdel-Aziz [et al.] // Antioxidants. - 2022. - Vol. 11, Iss. 12. - Art. 2400. -URL: https://doi.org/10.3390/antiox11122400.
345. ß-cell failure in type 2 diabetes: Postulated mechanisms and prospects for prevention and treatment / P. A. Halban, K. S. Polonsky, D. W. Bowden [et al.] // Diabetes Care. - 2014. - Vol. 37, Iss. 6. - P. 1751-1758.
346. ß-cell mass dynamics and islet cell plasticity in human type 2 diabetes / S. C. Hanley, E. Austin, B. Assouline-Thomas [et al.] // Endocrinology. -2010. - Vol. 151, Iss. 4. - P. 1462-1472.
347. 245-LB: An Ankyrin-B-Mediated Protein Chaperone Mechanism Modulates Pancreatic ß-Cell Susceptibility to Proteotoxicity-Induced ER Stress and Apoptosis / J. Tzeng, H. E. Hohmeier, D. Lorenzo // Diabetes. - 2022. -Vol. 71, Iss. 1. - P. 85
ПРИЛОЖЕНИЕ 1 Структура последовательностей праймеров, использованных
для генотипирования полиморфных вариантов ГРФБ и UPR
Ген, SNP ID Последовательности прямых (F) праймеров
Последовательности обратных (R) праймеров
Последовательности Extended праймеров
1 2
HSP90AA1 A>C rs11621560 ACGTTGGATGAACCCCAAGTTCTTCCACTC
ACGTTGGATGTGTTGTTGAGGAAGGAAGAG
gaGCTGGACAGAAAAGGC
HSP90AB1 A>C rs2070695 ACGTTGGATGAGCACAATTAGGGCTTCCTG
ACGTTGGATGCTCTTTGCTCTCACCTGTAG
GTAGGGTAATTAAATGAACTCAG
HSP90B1 A>T rs1165682 ACGTTGGATGAAAGGTAGCCTACTGCTGTG
ACGTTGGATGGCCTCTGAATATTGTCTTGG
GTTAAAATGGAAACCTTTATAAAATAT
HSP90B1 T>C rs10861147 ACGTTGGATGCCTTGTCTAGGTCTCACTAC
ACGTTGGATGAAGTAGAAGCTGCTGGTTAG
actaaTGGGCTCTGTGTTCATG
HSP90B1 A>G rs10778306 ACGTTGGATGAACTGTGTACACCGAGTAAG
ACGTTGGATGGTCAATAAGTCCCAAGAGGC
gCCAAGAGGCCAAATTTTAAAATA
HSP90B1 G>A rs1882019 ACGTTGGATGCAAACGGGCAAGGACATCTC
Обратите внимание, представленные выше научные тексты размещены для ознакомления и получены посредством распознавания оригинальных текстов диссертаций (OCR). В связи с чем, в них могут содержаться ошибки, связанные с несовершенством алгоритмов распознавания. В PDF файлах диссертаций и авторефератов, которые мы доставляем, подобных ошибок нет.